Identification of two novel putative satellite RNAs with hammerhead structures in the virome of French and Spanish carrot samples.

Carrot virome analysis using high-throughput sequencing revealed the presence of two RNA molecules with properties of satellite RNAs that are homologous to the satellite RNA of cereal yellow dwarf virus-RPV (CYDV-RPV). Satellite 1 is 298 nt long, while satellite 2 is 368 nt long. Their positive and negative genome strands contain hammerhead ribozymes similar to those found in other self-cleaving satellite RNAs. While both satellites were detected in Spanish carrot populations, only satellite 2 was found in French carrot populations. The most likely helper virus for these two satellites is carrot red leaf virus (CtRLV), which, like CYDV-RPV, is a polerovirus.

Complete genome sequence of cherry virus T, a novel cherry-infecting tepovirus.

Double-stranded RNA and total RNA purified from sour cherry leaves (Prunus cerasus, cv. Amarelka Chvalkovicka) was analyzed by high-throughput sequencing. BLAST annotation identified contigs with homology to several already known cherry-infecting viruses (prune dwarf virus, prunus necrotic ringspot virus, prunus virus F, little cherry virus 1) as well as contigs with sequences more distantly related to those of members of the family Betaflexiviridae and in particular to prunus virus T of the genus Tepovirus. The full genome sequence of a putative virus (6,847 nucleotides [nt]; GenBank no. MT090966) was assembled and completed at the genome ends. The genome has a typical tepovirus organization, containing three overlapping open reading frames (ORFs), encoding a replication-associated protein, a movement protein and a capsid protein, respectively. Both its genome organization and its phylogenetic relationships show that the virus belongs to the genus Tepovirus, but considering the species demarcation criteria for the family Betaflexiviridae, it appears to represent a novel virus species, and we propose the name "cherry virus T" (ChVT) for this virus.

Complete genome sequence of a novel grapevine-infecting member of the genus Polerovirus, grapevine polerovirus 1.

Double-stranded RNAs and total RNAs purified from grapevine (Vitis vinifera) phloem scrapings of two varieties held in the INRAE (France) grapevine germplasm collection were analyzed by high-throughput sequencing. BLAST annotation revealed contigs with homology to Polerovirus genus members. The full genome sequence of one isolate (KT) was determined (5651 nucleotides [nt]), and a partial sequence representing about half of the genome was assembled for a second isolate (KS) that was found to share 95% nt sequence identity with the KT isolate. The genome has a typical polerovirus organization, containing six open reading frames (ORFs) as well as a putative additional ORF3a. Based on genome organization and phylogenetic relationships, the new virus belongs to the genus Polerovirus but, similar to the recently described persimmon polerovirus 1, is characterized by a highly divergent coat-protein/readthrough domain. Considering the species demarcation criteria for the family Luteoviridae, these two isolates, together with a closely related sequence recently deposited in the GenBank database (LC507098), represent a new Polerovirus species for which the name "Grapevine polerovirus 1" is proposed.

Status of the current vitivirus taxonomy.

Since the establishment of the genus Vitivirus, several additional viruses have been sequenced and proposed to represent new species of this genus. Currently, the International Committee on Taxonomy of Viruses recognizes 15 vitivirus species. The report of new vitiviruses that fail to completely adhere to the species demarcation criteria, the incorporation of non-vitivirus grapevine viruses in the unofficial "naming system", and the existence of non-grapevine vitiviruses lead to inconsistencies in classification. In this report, we give a brief overview of vitiviruses and use currently available information to clarify the present status of the vitivirus taxonomy.

Biological and Genetic Characterization of New and Known Necroviruses Causing an Emerging Systemic Necrosis Disease of Corn Salad (Valerianella locusta) in France.

An emerging systemic necrosis disease of corn salad was first observed in the Nantes region of France in the late 2000s. Classical virology and high-throughput sequencing approaches demonstrated that the disease is associated with four different necroviruses: tobacco necrosis virus A (TNVA), tobacco necrosis virus D (TNVD), olive mild mosaic virus (OMMV), and a novel recombinant Alphanecrovirus for which the name corn salad necrosis virus (CSNV) is proposed. Satellite tobacco necrosis virus was also frequently observed. Koch's postulates were completed for all four agents, each one alone being able to cause systemic necrosis of varying severity in corn salad. OMMV was the most frequently observed virus and causes the most severe symptoms. TNVA was the second, both in terms of prevalence and symptom severity while TNVD and CSNV were only rarely observed and caused the less severe symptoms. The emergence of this systemic disease may have been favored by the short and repeated cropping cycles used for corn salad, possibly allowing the selection of necrovirus isolates with an improved ability to systemically invade this specialty crop.

Complete Nucleotide Sequence of an Isolate of Grapevine Satellite Virus and Evidence for the Presence of Multimeric Forms in an Infected Grapevine.

The complete nucleotide sequence of an isolate of grapevine satellite virus (GV-Sat) was determined by next-generation sequencing (NGS) and compared with the single available complete sequence. The NGS data unexpectedly provided evidence for the existence of multimeric forms of GV-Sat, which were experimentally confirmed, allowing the redefinition of GV-Sat genomic ends.

Complete Nucleotide Sequence of a French Isolate of Maize rough dwarf virus, a Fijivirus Member in the Family Reoviridae.

The complete nucleotide sequence of a French isolate of Maize rough dwarf virus (MRDV) was determined by next-generation sequencing and compared with the single available complete sequence and with the partial sequences of two additional isolates available in online databases.

Allelic variation at the rpv1 locus controls partial resistance to Plum pox virus infection in Arabidopsis thaliana.

BACKGROUND: Sharka is caused by Plum pox virus (PPV) in stone fruit trees. In orchards, the virus is transmitted by aphids and by grafting. In Arabidopsis, PPV is transferred by mechanical inoculation, by biolistics and by agroinoculation with infectious cDNA clones. Partial resistance to PPV has been observed in the Cvi-1 and Col-0 Arabidopsis accessions and is characterized by a tendency to escape systemic infection. Indeed, only one third of the plants are infected following inoculation, in comparison with the susceptible Ler accession. RESULTS: Genetic analysis showed this partial resistance to be monogenic or digenic depending on the allelic configuration and recessive. It is detected when inoculating mechanically but is overcome when using biolistic or agroinoculation. A genome-wide association analysis was performed using multiparental lines and 147 Arabidopsis accessions. It identified a major genomic region, rpv1. Fine mapping led to the positioning of rpv1 to a 200 kb interval on the long arm of chromosome 1. A candidate gene approach identified the chloroplast phosphoglycerate kinase (cPGK2) as a potential gene underlying the resistance. A virus-induced gene silencing strategy was used to knock-down cPGK2 expression, resulting in drastically reduced PPV accumulation. CONCLUSION: These results indicate that rpv1 resistance to PPV carried by the Cvi-1 and Col-0 accessions is linked to allelic variations at the Arabidopsis cPGK2 locus, leading to incomplete, compatible interaction with the virus.

Complete Nucleotide Sequence of Artichoke latent virus Shows it to be a Member of the Genus Macluravirus in the Family Potyviridae.

Complete genomic sequences of Artichoke latent virus (ArLV) have been obtained by classical or high-throughput sequencing for an ArLV isolate from Italy (ITBr05) and for two isolates from France (FR37 and FR50). The genome is 8,278 to 8,291 nucleotides long and has a genomic organization comparable with that of Chinese yam necrotic mosaic virus (CYNMV), the only macluravirus fully sequenced to date. The cleavage sites of the viral polyprotein have been tentatively identified by comparison with CYNMV, confirming that macluraviruses are characterized by the absence of a P1 protein, a shorter and N-terminally truncated coat protein (CP). Sequence comparisons firmly place ArLV within the genus Macluravirus, and confirm previous results suggesting that Ranunculus latent virus (RALV), a previously described Macluravirus sp., is very closely related to ArLV. Serological relationships and comparisons of the CP gene and of the partial RaLV sequence available all indicate that RaLV should not be considered as a distinct species but as a strain of ArLV. The results obtained also suggest that the spectrum of currently used ArLV-specific molecular hybridization or polymerase chain reaction detection assays should be improved to cover all isolates and strains in the ArLV species.

First Report of Grapevine Pinot gris virus (GPGV) in grapevine in France.

Grapevine Pinot gris virus (GPGV), belonging to the genus Trichovirus of the family Betaflexiviridae, was first identified by siRNA sequencing in northern Italy in 2012, in the grapevine varieties Pinot gris, Traminer, and Pinot Noir, which exhibited mottling and leaf deformation (1), and in asymptomatic vines, with a lower frequency. Since 2012, this virus has also been reported in South Korea, Slovenia, Greece (3), Czech Republic (2), Slovakia (2), and southern Italy (4). In 2014, GPGV was identified by Illumina sequencing of total RNAs extracted from leaves of the Merlot variety (Vitis vinifera) grafted onto Gravesac rootstock originated from a vineyard in the Bordeaux region of France. This Merlot plant exhibited fanleaf-like degeneration symptoms associated with Tomato black ring virus (TBRV) infection. Cuttings were collected in 2010 and maintained thereafter in a greenhouse. The full-length genome was assembled either de novo or by mapping of the Illumina reads on a reference GPGV genome (GenBank FR877530) using the CLC Genomics workbench software (CLC Bio, Qiagen, USA). The French GPGV isolate "Mer" (7,223 nucleotides, GenBank KM491305) is closely related to other European GPGV sequences; it exhibits 95.4% nucleotide identity with the reference Italian isolate (NC_015782) and 98 to 98.3% identity with Slovak isolates (KF134123 to KF134125). The higher divergence between French and Italian GPGV isolates was mainly due to differences in the 5' extremity of the genome, as already shown with the Slovak GPGV isolates. RNA extracted from phloem scrapings of 19 cv. Merlot vines from the same plot collected in 2014 were analyzed by RT-PCR using the specific primer pair Pg-Mer-F1 (5'-GGAGTTGCCTTCGTTTACGA-3') and Pg-Mer-R1 (5'-GTACTTGATTCGCCTC GCTCA-3'), designed on the basis of alignments of all available GPGV sequences from GenBank. The resulting amplicon of 770 bp corresponded to a fragment of the putative movement protein (MP) gene. Seven (35%) of the tested plants gave a strong positive amplification. Three RT-PCR products were directly sequenced and showed 99.3 to 99.5% identity within the MP gene of the GPGV-Mer isolate. Given the mixed viral infection status of the vines found infected by GPGV, it was not possible to associate a specific symptomatology with the presence of GPGV. Furthermore, similar RT-PCR tests were also performed on RNA extracts prepared from two plants of cv. Carignan that originated from a French grapevine collection, exhibiting fanleaf-like symptoms without any nepovirus detection. These samples similarly gave a strong positive amplification. The sequences obtained from the two Carignan vines showed 98.4 and 97.8% identity with the GPGV-Mer isolate. To our knowledge, this is the first report of GPGV in France. GPGV has been discovered in white and red berry cultivars, suggesting that its prevalence could be important in European vineyards (2). Further large-scale studies will be essential to determine the world prevalence of GPGV and to evaluate its potential effects on yield and on wine quality, as well as to shed light on GPGV epidemiology. Of particular concern is whether, like the other grapevine-infecting Trichovirus, Grapevine berry inner necrosis virus (GPGV) can be transmitted by the eryophid mite Colomerus vitis. References: (1) A. Giampetruzzi et al. Virus Res. 163: 262, 2012. (2) M. Glasa et al. Arch. Virol. 159: 2103, 2014. (3) G. P. Martelli, J. Plant Pathol. 96: S105, 2014. (4) M. Morelli et al. J. Plant Pathol. 96:431, 2014.

First Report of Grapevine redglobe virus (GRGV) in Grapevine in France.

The isometric virus Grapevine redglobe virus (GRGV), was first described on grapevine cv. Red Globe in southern Italy in 2000 (3) and later in Greece and California. GRGV belongs to the genus Maculavirus in the family Tymoviridae. These viruses are thought to be disseminated through propagation and grafting, as no vectors or seed transmission are known to date. A partial sequence (2,006 nucleotides [nt]) encompassing the 3' end of the replicase, the coat protein, and P17 genes, was obtained in 2003 (1). GRGV infections are apparently symptomless (2). In 2014, GRGV was identified by Illumina sequencing of total RNAs extracted from a Vitis vinifera cv. Cabernet franc (CF) vine grafted onto Gravesac in a vineyard of the Bordeaux region in France. This Cabernet franc plant displayed fanleaf-like degeneration symptoms associated with Tomato black ring virus (TBRV) infection. It had been collected in 2010 and maintained since in a greenhouse. The partial contigs assembled from the Illumina reads (552 and 430 nt, both in the putative replicase gene, KM491303 and KM491304) showed 85.9 and 86.3% nt identity with the partial sequence of a GRGV Italian isolate (AF521577), respectively. Total RNA extracts from leaves of 18 plants of cv. Cabernet franc from the same plot, collected in 2014, were analyzed by RT-PCR using specific primers RG-CF-F1 (5'-GAATTCGCTGTCGGCCACTC-3') and RG-CF-R1 (5'-AGTGAGAGGAGAGATTCCATC-3') designed on the basis of the alignment of the partial sequences of GRGV-CF and the Italian isolate (AF521577). Fifteen (83%) of the plants gave strong positive amplification for GRGV. Given the mixed viral infection status of these vines, it was not possible to associate a specific symptomatology with the presence of GRGV. Two RT-PCR amplicons were directly sequenced and showed 91.5 and 91.7% identities, respectively, with the reference GRGV-CF sequence. To our knowledge, this is the first report of GRGV in France. Further studies will be necessary to determine the prevalence of GRGV in the French vineyards and varieties, including rootstocks, and its possible threat to the grapevine industry. Studies are also needed to assess the pathogenicity of GRGV. Similarly to its close relative, Grapevine fleck virus, does it induce latent or semi-latent infections in Vitis vinifera and rootstock hybrids, influencing vigor, rooting ability, and graft compatibility? References: (1) N. Abou Ghanem-Sabanadzovic et al. Virus Genes 27:11, 2003. (2) G. P. Martelli et al. Arch. Virol. 147:1847, 2002. (3) S. Sabanadzovic et al. Arch. Virol. 145:553, 2000.

First Report of the Presence of Plum pox virus Rec Strain in France.

Plum pox virus (PPV) is the most detrimental virus in stone fruit crops (Prunus sp.). At least nine monophyletic PPV strains are recognized, three of which, PPV-D, PPV-M, and PPV-Rec, have broad distributions (2). PPV-Rec is characterized by a unique founding recombination event and has been reported mostly from Central and South-Central Europe (2). It is generally considered poorly adapted to peach, and the weak and transient symptoms it causes in the GF305 peach seedling indicator may complicate its biological detection (2). During surveys in the Alsace region of France in spring 2013, a plum orchard with trees (Prunus domestica cv. Quetsche d'Alsace 3066) showing dubious leaf symptoms possibly reminiscent of PPV infection was identified. Testing of material from this plant by ELISA (Bioreba AG, Switzerland) gave clear positive reactions, putting the overall infection rate of the orchard at 6.25%, while a second nearby orchard was found infected at a rate of 0.8%. The presence of PPV was confirmed by polymerase chain reaction (PCR) amplification using either the P1-P2 polyvalent primer pair or the P3M-P4b primer pair, which allows the specific amplification of isolates of the Rec and M strains (1). Sequencing of the 467-nt-long P3M-P4b PCR product (Genbank Accession No. KM035763), which spans the end of the NIb gene and the N-terminal hypervariable end of the coat protein gene, provided clear identification of the PPV isolate as belonging to the Rec strain, since it contained all the PPV-Rec specific mutations in the amplified region and showed 98.7 to 97.7% identity with a range of PPV Rec isolates mostly originating from the Balkans. Identification as a PPV-Rec isolate was also confirmed using a strain-specific reverse-transcription-PCR assay (3). This is, to our knowledge, the first report of the presence of PPV-Rec in France. This finding is worrisome given that PPV-Rec is considered well adapted to plum (2), the most important Prunus crop in Alsace. Further surveillance in Alsace during 2014 failed to provide evidence for the presence of PPV-Rec in other areas of the region away from the initial infection focus, which is currently undergoing eradication efforts. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) J. A. García et al. Mol. Plant Pathol. 15:226, 2014. (3) Z. Subr et al. Acta Virol. 48:173, 2004.

Key mutations in the cylindrical inclusion involved in lettuce mosaic virus adaptation to eIF4E-mediated resistance in lettuce.

We previously showed that allelic genes mol¹ and mo1² used to protect lettuce crops against Lettuce mosaic virus (LMV) correspond to mutant alleles of the gene encoding the eukaryotic translation initiation factor 4E. LMV resistance-breaking determinants map not only to the main potyvirus virulence determinant, a genome-linked viral protein, but also to the C-terminal region of the cylindrical inclusion (CI), with a key role of amino acid at position 621. Here, we show that the propagation of several non-lettuce isolates of LMV in mo1¹ plants is accompanied by a gain of virulence correlated with the presence in the CI C terminus of a serine at position 617 and the accumulation of mutations at positions 602 or 627. Whole-genome sequencing of native and evolved isolates showed that no other mutation could be associated with adaptation to mo1 resistance. Site-directed mutagenesis pinpointed the key role in the virulence of the combination of mutations at positions 602 and 617, in addition to position 621. The impact of these mutations on the fitness of the virus was evaluated, suggesting that the durability of mo1 resistance in the field relies on the fitness cost associated with the resistance-breaking mutations, the nature of the mutations, and their potential antagonistic effects.

First Report of Southern tomato virus on Tomatoes in Southwest France.

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5' CTGGAGATGAAGTGCTCGAAGA 3' and STV-rev 5' TGGCTCGTCTCGCATCCTTCG 3') was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan.

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5'TTCGGMSARTGGTTGTGGTCCA 3' and YanR-new 5'TGTTGAGGAGTCTACCTATTTNG 3' (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5'TCACSTTCGGRCCGWSTYTWTCAG 3' (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5'TTGTACCGCTTGATCCACGG 3' et CYDV-rev-New 5'GTCTGCGCGAACCATTGCC 3', both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

The C terminus of lettuce mosaic potyvirus cylindrical inclusion helicase interacts with the viral VPg and with lettuce translation eukaryotic initiation factor 4E.

Recessive resistance to lettuce mosaic virus (LMV) is conferred in lettuce by the mo1 gene, encoding the eukaryotic translation initiation factor 4E (eIF4E). The C terminus of the viral cylindrical inclusion helicase (CI-Cter), together with the VPg, is involved directly in overcoming mo1 resistance. In this study, recombinant LMV VPg and CI-Cter proteins from wild-type or resistance-breaking isolates were expressed and purified from Escherichia coli. The allelic forms of eIF4E from susceptible or resistant lettuce cultivars were produced similarly and these proteins were used in ELISA-based assays to demonstrate the in vitro binding of the various forms of LMV CI-Cter to both lettuce eIF4E and LMV VPg proteins. All combinations tested displayed significant and specific interactions, and the interaction between the C-terminal part of the LMV CI and eIF4E was confirmed in vivo in bimolecular fluorescence complementation assays. Higher interaction signals for both CI-eIF4E and CI-VPg were observed for LMV-E, indicating that the eIF4E interaction network involving CI and VPg appears to be stronger in the case of this resistance-breaking isolate. This could suggest the need for a minimal interaction threshold for infection success in resistant lettuce, but more precise measurement of the interaction parameters linking eIF4E, VPg and CI is needed in order to reinforce such a hypothesis.

First Report of Apricot pseudo-chlorotic leaf spot virus Infecting Plum (Prunus domestica) in the Czech Republic.

Apricot pseudo-chlorotic leaf spot virus (APCLSV) is a novel, still poorly known Trichovirus in the family Betaflexiviridae. It is most closely related to Apple chlorotic leaf spot virus (ACLSV) (2,4) and infects stone fruit trees of the Prunus genus. Its presence has so far been detected in apricot, plum, Japanese plum, and peach trees in Italy, Spain, France, Hungary, Turkey, Jordan, and Australia (1,2,4). During the summers of 2008 and 2010, leaf samples of old Czech local plum cultivars were obtained from the Holovousy collection and assessed for the presence of viruses belonging to the Capillovirus, Trichovirus, and Foveavirus genera using the polyvalent degenerate oligonucleotides (PDO) nested reverse transcription (RT)-PCR test (3). Following amplification from total RNAs extracts, the amplicons were cloned and several clones were sequenced for each plant sample. In plum (Prunus domestica) cv. Babce, a mixture of amplicons was observed and BlastN and BlastX analyses of the obtained sequences revealed the presence of ACLSV and APCLSV. The 310-bp APCLSV amplicon (GenBank Accession No. JN790294) showed highest identity (82.9% in nucleotide sequence and 97.1% in amino acid sequence) with the Sus2 isolate of APCLSV (4) and clustered with APCLSV isolates in a phylogenetic analysis. APCLSV infection was further confirmed with an APCLSV-specific RT-PCR assay (4), which yielded a product of the expected 205-bp size (GenBank Accession No. JN653070) with closest homology again to the Sus2 APCLSV isolate (83.4 and 94.3% nucleotide and amino acid identity, respectively). To our knowledge, this finding represents the first detection of APCLSV in domestic plums in the Czech Republic, extending our vision of APCLSV diversity and its geographic distribution. For unknown reasons, APCLSV has almost always been reported in mixed infection with ACLSV (1,2,4) and the situation in cv. Babce does not deviate from this trend. This has greatly hindered the analysis of the pathogenicity of APCLSV, a situation further complicated in the current case because the Babce cultivar was also infected by Plum pox virus. References: (1) M. Barone et al. Acta Hortic. 781:53, 2008. (2) T. Candresse et al. Virus and Virus-Like Diseases of Pome and Stone Fruit Trees. A. Hadidi et al., eds. The American Phytopathological Society, St. Paul, MN, 2011. (3) X. Foissac et al. Phytopathology 95:617, 2005. (4) D. Liberti et al. Phytopathology 95:420, 2005.

First Report of Chrysanthemum stunt viroid in Various Cultivars of Argyranthemum frutescens in France.

Described for the first time in Chrysanthemum indicum in the United States, Chrysanthemum stunt viroid (CSVd) was reported to naturally infect species in the Asteraceae family (1,3), as well a few hosts in other families. In May 2010 in a nursery in southwest France, the occurrence of stunted A. frutescens plantlets of cv. Butterfly showing yellow deformed leaves with terminal necrosis, which resembled the growth reduction, flower distortion or leaf necrosis symptoms reported for CSVd in Argyranthemum spp. (3), was reported. Mother plants from which the plantlets originated were asymptomatic. Reverse transcription (RT)-PCR with universal pospiviroid primers Pospi1-FW/RE (4) was performed on five symptomatic plants. A fragment of expected size (197 bp) was obtained in all cases. Viroid infection was confirmed by RT-PCR with two sets of primers: Vid-FW/RE using a 59°C annealing temperature instead of the recommended 62°C (4) and Vir-plus/minus that allows the amplification of the full-length viroid genome (2). Sequences of the three different uncloned amplicons were determined and a 355-nt contig was assembled (GenBank No. JF938538). A BLAST analysis of this full-length sequence revealed 99% identity with CSVd isolates from Chrysanthemum from Korea and Germany (GenBank Accession Nos. AF394452 and X16408). The Argyranthemum CSVd sequence differed from the Chrysanthemum ones by an A insertion at position 289 and substitutions (A to T) at positions 65 and 299. The insertion at position 289 is currently unique among CSVd sequences in GenBank. Thirty-five symptomless mother plants of A. frutescens cv. Butterfly were tested by PCR and all were shown to be infected. The difference in symptomatology observed between the mother plants and the commercial potting plants cannot be explained at this stage, but may reflect the different physiologies or growing conditions of the two kinds of plants, since these are known to affect CSVd symptoms in other hosts (1). To estimate the extent of CSVd contamination in A. frutescens, samples of 11 other cultivars originating from different nurseries were similarly analyzed. In addition to Butterfly, cvs. Sonnenstral, Maya Bofinger, Lili, Blanc Double, and Daisy Solenio were found to be infected by CSVd in the absence of clear symptomatology. The CSVd-free cultivars were Angelic Bordeaux, Dark Pink, Pink Delight, Angelic White, Dana, and Summer. The Pospi1-FW/RE amplicons from Blanc Double, Lili, and Daisy Solenio were identical to the Butterfly isolate sequence while the Maya Bofinger sequence showed one substitution (C to T) at position 256 and Sonnenstral had one substitution (T to A) at position 254. Although CSVd infection of Butterfly had been reported from Germany (3), to our knowledge, the results reported here represent the first report of CSVd in Argyranthemum for France and implicate a range of cultivars. CSVd being classified as a quarantine pest in Chrysanthemum spp. in the European Union, the finding of its significant prevalence in A. frutescens cultivars, frequently in the absence of clear symptomatology, raises the possibility that contaminated Argyranthemum may constitute a reservoir for future Chrysanthemum contamination. References: (1) I. Bouwnen and A. van Zaayen. Page 281 in: Viroids. Science Publishers, Enfield, NH, 2003. (2) T. Candresse et al. Plant Dis. 91:330, 2007. (3) W. Mentzel and E. Maiss. Z. Pflanzenk. Pfanzenschutz 107:548, 2000. (4) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.