Virome release of an invasive exotic plant species in southern France.

The increase in human-mediated introduction of plant species to new regions has resulted in a rise of invasive exotic plant species (IEPS) that has had significant effects on biodiversity and ecosystem processes. One commonly accepted mechanism of invasions is that proposed by the enemy release hypothesis (ERH), which states that IEPS free from their native herbivores and natural enemies in new environments can outcompete indigenous species and become invasive. We here propose the virome release hypothesis (VRH) as a virus-centered variant of the conventional ERH that is only focused on enemies. The VRH predicts that vertically transmitted plant-associated viruses (PAV, encompassing phytoviruses and mycoviruses) should be co-introduced during the dissemination of the IEPS, while horizontally transmitted PAV of IEPS should be left behind or should not be locally transmitted in the introduced area due to a maladaptation of local vectors. To document the VRH, virome richness and composition as well as PAV prevalence, co-infection, host range, and transmission modes were compared between indigenous plant species and an invasive grass, cane bluestem (Bothriochloa barbinodis), in both its introduced range (southern France) and one area of its native range (Sonoran Desert, Arizona, USA). Contrary to the VRH, we show that invasive populations of B. barbinodis in France were not associated with a lower PAV prevalence or richness than native populations of B. barbinodis from the USA. However, comparison of virome compositions and network analyses further revealed more diverse and complex plant-virus interactions in the French ecosystem, with a significant richness of mycoviruses. Setting mycoviruses apart, only one putatively vertically transmitted phytovirus (belonging to the Amalgaviridae family) and one putatively horizontally transmitted phytovirus (belonging to the Geminiviridae family) were identified from B. barbinodis plants in the introduced area. Collectively, these characteristics of the B. barbinodis-associated PAV community in southern France suggest that a virome release phase may have immediately followed the introduction of B. barbinodis to France in the 1960s or 1970s, and that, since then, the invasive populations of this IEPS have already transitioned out of this virome release phase, and have started interacting with several local mycoviruses and a few local plant viruses.

Characterization of the RNA Mycovirome Associated with Grapevine Fungal Pathogens: Analysis of Mycovirus Distribution and Their Genetic Variability within a Collection of Botryosphaeriaceae Isolates.

Botryosphaeriaceae are fungi involved in the decay of various woody species, including the grapevine, leading to significant production losses. This fungal family is largely ubiquitous, and seven species of Botryosphaeriaceae have been identified in French vineyards, with variable levels of aggressiveness, both in vitro and in planta. Mycoviruses can impact the life traits of their fungal hosts, including aggressiveness, and are one of the factors influencing fungal pathogenicity. In this study, the RNA mycovirome of fifteen Botryosphaeriaceae isolates was characterized through the high-throughput sequencing of double-stranded RNA preparations from the respective samples. Eight mycoviruses were detected, including three potential novel species in the Narnaviridae family, as well as in the proposed Mycobunyaviridae and Fusagraviridae families. A large collection of Botryosphaeriaceae isolates was screened using RT-PCR assays specific for 20 Botryosphaeriaceae-infecting mycoviruses. Among the mycoviruses detected, some appeared to be specialists within a single host species, while others infected isolates belonging to multiple Botryosphaeriaceae species. This screening allowed us to conclude that one-third of the Botryosphaeriaceae isolates were infected by at least one mycovirus, and a significant proportion of isolates (43.5%) were found to be coinfected by several viruses, with very complex RNA mycoviromes for some N. parvum isolates.

Correction: Haegeman et al. Looking beyond Virus Detection in RNA Sequencing Data: Lessons Learned from a Community-Based Effort to Detect Cellular Plant Pathogens and Pests. Plants 2023, 12, 2139.

In the original publication [...].

Comparative performance evaluation of double-stranded RNA high-throughput sequencing for the detection of viral infection in temperate fruit crops.

There is limited information on the compared performance of currently used biological, serological and molecular assays with high-throughput sequencing (HTS) for viral indexing in temperate fruit crops. Here, using a range of samples of predetermined virological status, we compared two performance criteria (inclusivity and analytical sensitivity) of ELISA, molecular hybridization, RT-PCR and double-stranded RNA (dsRNA) HTS for the detection of a total of 14 viruses (10 genera) and four viroids (three genera). Using undiluted samples from individual plants, ELISA had the lowest performance, with an overall detection rate of 68.7%, followed by RT-PCR (82.5%) and HTS (90.7%, and 100% if considering only viruses). The lower performance of RT-PCR reflected the inability to amplify some isolates as a consequence of point mutations affecting primer-binding sites. In addition, HTS identified viruses that had not been identified by others assays in close to two-thirds of samples. Analysis of serial dilutions of fruit tree samples allowed to compare analytical sensitivity for various viruses. ELISA showed the lowest analytical sensitivity but RT-PCR showed higher analytical sensitivity than HTS for a majority of samples. Overall, these results confirm the superiority of HTS over biological indexing in terms of speed, and inclusivity and show that while absolute analytical sensitivity of RT-PCR tends to be higher than that of HTS, PCR inclusivity is affected by viral genetic diversity. Taken together these results make a strong case for the implementation of HTS-based approaches in fruit tree viral testing protocols supporting quarantine and certification programs.

Benchmarking of virome metagenomic analysis approaches using a large, 60+ members, viral synthetic community.

IMPORTANCE: We report here efforts to benchmark performance of two widespread approaches for virome analysis, which target either virion-associated nucleic acids (VANA) or highly purified double-stranded RNAs (dsRNAs). This was achieved using synthetic communities of varying complexity levels, up to a highly complex community of 72 viral agents (115 viral molecules) comprising isolates from 21 families and 61 genera of plant viruses. The results obtained confirm that the dsRNA-based approach provides a more complete representation of the RNA virome, in particular, for high complexity ones. However, for viromes of low to medium complexity, VANA appears a reasonable alternative and would be the preferred choice if analysis of DNA viruses is of importance. Several parameters impacting performance were identified as well as a direct relationship between the completeness of virome description and sample sequencing depth. The strategy, results, and tools used here should prove useful in a range of virome analysis efforts.

First report of Vitis cryptic virus (VCV) infecting mildew-resistant grapevine interspecific hybrids in France.

Vitis cryptic virus (VCV), a deltapartitivirus identified in Japan in Vitis coignetiae (Nabeshima and Abe, 2021), is known from only two other countries. It was detected in China (Fan et al., 2022) and in Russia, including in a V. labrusca and the Saperavi Severnyi interspecific hybrid (Shvets et al., 2022). There is no information on VCV pathogenicity but deltapartitiviruses are generally not pathogenic. Fan et al. (2022) reported VCV graft transmission and chlorotic mottling symptoms developing on a graft-inoculated vine, in spite of the fact that cryptic viruses are not known to move cell-to-cell or be graft-transmissible. In fall 2022, a few plants of the Prior interspecific hybrid (https://www.vivc.de) showed unusual red blotch and leaf curl in Bordeaux (France), prompting the HTS analysis of two plants using total leaf RNA. Following host genome substraction, the ribodepleted RNASeq data was assembled de novo using CLC Genomics Workbench (Candresse et al., 2018) and contigs annotated by BlastX against the GenBank database. Rupestris stem pitting virus, grapevine pinot gris virus, hop stunt viroid and grapevine yellow speckle viroid 1 were identified. In addition, mycoviral contigs were identified, together with contigs for Rhopalosiphum padi virus and a divergent isolate of barley aphid RNA virus 10 (the later only in one plant), and the two genomic RNAs of VCV. The VCV RNA1 contigs were 1570 and 1574 nucleotides (nt) long, respectively, and 100% identical, showing 97.1% nt identity to a Japanese isolate (LC746759). They integrated 6480 and 4613 reads (0.2 and 0.4% of total substracted reads) for a coverage of 611 and 433x, respectively. The VCV RNA2 contigs were also 100% identical and shared 95.5% identity with a Japanese isolate (LC746761). They were 1518-1519 nt long, integrated 11338 and 9999 reads (0.4 and 0.9% of reads) for a coverage of 1109 and 972x, respectively. The Prior VCV RNAs were deposited in GenBank (OR474475-76). Specific RNA2 primers 5' TTACAGGTTTGATTGGAATCATG 3' and 5' ATAGTAGGTCCAATCACTAATC 3' (Tm 56°C) were used to confirm VCV presence in the original plants as well as in three other asymptomatic Prior vines. Amplicons 100% identical to the contigs were obtained from 4 of 5 plants. Two plants of Bronner, one of Prior parents, also tested positive. The rootstock (Fercal) of a VCV-infected Prior and two plants of another hybrid, Artaban, (sampled in the same plot as Prior) tested negative. BlastN datamining identified VCV reads in RNASeq data from a range of wild grapevines including V. acerifolia (SRX2885763), V. quinquangularis (SRX1496837), V. romanetii (SRR3938616), V. cinerea (SRR10135144), V. davidii (SRR3255926), V. amurensis (SRX13387918) and V. vinifera subsp. sylvestris (HAOE01029819, HAOE01001237). Although not experimentally verified, detection in wild Vitis, including V. amurensis, a Saperavi Severnyi, Bronner and Prior progenitor, suggests VCV might have been introduced in these hybrids through crosses aiming to develop powdery and downy mildew resistant varieties. To the best of our knowledge, this is the first report of VCV infection in grapevine in France. The symptoms that prompted this research have not recurred in 2023 and are not linked to VCV because the virus was also identified in symptomless Prior plants. The risk of introducing VCV in European grapevine through breeding efforts appears limited, but VCV may be present in fungal disease-resistant cultivars in a range of countries.

Complete Genome Characterization of Penicillimonavirus gammaplasmoparae, a Bipartite Member of the Family Mymonaviridae.

In this study, we identified Plasmopara-viticola-lesion-associated mononegaambi virus 3 (recently classified as Penicillimonavirus gammaplasmoparae), a fungi-associated mymonavirus, in grapevine plants showing an unusual upward curling symptomatology on the leaves and premature decline. Mymonaviridae is a family comprising nine genera of negative-sense single-stranded RNA viruses infecting filamentous fungi, although few of them have been associated with oomycetes, plants, and insects. Although the first mymonavirus genome description was reported a decade ago, the genome organization of several genera in the family, including the genus Penicillimonavirus, has remained unclear to date. We have determined the complete genome of P. gammaplasmoparae, which represents the first complete genomic sequence for this genus. Moreover, we provide strong evidence that P. gammaplasmoparae genome is bipartite and comprises two RNA molecules of around 6150 and 4560 nt. Our results indicate that the grapevine powdery mildew pathogen, Erysiphe necator, was also present in the analyzed plants and suggest P. gammaplasmoparae could be infecting this fungus. However, whether the fungus and/or the mycovirus are associated with the symptomatology that initially prompted these efforts remains to be determined.

Identification of divergent isolates of cherry latent virus 1 in Greek sweet cherry orchards.

In this study, samples collected from eight sweet cherry trees in northern Greece were analyzed by high-throughput sequencing for the presence of viruses. Bioinformatic analysis revealed the presence of divergent isolates of cherry latent virus 1 (CLV-1), a recently identified trichovirus in a sweet cherry accession imported into the USA from the Republic of Georgia. The complete genome sequences of seven CLV-1 isolates were determined, and phylogenetic analysis indicated that they belonged to a separate clade from the previously characterized Georgian isolate. A small-scale survey confirmed the presence of CLV-1 in 47 out of 151 sweet cherry samples tested, and partial sequencing of 15 isolates showed a high degree of nucleotide sequence similarity among them.

Carrot populations in France and Spain host a complex virome rich in previously uncharacterized viruses.

High-throughput sequencing (HTS) has proven a powerful tool to uncover the virome of cultivated and wild plants and offers the opportunity to study virus movements across the agroecological interface. The carrot model consisting of cultivated (Daucus carota ssp. sativus) and wild carrot (Daucus carota ssp. carota) populations, is particularly interesting with respect to comparisons of virus communities due to the low genetic barrier to virus flow since both population types belong to the same plant species. Using a highly purified double-stranded RNA-based HTS approach, we analyzed on a large scale the virome of 45 carrot populations including cultivated, wild and off-type carrots (carrots growing within the field and likely representing hybrids between cultivated and wild carrots) in France and six additional carrot populations from central Spain. Globally, we identified a very rich virome comprising 45 viruses of which 25 are novel or tentatively novel. Most of the identified novel viruses showed preferential associations with wild carrots, either occurring exclusively in wild populations or infecting only a small proportion of cultivated populations, indicating the role of wild carrots as reservoir of viral diversity. The carrot virome proved particularly rich in viruses involved in complex mutual interdependencies for aphid transmission such as poleroviruses, umbraviruses and associated satellites, which can be the basis for further investigations of synergistic or antagonistic virus-vector-host relationships.

Diversity and Pathobiology of an Ilarvirus Unexpectedly Detected in Diverse Plants and Global Sequencing Data.

High-throughput sequencing (HTS) and sequence mining tools revolutionized virus detection and discovery in recent years, and implementing them with classical plant virology techniques results in a powerful approach to characterize viruses. An example of a virus discovered through HTS is Solanum nigrum ilarvirus 1 (SnIV1) (Bromoviridae), which was recently reported in various solanaceous plants from France, Slovenia, Greece, and South Africa. It was likewise detected in grapevines (Vitaceae) and several Fabaceae and Rosaceae plant species. Such a diverse set of source organisms is atypical for ilarviruses, thus warranting further investigation. In this study, modern and classical virological tools were combined to accelerate the characterization of SnIV1. Through HTS-based virome surveys, mining of sequence read archive datasets, and a literature search, SnIV1 was further identified from diverse plant and non-plant sources globally. SnIV1 isolates showed relatively low variability compared with other phylogenetically related ilarviruses. Phylogenetic analyses showed a distinct basal clade of isolates from Europe, whereas the rest formed clades of mixed geographic origin. Furthermore, systemic infection of SnIV1 in Solanum villosum and its mechanical and graft transmissibility to solanaceous species were demonstrated. Near-identical SnIV1 genomes from the inoculum (S. villosum) and inoculated Nicotiana benthamiana were sequenced, thus partially fulfilling Koch's postulates. SnIV1 was shown to be seed-transmitted and potentially pollen-borne, has spherical virions, and possibly induces histopathological changes in infected N. benthamiana leaf tissues. Overall, this study provides information to better understand the diversity, global presence, and pathobiology of SnIV1; however, its possible emergence as a destructive pathogen remains uncertain. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

Looking beyond Virus Detection in RNA Sequencing Data: Lessons Learned from a Community-Based Effort to Detect Cellular Plant Pathogens and Pests.

High-throughput sequencing (HTS), more specifically RNA sequencing of plant tissues, has become an indispensable tool for plant virologists to detect and identify plant viruses. During the data analysis step, plant virologists typically compare the obtained sequences to reference virus databases. In this way, they are neglecting sequences without homologies to viruses, which usually represent the majority of sequencing reads. We hypothesized that traces of other pathogens might be detected in this unused sequence data. In the present study, our goal was to investigate whether total RNA-seq data, as generated for plant virus detection, is also suitable for the detection of other plant pathogens and pests. As proof of concept, we first analyzed RNA-seq datasets of plant materials with confirmed infections by cellular pathogens in order to check whether these non-viral pathogens could be easily detected in the data. Next, we set up a community effort to re-analyze existing Illumina RNA-seq datasets used for virus detection to check for the potential presence of non-viral pathogens or pests. In total, 101 datasets from 15 participants derived from 51 different plant species were re-analyzed, of which 37 were selected for subsequent in-depth analyses. In 29 of the 37 selected samples (78%), we found convincing traces of non-viral plant pathogens or pests. The organisms most frequently detected in this way were fungi (15/37 datasets), followed by insects (13/37) and mites (9/37). The presence of some of the detected pathogens was confirmed by independent (q)PCRs analyses. After communicating the results, 6 out of the 15 participants indicated that they were unaware of the possible presence of these pathogens in their sample(s). All participants indicated that they would broaden the scope of their bioinformatic analyses in future studies and thus check for the presence of non-viral pathogens. In conclusion, we show that it is possible to detect non-viral pathogens or pests from total RNA-seq datasets, in this case primarily fungi, insects, and mites. With this study, we hope to raise awareness among plant virologists that their data might be useful for fellow plant pathologists in other disciplines (mycology, entomology, bacteriology) as well.

Managing the deluge of newly discovered plant viruses and viroids: an optimized scientific and regulatory framework for their characterization and risk analysis.

The advances in high-throughput sequencing (HTS) technologies and bioinformatic tools have provided new opportunities for virus and viroid discovery and diagnostics. Hence, new sequences of viral origin are being discovered and published at a previously unseen rate. Therefore, a collective effort was undertaken to write and propose a framework for prioritizing the biological characterization steps needed after discovering a new plant virus to evaluate its impact at different levels. Even though the proposed approach was widely used, a revision of these guidelines was prepared to consider virus discovery and characterization trends and integrate novel approaches and tools recently published or under development. This updated framework is more adapted to the current rate of virus discovery and provides an improved prioritization for filling knowledge and data gaps. It consists of four distinct steps adapted to include a multi-stakeholder feedback loop. Key improvements include better prioritization and organization of the various steps, earlier data sharing among researchers and involved stakeholders, public database screening, and exploitation of genomic information to predict biological properties.

Molecular diversity of yam virus Y and identification of banana mild mosaic virus isolates infecting yam (Dioscorea spp.).

Two members of the family Betaflexiviridae associated with yam (Dioscorea spp.) have been described so far: yam latent virus (YLV) and yam virus Y (YVY). However, their geographical distribution and molecular diversity remain poorly documented. Using a nested RT-PCR assay, we detected YVY in D. alata, D. bulbifera, D. cayenensis, D. rotundata, and D. trifida in Guadeloupe, and in D. rotundata in Côte d'Ivoire, thus extending the known host range of this virus and geographical distribution. Using amplicon sequencing, we determined that the molecular diversity of YVY in the yam samples analyzed in this work ranged between 0.0 and 29.1% and that this diversity is partially geographically structured. We also identified three isolates of banana mild mosaic virus (BanMMV) infecting D. alata in Guadeloupe, providing the first evidence for BanMMV infection in yam.

Molecular and Biological Characterization of Novel and Known Family Secoviridae Members Infecting Lettuce.

High-throughput sequencing of two lettuces showing virus-like symptoms in France provided evidence of infection by members of the family Secoviridae. One plant (JG1) had a complex mixed infection that involved, among others, a novel waikavirus (lettuce waikavirus 1) and two isolates of a sequivirus related to lettuce mottle virus (LeMoV). The second lettuce plant (JG2) was singly infected by LeMoV. Complete genomic sequences were obtained for all four isolates and, in addition, near complete genome sequences were obtained for other LeMoV or LeMoV-related isolates (from French cultivated and wild lettuces and from a Brazilian cultivated lettuce) and for two isolates of another family Asteraceae-infecting sequivirus, dandelion yellow mosaic virus (DaYMV). Analysis of these genomic sequences allows the proposal of tentative genome organization for the various viruses and clarification of their phylogenetic relationships. Sequence and host range comparisons point to significant differences between the two sequivirus isolates identified in the JG1 plant and LeMoV isolates from France and Brazil, suggesting they belong to a novel species for which the name lettuce star mosaic virus is proposed.

Long-Term Anthropogenic Management and Associated Loss of Plant Diversity Deeply Impact Virome Richness and Composition of Poaceae Communities.

Modern agriculture has influenced plant virus emergence through ecosystem simplification, introduction of new host species, and reduction in crop genetic diversity. Therefore, it is crucial to better understand virus distributions across cultivated and uncultivated communities in agro-ecological interfaces, as well as virus exchange among them. Here, we advance fundamental understanding in this area by characterizing the virome of three co-occurring replicated Poaceae community types that represent a gradient of grass species richness and management intensity, from highly managed crop monocultures to little-managed, species-rich grasslands. We performed a large-scale study on 950 wild and cultivated Poaceae over 2 years, combining untargeted virome analysis down to the virus species level with targeted detection of three plant viruses. Deep sequencing revealed (i) a diversified and largely unknown Poaceae virome (at least 51 virus species or taxa), with an abundance of so-called persistent viruses; (ii) an increase of virome richness with grass species richness within the community; (iii) stability of virome richness over time but a large viral intraspecific variability; and (iv) contrasting patterns of virus prevalence, coinfections, and spatial distribution among plant communities and species. Our findings highlight the complex structure of plant virus communities in nature and suggest the influence of anthropogenic management on viral distribution and prevalence. IMPORTANCE Because viruses have been mostly studied in cultivated plants, little is known about virus diversity and ecology in less-managed vegetation or about the influence of human management and agriculture on virome composition. Poaceae (grass family)-dominated communities provide invaluable opportunities to examine these ecological issues, as they are distributed worldwide across agro-ecological gradients, are essential for food security and conservation, and can be infected by numerous viruses. Here, we used multiple levels of analysis that considered plant communities, individual plants, virus species, and haplotypes to broaden understanding of the Poaceae virome and to evaluate host-parasite richness relationships within agro-ecological landscapes in our study area. We emphasized the influence of grass diversity and land use on the composition of viral communities and their life history strategies, and we demonstrated the complexity of plant-virus interactions in less-managed grass communities, such as the higher virus prevalence and overrepresentation of mixed virus infection compared to theoretical predictions.

The Expanding Menagerie of Prunus-Infecting Luteoviruses.

Members of the genus Luteovirus are responsible for economically destructive plant diseases worldwide. Over the past few years, three luteoviruses infecting Prunus trees have been characterized. However, the biological properties, prevalence, and genetic diversity of those viruses have not yet been studied. High-throughput sequencing of samples of various wild, cultivated, and ornamental Prunus species enabled the identification of four novel species in the genus Luteovirus for which we obtained complete or nearly complete genomes. Additionally, we identified another new putative species recovered from Sequence Read Archive data. Furthermore, we conducted a survey on peach-infecting luteoviruses in eight European countries. Analyses of 350 leaf samples collected from germplasm, production orchards, and private gardens showed that peach-associated luteovirus (PaLV), nectarine stem pitting-associated virus (NSPaV), and a novel luteovirus, peach-associated luteovirus 2 (PaLV2), are present in all countries; the most prevalent virus was NSPaV, followed by PaLV. The genetic diversity of these viruses was also analyzed. Moreover, the biological indexing on GF305 peach indicator plants demonstrated that PaLV and PaLV2, like NSPaV, are transmitted by graft at relatively low rates. No clear viral symptoms have been observed in either graft-inoculated GF305 indicators or different peach tree varieties observed in an orchard. The data generated during this study provide a broader overview of the genetic diversity, geographical distribution, and prevalence of peach-infecting luteoviruses and suggest that these viruses are likely asymptomatic in peach under most circumstances.

A new potyvirus from hedge mustard (Sisymbrium officinale (L.) Scop.) sheds light on the evolutionary history of turnip mosaic virus.

A novel potyvirus was identified in symptomatic hedge mustard (Sisymbrium officinale (L.) Scop.) and wild radish (Raphanus raphanistrum L.) in France. The nearly complete genome sequence of hedge mustard mosaic virus (HMMV) was determined, demonstrating that it belongs to a sister species to turnip mosaic virus (TuMV). HMMV readily infected several other members of the family Brassicaceae, including turnip, shepherd's purse (Capsella bursa-pastoris), and arabidopsis. The identification of HMMV as a Brassicaceae-infecting virus closely related to TuMV leads us to question the current scenario of TuMV evolution and suggests a possible alternative one in which transition from a monocot-adapted ancestral lifestyle to a Brassicaceae-adapted one could have occurred earlier than previously recognized.Please check and confirm that the authors and their respective affiliations have been correctly identified and amend if necessary.all OK.

2022 taxonomic update of phylum Negarnaviricota (Riboviria: Orthornavirae), including the large orders Bunyavirales and Mononegavirales.

In March 2022, following the annual International Committee on Taxonomy of Viruses (ICTV) ratification vote on newly proposed taxa, the phylum Negarnaviricota was amended and emended. The phylum was expanded by two new families (bunyaviral Discoviridae and Tulasviridae), 41 new genera, and 98 new species. Three hundred forty-nine species were renamed and/or moved. The accidentally misspelled names of seven species were corrected. This article presents the updated taxonomy of Negarnaviricota as now accepted by the ICTV.

Virus classification based on in-depth sequence analyses and development of demarcation criteria using the Betaflexiviridae as a case study.

Currently, many viruses are classified based on their genome organization and nucleotide/amino acid sequence identities of their capsid and replication-associated proteins. Although biological traits such as vector specificities and host range are also considered, this later information is scarce for the majority of recently identified viruses, characterized only from genomic sequences. Accordingly, genomic sequences and derived information are being frequently used as the major, if not only, criteria for virus classification and this calls for a full review of the process. Herein, we critically addressed current issues concerning classification of viruses in the family Betaflexiviridae in the era of high-throughput sequencing and propose an updated set of demarcation criteria based on a process involving pairwise identity analyses and phylogenetics. The proposed framework has been designed to solve the majority of current conundrums in taxonomy and to facilitate future virus classification. Finally, the analyses performed herein, alongside the proposed approaches, could be used as a blueprint for virus classification at-large.

The Molecular Characterization of a New Prunus-Infecting Cheravirus and Complete Genome Sequence of Stocky Prune Virus.

As part of a virome characterization of Prunus species, a novel cheravirus was discovered in two wild species, Prunus brigantina and P. mahaleb, and in an apricot (P. armeniaca) accession. The sequence of the two genomic RNAs was completed for two isolates. The Pro-Pol conserved region showed 86% amino acid (aa) identity with the corresponding region of trillium govanianum cheravirus (TgCV), a tentative Cheravirus member, whereas the combined coat proteins (CPs) shared only 40% aa identity with TgCV CPs, well below the species demarcation threshold for the genus. This suggests that the new virus should be considered a new species for which the name alpine wild prunus virus (AWPV) is proposed. In parallel, the complete genome sequence of stocky prune virus (StPV), a poorly known cheravirus for which only partial sequences were available, was determined. A phylogenetic analysis showed that AWPV, TgCV and StPV form a distinct cluster, away from other cheraviruses.