RESUMEN
During the ripening of sweet pepper (Capsicum annuum L.) fruits, in a genetically controlled scenario, enormous metabolic changes occur that affect the physiology of most cell compartments. Peroxisomal catalase gene expression decreases after pepper fruit ripening, while the enzyme is also susceptible to undergo post-translational modifications (nitration, S-nitrosation, and oxidation) promoted by reactive oxygen and nitrogen species (ROS/RNS). Unlike most plant catalases, the pepper fruit enzyme acts as a homodimer, with an atypical native molecular mass of 125 to 135 kDa and an isoelectric point of 7.4, which is higher than that of most plant catalases. These data suggest that ROS/RNS could be essential to modulate the role of catalase in maintaining basic cellular peroxisomal functions during pepper fruit ripening when nitro-oxidative stress occurs. Using catalase from bovine liver as a model and biotin-switch labeling, in-gel trypsin digestion, and nanoliquid chromatography coupled with mass spectrometry, it was found that Cys377 from the bovine enzyme could potentially undergo S-nitrosation. To our knowledge, this is the first report of a cysteine residue from catalase that can be post-translationally modified by S-nitrosation, which makes it especially important to find the target points where the enzyme can be modulated under either physiological or adverse conditions.
RESUMEN
We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.
Asunto(s)
Secuencias Repetitivas Esparcidas/genética , Pseudomonas putida/genética , Secuencias Repetitivas de Ácidos Nucleicos/genética , Secuencia de Aminoácidos , Secuencia de Bases , Cromosomas Bacterianos/genética , Datos de Secuencia Molecular , Plásmidos/genética , Transposasas/química , Transposasas/genética , Transposasas/metabolismoRESUMEN
Pseudomonas putida KT2440, a paradigm organism in biodegradation and a good competitive colonizer of the maize rhizosphere, was the subject of studies undertaken to establish the genetic determinants important for its rhizospheric lifestyle. By using in vivo expression technology (IVET) to positively select single cell survival, we identified 28 rap genes (root-activated promoters) preferentially expressed in the maize rhizosphere. The IVET system had two components: a mutant affected in aspartate-beta-semialdehyde dehydrogenase (asd), which was unable to survive in the rhizosphere, and plasmid pOR1, which carries a promoter-less asd gene. pOR1-borne transcriptional fusions of the rap promoters to the essential gene asd, which were integrated into the chromosome at the original position of the corresponding rap gene, were active and allowed growth of the asd strain in the rhizosphere. The fact that five of the rap genes identified in the course of this work had been formerly characterized as being related to root colonization reinforced the IVET approach. Up to nine rap genes encoded proteins either of unknown function or that had been assigned an unspecific role based on conservation of the protein family domains. Rhizosphere-induced fusions included genes with probable functions in the cell envelope, chemotaxis and motility, transport, secretion, DNA metabolism and defense mechanism, regulation, energy metabolism, stress, detoxification, and protein synthesis.
Asunto(s)
Regulación Bacteriana de la Expresión Génica/fisiología , Raíces de Plantas/microbiología , Regiones Promotoras Genéticas/fisiología , Pseudomonas putida/genética , Zea mays/microbiología , Proteínas Bacterianas/biosíntesis , Perfilación de la Expresión Génica , Hidroponía , Pseudomonas putida/metabolismo , PlantonesRESUMEN
The solvent-tolerant strain Pseudomonas putida DOT-T1E has been engineered for biotransformation of toluene into 4-hydroxybenzoate (4-HBA). P. putida DOT-T1E transforms toluene into 3-methylcatechol in a reaction catalyzed by toluene dioxygenase. The todC1C2 genes encode the alpha and beta subunits of the multicomponent enzyme toluene dioxygenase, which catalyzes the first step in the Tod pathway of toluene catabolism. A DOT-T1EdeltatodC mutant strain was constructed by homologous recombination and was shown to be unable to use toluene as a sole carbon source. The P. putida pobA gene, whose product is responsible for the hydroxylation of 4-HBA into 3,4-hydroxybenzoate, was cloned by complementation of a Pseudomonas mendocina pobA1 pobA2 double mutant. This pobA gene was knocked out in vitro and used to generate a double mutant, DOT-T1EdeltatodCpobA, that was unable to use either toluene or 4-HBA as a carbon source. The tmo and pcu genes from P. mendocina KR1, which catalyze the transformation of toluene into 4-HBA through a combination of the toluene 4-monoxygenase pathway and oxidation of p-cresol into the hydroxylated carboxylic acid, were subcloned in mini-Tn5Tc and stably recruited in the chromosome of DOT-T1EdeltatodCpobA. Expression of the tmo and pcu genes took place in a DOT-T1E background due to cross-activation of the tmo promoter by the two-component signal transduction system TodST. Several independent isolates that accumulated 4-HBA in the supernatant from toluene were analyzed. Differences were observed in these clones in the time required for detection of 4-HBA and in the amount of this compound accumulated in the supernatant. The fastest and most noticeable accumulation of 4-HBA (12 mM) was found with a clone designated DOT-T1E-24.