Correlation of altered expression of a long non-coding RNA, NEAT1, in peripheral blood mononuclear cells with dengue disease progression.

The association of long non-coding RNAs (lncRNAs) with dengue disease progression is currently unknown. Therefore, the present study aimed to identify lncRNAs in different categories of dengue patients and evaluate their association with dengue disease progression. Herein, we examined the expression profiles of lncRNAs and protein-coding genes between other febrile illness (OFI) and different grade of dengue patients through high-throughput RNA sequencing. We identified Nuclear Enriched Abundant Transcript 1 (NEAT1) as one of the differentially expressed lncRNAs (adjusted P ≤ 0.05 and log-fold change ≥ 2) and subsequently validated the expression by qRT-PCR. The co-expression analysis further revealed that NEAT1 and the coding gene IFI27 were highly co-expressed and negatively correlated with dengue severity. Using regression analysis, we observed that NEAT1 expression was significantly dependent on disease progression (Coefficient = -0.27750, SE Coefficient = 0.07145, and t = -3.88).Further, receiver operating characteristic (ROC) curve revealed that NEAT1 expression could discriminate DI from DS (sensitivity and specificity of 100% (95%CI: 85.69 - 97.22) and area under the curve (AUC) = 0.97). Overall, the results of this study offer the first experimental evidence demonstrating the correlation between lncRNAs and severe dengue phenotype. Monitoring NEAT1and IFI27 expression in PBMC may be useful in understanding dengue virus-induced disease progression.

Decrypting ENCODEd epigenetic marks of human tRN-A-RS genes in normal, stem and cancer cell lines.

Screening large-scale ENCODE data of 625 cytoplasmic transfer RNA (tRNAs) and 37 aminoacyl tRNA synthetase (AARSs) human genes, we deconstruct the array of relations between 10 histone marks affecting 15 chromatin states; their tissue specificity and variations and interchange amongst normal, cancerous and stem cells. The histone marks of RNA Pol II transcribed AARS genes share, but also contrast with that on RNA Pol III transcribed tRNA genes. tRNAs with identical/similar sequences may be in significantly varying states even within the same cell line; the chromatin scaffold, where the tRNA gene resides, is the key determinant. Hepatocellular carcinoma cell line has dominant H3K27me3, and singular clustering of other marks. Leukaemic cell line has hyperactive genes. The quiescence of the stem cells is encoded in the markers. Leaving aside the important exceptions in stem cells and elsewhere, tRNAs with cove scores above 50 have active markers and precise sets of transcription factors, and are usually well conserved compared to the low-scoring ones. Pseudo tRNAs are in heterochromatin/repressed state with anomalous exceptions in cancer cells. We motivate that Epigenetic-Phishing hacks the translation apparatus through the chromatin states governed by the histone marks of tRNA and AARS genes, and speculate on their therapeutic implications in cancer and on stem cells.

miRepress: modelling gene expression regulation by microRNA with non-conventional binding sites.

Some earlier studies have reported an alternative mode of microRNA-target interaction. We detected target regions within mRNA transcripts from AGO PAR-CLIP that did not contain any conventional microRNA seed pairing but only had non-conventional binding sites with microRNA 3' end. Our study from 7 set of data that measured global protein fold change after microRNA transfection pointed towards the association of target protein fold change with 6-mer and 7-mer target sites involving microRNA 3' end. We developed a model to predict the degree of microRNA target regulation in terms of protein fold changes from the number of different conventional and non-conventional target sites present in the target, and found significant correlation of its output with protein expression changes. We validated the effect of non-conventional interactions with target by modulating the abundance of microRNA in a human breast cancer cell line MCF-7. The validation was done using luciferase assay and immunoblot analysis for our predicted non-conventional microRNA-target pair WNT1 (3' UTR) and miR-367-5p and immunoblot analysis for another predicted non-conventional microRNA-target pair MYH10 (coding region) and miR-181a-5p. Both experiments showed inhibition of targets by transfection of microRNA mimics that were predicted to have only non-conventional sites.

Dynamic changes in global microRNAome and transcriptome reveal complex miRNA-mRNA regulated host response to Japanese Encephalitis Virus in microglial cells.

Microglia cells in the brain play essential role during Japanese Encephalitis Virus (JEV) infection and may lead to change in microRNA (miRNA) and mRNA profile. These changes may together control disease outcome. Using Affymetrix microarray platform, we profiled cellular miRNA and mRNA expression at multiple time points during viral infection in human microglial (CHME3) cells. In silico analysis of microarray data revealed a phased pattern of miRNAs expression, associated with JEV replication and provided unique signatures of infection. Target prediction and pathway enrichment analysis identified anti correlation between differentially expressed miRNA and the gene expression at multiple time point which ultimately affected diverse signaling pathways including Notch signaling pathways in microglia. Activation of Notch pathway during JEV infection was demonstrated in vitro and in vivo. The expression of a subset of miRNAs that target multiple genes in Notch signaling pathways were suppressed and their overexpression could affect JEV induced immune response. Further analysis provided evidence for the possible presence of cellular competing endogenous RNA (ceRNA) associated with innate immune response. Collectively, our data provide a uniquely comprehensive view of the changes in the host miRNAs induced by JEV during cellular infection and identify Notch pathway in modulating microglia mediated inflammation.

Eukaryotic tRNA paradox.

tRNAs are widely believed to segregate into two classes, I and II. Computational analysis of eukaryotic tRNA entries in Genomic tRNA Database, however, leads to new, albeit paradoxical, presence of more than a thousand class-I tRNAs with uncharacteristic long variable arms (V-arms), like in class-II. Out of 62,202 tRNAs from 69 eukaryotes, as many as 1431 class-I tRNAs have these novel extended V-arms, and we refer to them as paradoxical tRNAs (pxtRNAs). A great majority of these 1431 pxtRNA genes are located in intergenic regions, about 18% embedded in introns of genes or ESTs, and just one in 3'UTR. A check on the conservations of 2D and 3D base pairs for each position of these pxtRNAs reveals a few variations, but they seem to have almost all the known features (already known identity and conserved elements of tRNA). Analyses of the A-Box and B-Box of these pxtRNA genes in eukaryotes display salient deviations from the previously annotated conserved features of the standard promoters, whereas the transcription termination signals are just canonical and non-canonical runs of thymidine, similar to the ones in standard tRNA genes. There is just one such pxtRNA(ProAGG) gene in the entire human genome, and the availability of data allows epigenetic analysis of this human pxtRNA(ProAGG) in three different cell lines, H1 hESC, K562, and NHEK, to assess the level of its expression. Histone acetylation and methylation of this lone pxtRNA(ProAGG) gene in human differ from that of the nine standard human tRNA(ProAGG) genes. The V-arm nucleotide sequences and their secondary structures in pxtRNA differ from that of class-II tRNA. Considering these differences, hypotheses of alternative splicing, non-canonical intron and gene transfer are examined to partially improve the Cove scores of these pxtRNAs and to critically question their antecedence and novelty.

Eukaryotic tRNAs fingerprint invertebrates vis-à-vis vertebrates.

During translation, aminoacyl-tRNA synthetases recognize the identities of the tRNAs to charge them with their respective amino acids. The conserved identities of 58,244 eukaryotic tRNAs of 24 invertebrates and 45 vertebrates in genomic tRNA database were analyzed and their novel features extracted. The internal promoter sequences, namely, A-Box and B-Box, were investigated and evidence gathered that the intervention of optional nucleotides at 17a and 17b correlated with the optimal length of the A-Box. The presence of canonical transcription terminator sequences at the immediate vicinity of tRNA genes was ventured. Even though non-canonical introns had been reported in red alga, green alga, and nucleomorph so far, fairly motivating evidence of their existence emerged in tRNA genes of other eukaryotes. Non-canonical introns were seen to interfere with the internal promoters in two cases, questioning their transcription fidelity. In a first of its kind, phylogenetic constructs based on tRNA molecules delineated and built the trees of the vast and diverse invertebrates and vertebrates. Finally, two tRNA models representing the invertebrates and the vertebrates were drawn, by isolating the dominant consensus in the positional fluctuations of nucleotide compositions.

Anomalous altered expressions of downstream gene-targets in TP53-miRNA pathways in head and neck cancer.

The prevalence of head and neck squamous cell carcinoma, HNSCC, continues to grow. Change in the expression of TP53 in HNSCC affects its downstream miRNAs and their gene targets, anomalously altering the expressions of the five genes, MEIS1, AGTR1, DTL, TYMS and BAK1. These expression alterations follow the repression of TP53 that upregulates miRNA-107, miRNA- 215, miRNA-34 b/c and miRNA-125b, but downregulates miRNA-155. The above five so far unreported genes are the targets of these miRNAs. Meta-analyses of microarray and RNA-Seq data followed by qRT-PCR validation unravel these new ones in HNSCC. The regulatory roles of TP53 on miRNA-155 and miRNA-125b differentiate the expressions of AGTR1 and BAK1in HNSCC vis-à-vis other carcinogenesis. Expression changes alter cell cycle regulation, angiogenic and blood cell formation, and apoptotic modes in affliction. Pathway analyses establish the resulting systems-level functional and mechanistic insights into the etiology of HNSCC.

HumanViCe: host ceRNA network in virus infected cells in human.

Host-virus interaction via host cellular components has been an important field of research in recent times. RNA interference mediated by short interfering RNAs and microRNAs (miRNA), is a widespread anti-viral defense strategy. Importantly, viruses also encode their own miRNAs. In recent times miRNAs were identified as key players in host-virus interaction. Furthermore, viruses were shown to exploit the host miRNA networks to suite their own need. The complex cross-talk between host and viral miRNAs and their cellular and viral targets forms the environment for viral pathogenesis. Apart from protein-coding mRNAs, non-coding RNAs may also be targeted by host or viral miRNAs in virus infected cells, and viruses can exploit the host miRNA mediated gene regulatory network via the competing endogenous RNA effect. A recent report showed that viral U-rich non-coding RNAs called HSUR, expressed in primate virus herpesvirus saimiri (HVS) infected T cells, were able to bind to three host miRNAs, causing significant alteration in cellular level for one of the miRNAs. We have predicted protein coding and non protein-coding targets for viral and human miRNAs in virus infected cells. We identified viral miRNA targets within host non-coding RNA loci from AGO interacting regions in three different virus infected cells. Gene ontology (GO) and pathway enrichment analysis of the genes comprising the ceRNA networks in the virus infected cells revealed enrichment of key cellular signaling pathways related to cell fate decisions and gene transcription, like Notch and Wnt signaling pathways, as well as pathways related to viral entry, replication and virulence. We identified a vast number of non-coding transcripts playing as potential ceRNAs to the immune response associated genes; e.g., APOBEC family genes, in some virus infected cells. All these information are compiled in HumanViCe (http://gyanxet-beta.com/humanvice), a comprehensive database that provides the potential ceRNA networks in virus infected human cells.

lnCeDB: database of human long noncoding RNA acting as competing endogenous RNA.

UNLABELLED: Long noncoding RNA (lncRNA) influences post-transcriptional regulation by interfering with the microRNA (miRNA) pathways, acting as competing endogenous RNA (ceRNA). These lncRNAs have miRNA responsive elements (MRE) in them, and control endogenous miRNAs available for binding with their target mRNAs, thus reducing the repression of these mRNAs. lnCeDB provides a database of human lncRNAs (from GENCODE 19 version) that can potentially act as ceRNAs. The putative mRNA targets of human miRNAs and the targets mapped to AGO clipped regions are collected from TargetScan and StarBase respectively. The lncRNA targets of human miRNAs (up to GENCODE 11) are downloaded from miRCode database. miRNA targets on the rest of the GENCODE 19 lncRNAs are predicted by our algorithm for finding seed-matched target sites. These putative miRNA-lncRNA interactions are mapped to the Ago interacting regions within lncRNAs. To find out the likelihood of an lncRNA-mRNA pair for actually being ceRNA we take recourse to two methods. First, a ceRNA score is calculated from the ratio of the number of shared MREs between the pair with the total number of MREs of the individual candidate gene. Second, the P-value for each ceRNA pair is determined by hypergeometric test using the number of shared miRNAs between the ceRNA pair against the number of miRNAs interacting with the individual RNAs. Typically, in a pair of RNAs being targeted by common miRNA(s), there should be a correlation of expression so that the increase in level of one ceRNA results in the increased level of the other ceRNA. Near-equimolar concentration of the competing RNAs is associated with more profound ceRNA effect. In lnCeDB one can not only browse for lncRNA-mRNA pairs having common targeting miRNAs, but also compare the expression of the pair in 22 human tissues to estimate the chances of the pair for actually being ceRNAs. AVAILABILITY: Downloadable freely from http://gyanxet-beta.com/lncedb/.

Competing endogenous RNA: the key to posttranscriptional regulation.

Competing endogenous RNA, ceRNA, vie with messenger RNAs (mRNAs) for microRNAs (miRNAs) with shared miRNAs responses elements (MREs) and act as modulator of miRNA by influencing the available level of miRNA. It has recently been discovered that, apart from protein-coding ceRNAs, pseudogenes, long noncoding RNAs (lncRNAs), and circular RNAs act as miRNA "sponges" by sharing common MRE, inhibiting normal miRNA targeting activity on mRNA. These MRE sharing elements form the posttranscriptional ceRNA network to regulate mRNA expression. ceRNAs are widely implicated in many biological processes. Recent studies have identified ceRNAs associated with a number of diseases including cancer. This brief review focuses on the molecular mechanism of ceRNA as part of the complex post-transcriptional regulatory circuit in cell and the impact of ceRNAs in development and disease.

Viral/plasmid captures in Crenarchaea.

tRNA genes are the integration sites of viral/plasmid genomes into their hosts chromosomes by homologous recombination catalyzed by integrases. The crossover between viral/plasmid and host genomes leaves 3'-fractional tRNA motif as tell-tale marker of integration on host-chromosome. This 3'-fractional tRNA motif on host genome is our retrenched tRNA (rtRNA). To track integration in Crenarchaea, host rtRNAs, and conserved features in viral/plasmid tRNA motifs and in integrases were identified. The viral-integrase has a conserved 24-nucleotide long motif, GTATTATGTTTACTCAATAGAGAA in the N-terminal region. Upstream of the viral tRNA motif has a conserved poly-cytosine region and a hairpin secondary structure. Corresponding to a host tRNA, we observe up to two rtRNAs on crenarchaeal chromosome. The length of the rtRNA is not random. The fraction of tRNA excised off in rtRNA is either 61.8, or 50, or 38.2, or 23.6%. Thus, the integration fragments the tRNA nonrandomly dividing it approximately in ratios 3:2, or 1:1, or 2:3, or 1:3. More than 79% of rtRNAs have lengths that are excised 38.2% off tRNA. It turns out that 38.2% excision implies that the ratio of the length of tRNA to its rtRNA is just 1.618, the golden ratio. Hence, the vast majority of rtRNAs are at or near the golden ratio. Evidence emerges of new extremophile viral entities.

Circ2Traits: a comprehensive database for circular RNA potentially associated with disease and traits.

Circular RNAs are new players in regulation of post transcriptional gene expression. Animal genomes express many circular RNAs from diverse genomic locations. A recent study has validated a fairly large number of circular RNAs in human, mouse, and nematode. Circular RNAs play a crucial role in fine tuning the level of miRNA mediated regulation of gene expression by sequestering the miRNAs. Their interaction with disease associated miRNAs indicates that circular RNAs are important for disease regulation. In this paper we studied the potential association of circular RNAs (circRNA) with human diseases in two different ways. Firstly, the interactions of circRNAs with disease associated miRNAs were identified, following which the likelihood of a circRNA being associated with a disease was calculated. For the miRNAs associated with individual diseases, we constructed a network of predicted interactions between the miRNAs and protein coding, long non-coding and circular RNA genes. We carried out gene ontology (GO) enrichment analysis on the set of protein coding genes in the miRNA- circRNA interactome of individual diseases to check the enrichment of genes associated with particular biological processes. Secondly, disease associated SNPs were mapped on circRNA loci, and Argonaute (Ago) interaction sites on circular RNAs were identified. We compiled a database of disease-circRNA association in Circ2Traits (http://gyanxet-beta.com/circdb/), the first comprehensive knowledgebase of potential association of circular RNAs with diseases in human.

Systems biology of cancer biomarker detection.

Cancer systems-biology is an ever-growing area of research due to explosion of data; how to mine these data and extract useful information is the problem. To have an insight on carcinogenesis one need to systematically mine several resources, such as databases, microarray and next-generation sequences. This review encompasses management and analysis of cancer data, databases construction and data deposition, whole transcriptome and genome comparison, analysing results from high throughput experiments to uncover cellular pathways and molecular interactions, and the design of effective algorithms to identify potential biomarkers. Recent technical advances such as ChIP-on-chip, ChIP-seq and RNA-seq can be applied to get epigenetic information transformed into a high-throughput endeavour to which systems biology and bioinformatics are making significant inroads. The data from ENCODE and GENCODE projects available through UCSC genome browser can be considered as benchmark for comparison and meta-analysis. A pipeline for integrating next generation sequencing data, microarray data, and putting them together with the existing database is discussed. The understanding of cancer genomics is changing the way we approach cancer diagnosis and treatment. To give a better understanding of utilizing available resources' we have chosen oral cancer to show how and what kind of analysis can be done. This review is a computational genomic primer that provides a bird's eye view of computational and bioinformatics' tools currently available to perform integrated genomic and system biology analyses of several carcinoma.

SeedSeq: off-target transcriptome database.

Detection of potential cross-reaction between a short oligonucleotide sequence and a longer (unintended) sequence is crucial for many biological applications, such as high content screening (HCS), microarray nucleotide probes, or short interfering RNAs (siRNAs). However, owing to a tolerance for mismatches and gaps in base-pairing with target transcripts, siRNAs could have up to hundreds of potential target sequences in a genome, and some small RNAs in mammalian systems have been shown to affect the levels of many messenger RNAs (off-targets) besides their intended target transcripts (on-targets). The reference sequence (RefSeq) collection aims to provide a comprehensive, integrated, nonredundant, well-annotated set of sequences, including mRNA transcripts. We performed a detailed off-target analysis of three most commonly used kinome siRNA libraries based on the latest RefSeq version. To simplify the access to off-target transcripts, we created a SeedSeq database, a new unique format to store off-target information.

Long noncoding RNAs: new players in the molecular mechanism for maintenance and differentiation of pluripotent stem cells.

Maintenance of the pluripotent state or differentiation of the pluripotent state into any germ layer depends on the factors that orchestrate expression of thousands of genes through epigenetic, transcriptional, and post-transcriptional regulation. Long noncoding RNAs (lncRNAs) are implicated in the complex molecular circuitry in the developmental processes. The ENCODE project has opened up new avenues for studying these lncRNA transcripts with the availability of new datasets for lncRNA annotation and regulation. Expression studies identified hundreds of long noncoding RNAs differentially expressed in the pluripotent state, and many of these lncRNAs are found to control the pluripotency and stemness in embryonic and induced pluripotent stem cells or, in the reverse way, promote differentiation of pluripotent cells. They are generally transcriptionally activated or repressed by pluripotency-associated transcription factors and function as molecular mediators of gene expression that determine the pluripotent state of the cell. They can act as molecular scaffolds or guides for the chromatin-modifying complexes to direct them to bind into specific genomic loci to impart a repressive or activating effect on gene expression, or they can transcriptionally or post-transcriptionally regulate gene expression by diverse molecular mechanisms. This review focuses on recent findings on the regulatory role of lncRNAs in two main aspects of pluripotency, namely, self renewal and differentiation into any lineage, and elucidates the underlying molecular mechanisms that are being uncovered lately.

An siRNA designing tool with a unique functional off-target filtering approach.

Investigations have revealed that silencing unwanted transcripts or off-targeting can induce false positive phenotype during RNA interference (RNAi)-based gene function study. But still the standard computational approaches towards small interfering RNA (siRNA) off-target minimization fall short in terms of addressing this false positive phenotype issue. Some of these off-targets may interfere with the biochemical pathway being investigated. It may also inadvertently target cell's metabolic pathways with unquantifiable consequences on the processes of user's interest. Here, we report the development of a siRNA selection tool that, for the first time, implements a functional off-target filtering that aims to minimize false positive phenotypes arising from inadvertent targets that are functionally similar or related to the direct target gene, along with a multi-parametric classifier (support vector machine) for optimized selection of potent siRNAs. The functional off-target filtering minimizes the number of off-target genes which are functionally related to the direct target gene, i.e. involved in a common biological process and may have similar phenotype. A text-mining algorithm is used to find related biological processes associated with the direct target and each off-target transcript by comparison of the biological processes associated with these genes. It also gives the user a choice to select one or more off-targets that may be potentially more harmful, from a predicted off-target gene list to be filtered out. Testing with huge set of biologically validated siRNAs from three different sources showed consistent good performance of our tool in terms of effective siRNA selection. It outperformed four potent siRNA selection algorithms of present day in terms of specificity in the selection of highly efficient siRNAs when compared on a common test set. A genome wide testing with potent siRNAs used in high-content screening confirmed validation of 2767 designed siRNAs in terms of phenotypic output. This tool presently supports siRNA designs for human genes and is freely available at http://gyanxet-beta.com .

HNOCDB: a comprehensive database of genes and miRNAs relevant to head and neck and oral cancer.

In spite of the wide prevalence of head, neck and oral cancer, HNOC, there is no integrated database on genes and miRNAs associated with all the carcinoma subtypes of HNOC. The objective is to compile a multilayered and comprehensive database of HNOC as a user-friendly resource for researchers devising novel therapeutic strategies. We present HNOCDB, the head, neck and oral cancer database, with the following key features: (i) it tabulates all the different categories of HNOC separately under appropriate subtype-names, and then puts them together in a table headlined All; (ii) the oncogenes/oncomiRs that cause HNOC are listed; their mutations, methylations and polymorphisms loci are marked, and the variations in their expression profiles relative to the normal are recorded; (iii) HNOCDB contains a chromosomal map of HNOC genes and miRNA; (iv) contains references that experimentally validate the reason for the inclusion of the genes and the miRNAs in HNOCDB. HNOCDB is freely accessible for academic and non-profit users via http://gyanxet.com/hno.html.

Analysis of the genome and proteome composition of Bdellovibrio bacteriovorus: indication for recent prey-derived horizontal gene transfer.

The genome/proteome composition of Bdellovibrio bacteriovorus, the predatory microorganism that preys on other Gram-negative bacteria, has been analyzed. The study elucidates that translational selection plays a major role in genome compositional variation with higher intensity compared to other deltaproteobacteria. Other sources of variations having relatively minor contributions are local GC-bias, horizontal gene transfer and strand-specific mutational bias. The study identifies a group of AT-rich genes with distinct codon composition that is presumably acquired by Bdellovibrio recently from Gram-negative prey-bacteria other than deltaproteobacteria. The proteome composition of this species is influenced by various physico-chemical factors, viz, alcoholicity, residue-charge, aromaticity and hydropathy. Cell-wall-surface-anchor-family (CSAPs) and transporter proteins with distinct amino acid composition and specific secondary-structure also contribute notably to proteome compositional variation. CSAPs, which are low molecular-weight, outer-membrane proteins with highly disordered secondary-structure, have preference toward polar-uncharged residues and cysteine that presumably help in prey-predator interaction by providing particular bonds of attachment.

MicroRNA reins in embryonic and cancer stem cells.

MicroRNAs represents a new layer of gene regulation in stem cells by controlling the molecular mechanisms involved in modulating stem cell fate and behavior. Such a role of microRNA is seen in embryonic stem cell as well, maintaining a delicate balance between survival, proliferation, and self-renewal signals. Further, dysregulation of stem cell self-renewal is a likely requirement for the initiation and formation of cancer stem cells that probably pose resistance to current cancer treatments. In fact, the precise mechanism that regulates embryonic as well as cancer stem cell self-renewal and pluripotency remains largely unknown. Understanding the miRNA related stem cell biology and pathways offers great promise for improving stem cell mediated regenerative therapy as well as cancer therapies. Here we summarize some of the emerging evidences demonstrating the role of these molecular switches in embryonic and cancer stem cells.

Novel hybrid encodes both continuous and split tRNA genes?

tRNAs are mostly transcribed from un-fragmented genes, but occasionally also from split genes, with separated 5' and 3' halves. A reanalysis of the existing data on Staphylothermus marinus and Staphylothermus hellenicus hints of a novel hybrid gene that encodes both an un-fragmented and a 5'-split-half together in one. The corresponding 3' complement-gene is located elsewhere on the genome. As un-fragmented, the hybrid gene transcribes to tRNA(lys)(TTT). But as 5'-half, it trans-splices with its 3'-complement-half to tRNA(lys)(CTT), the tRNA missed so far. This hybrid of the split and the un-fragmented in one suggests a deeper synergy between the two, and hints of co-evolution. Furthermore, in a subtle contrast to the widely held idea of conservation of 3'-half, it is precisely the 3'-half that varies in these two tRNAs; the 5'-half remains conserved.