RESUMEN
Information regarding the correct pedigree of and relationship between animals is useful for managing dairy breeding, reducing inbreeding, estimating breeding value, and establishing correct breeding programs. Additionally, the successful implementation of progeny testing is crucial for improving the genetics of dairy cattle, which depends on the availability of correct pedigree information. Incorrect pedigree information leads to bias in bull evaluation. In this study, Neogen GeneSeek Genomic Profiler (GGP) 50K SNP chips were used to identify and verify the sire of Taiwanese Holstein dairy cattle and analyze the reasons that lead to incorrect sire records. Samples were collected from 2,059 cows of 36 dairy farms, and the pedigree information was provided by breeders. The results of sire verification can be divided into three categories: submitted unconfirmed sire, submitted confirmed sire, and incorrectly submitted verified sire. Data on the sires of 1,323 (64.25%) and 572 (27.78%) dairy cows were verified and discovered, respectively. Sires of 1,895 (92.03%) dairy cattle were identified, which showed that the paternal pedigree of dairy cattle could be discovered and verified through genetic testing. An error-like analysis revealed that the data of 37 sires were incorrectly recorded because the bull's NAAB code number was incorrectly entered into the insemination records: for 19 sires, the wrong bull was recorded because the frozen semen of a bull placed in the wrong storage tank was used, 6 had no sire records, and for 12 sires, the NAAB code of the correct bull was recorded but with a wrong stud code, marketing code, or unique number for the stud or breed. To reduce recorded sire error rates by at least 27.78%, automated identification of the mated bull must be adopted to reduce human error and improve dairy breeding management on dairy farms.
Asunto(s)
Genoma , Endogamia , Animales , Bovinos/genética , Femenino , Genómica , Masculino , Linaje , TaiwánRESUMEN
Chronic inflammation may cause endothelial dysfunction and atherosclerosis, resulting in subsequent erectile dysfunction (ED). We examined the relationship between chronic osteomyelitis, which is a chronic inflammatory disease, and ED. A retrospective cohort study was conducted using data from the National Health Insurance Research Database. After excluding patients <40 years of age, 677 male patients newly diagnosed with chronic osteomyelitis (COM) from 1 January 2000 to 31 December 2011 were identified for the study. The non-osteomyelitis comparison cohort consisted of 2706 male participants. The incidence of ED was 2.66-fold higher in the COM cohort than in the non-osteomyelitis cohort (4.01 vs 1.51 per 10 000 person-years). After adjusting for age and comorbidities of coronary heart disease, hypertension, hyperlipidemia, depression, stroke, diabetes, peripheral vascular disease, chronic kidney disease, chronic obstructive pulmonary disease and asthma, the patients with COM had a 2.82-fold risk of ED (95% confidence interval=1.44-5.56). The incidence of ED increased with that of comorbidities in both cohorts. The highest hazard ratio was in patients between 40 and 59 years of age who had COM. Our data showed, for the first time, that COM is a possible risk factor for the development of ED.
Asunto(s)
Disfunción Eréctil/etiología , Osteomielitis/complicaciones , Adulto , Anciano , Anciano de 80 o más Años , Bases de Datos Factuales , Disfunción Eréctil/epidemiología , Humanos , Incidencia , Masculino , Persona de Mediana Edad , Estudios Retrospectivos , Riesgo , Taiwán/epidemiologíaRESUMEN
Chronic fatigue syndrome (CFS) is a complex disorder characterized by profound and persistent fatigue and several comorbidities. CFS was previously reported to be associated with female sexual dysfunction. We propose that CFS might also be associated with organic erectile dysfunction (organic ED). We conducted a retrospective cohort study by using data from the National Health Insurance (NHI) Research Database. We identified 2156 male patients who were newly diagnosed with CFS between January 1, 2003 and December 31, 2006. After excluding those younger than 20 years and prevalent cases, 1976 patients were subjected to analysis, and 7904 people served as healthy controls. All study subjects were followed up from the index date to the date of organic ED diagnosis, withdrawal from the NHI program, or the end of 2011. Compared with the non-CFS cohort, the incidence density rate of organic ED was 1.88-fold higher than that in the CFS cohort (3.23 vs. 1.73 per 1000 person-years) with an adjusted hazard ratio (HR) of 1.88 (95% CI = 1.26-2.81) when adjusting for sex and comorbidities. The combined impacts of patients with CFS and cardiovascular disease (CVD), diabetes mellitus (DM), chronic kidney disease (CKD), depression, and anxiety showed a significant by joint association with organic ED risk compared with patients with no CFS and no counterpart comorbidity. The greatest magnitude of adjusted HR of ED for CFS was observed in individuals without any comorbidity (3.87, 1.95-7.66). The incidence of organic ED is higher among males aged 40 years and over for both CFS and non-CFS cohorts. As the number of comorbidity increases, the incidence of organic ED increases in males without CFS. Higher incidence of organic ED was observed in males with CVD, DM, CKD, depression, or anxiety for both CFS and non-CFS cohorts.
Asunto(s)
Disfunción Eréctil/etiología , Síndrome de Fatiga Crónica/complicaciones , Adulto , Anciano , Disfunción Eréctil/epidemiología , Síndrome de Fatiga Crónica/epidemiología , Humanos , Incidencia , Masculino , Persona de Mediana Edad , Estudios Retrospectivos , Taiwán/epidemiología , Adulto JovenRESUMEN
BACKGROUND: The relationship between tuberculosis (TB) and subsequent chronic kidney disease (CKD) remains unclear. Therefore, we examined the risk of CKD among patients with TB in a nationwide study. METHODS: We conducted a retrospective cohort study using data from the National Health Insurance system of Taiwan. The cohort included 8735 patients who were newly diagnosed with TB. Patients were recruited between 1998 and 2002, and the date of diagnosis was defined as the index date. Each patient was randomly matched with four people from the general population without TB, according to age, gender and the index year. The occurrence of CKD was followed up until the end of 2011. The relative risks of CKD were estimated using the Cox proportional hazard model after adjusting for age, gender, index year and comorbidities. RESULTS: The overall incidence of CKD was 1.27-fold greater in the TB cohort than in the non-TB cohort. The adjusted hazard ratio (HR) of CKD associated with TB was higher in women (1.72; 95% confidence interval [CI]: 1.33-2.22), those aged <50 years (1.67; 95% CI: 1.15-2.41) and those without comorbidities (1.39; 95% CI: 1.06-1.83). In addition, patients with more comorbidities among hypertension, diabetes and hyperlipidemia have a greater risk of developing CKD in both cohorts, and the adjusted HRs were higher in the TB cohort than in the non-TB cohort. CONCLUSION: TB patients had a significantly higher risk of developing CKD than the general population. The detailed mechanisms need further investigation.
Asunto(s)
Insuficiencia Renal Crónica/epidemiología , Tuberculosis/complicaciones , Adulto , Anciano , Comorbilidad , Complicaciones de la Diabetes , Femenino , Humanos , Hiperlipidemias/complicaciones , Hipertensión/complicaciones , Masculino , Persona de Mediana Edad , Modelos de Riesgos Proporcionales , Insuficiencia Renal Crónica/complicaciones , Estudios Retrospectivos , Factores de Riesgo , Taiwán/epidemiología , Tuberculosis/epidemiologíaRESUMEN
Asian foxtail (Uraria crinita (L.) Desv. ex DC.) is an herb cultivated for the use of roots and stems in Taiwanese cuisine. In September 2013, symptoms of leaf blight and basal rot were observed on U. crinita in a commercial field in Longjing District, Taichung, Taiwan, at an incidence of approximately 20%. White mycelia and brown sclerotia formed on the surfaces of the basal stems. The infected plant gradually wilted and eventually died. Diseased lower stem tissues were surface sterilized in 0.6% NaOCl, rinsed with sterile distilled water, and transferred to potato dextrose agar plates. The cultures were incubated at 25°C in the dark. The radial mycelial growth was 9.0 mm/day during the first 4 days, and the diameter of mature sclerotia was 1.76 mm following 3 weeks of incubation. The internal transcribed spacer (ITS) sequence of the isolate was amplified by PCR using the primers ITS5 and ITS4 (2). The amplicon was cloned, sequenced, and deposited in GenBank (Accession No. KJ677121). The sequence similarity was 99% compared with that of Sclerotium rolfsii Sacc. from Spain (GU080230) (1). Based on the characteristics, the fungus was identified as S. rolfsii. The fungal isolate (BCRC FU30230) was deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Pathogenicity tests were conducted on six 2-month-old potted U. crinita plants in a greenhouse. Prior to infesting the plant, fungal inoculum of S. rolfsii BCRC FU30230 was prepared by inoculating the isolate on autoclaved rice (rice/water/dextrose = 50:50:1) in a flask. After 20 days incubation at room temperature, rice colonized by S. rolfsii was placed near the base of the plants (approximately 30 g/plant) in the greenhouse. Sterile rice applied to an equal number of plants served as negative controls. All inoculated plants developed blight symptoms with mycelia and sclerotia produced near the bases of each seedling 1 week after inoculation at an average temperature of 26°C. The control plants remained healthy. The pathogen re-isolated from the inoculated plants was morphologically identical to the original isolate. The pathogenicity test was repeated by inoculated healthy plants with reduced inoculum (five granules/plant). A delay of symptom development was observed and similar results were obtained. To our knowledge, this is the first report of Sclerotium rot on U. crinita in Taiwan, and the first report on U. crinita as a host for S. rolfsii. References: (1) E. Remesal et al. Plant Dis. 94:280, 2010. (2) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, San Diego, 1990.
RESUMEN
This retrospective population-based study aimed to investigate associations between erectile dysfunction (ED) and the irritable bowel syndrome (IBS) using a Taiwanese cohort. We identified 17 608 male patients who were newly diagnosed with IBS from 1997 to 2010. The date that the diagnosis of IBS had been made was the index date. IBS patients with a history of ED before the index date or with incomplete demographic information were excluded. 70 432 age-matched subjects without IBS were selected as comparison cohort. Both cohorts were followed until the end of 2010 or censored. Cox proportional hazard regression model was used to estimate the effects of IBS on ED risks. The incidence rate ratio of ED in the IBS cohort was 2.92 times higher than that in the non-IBS cohort (29.5 vs. 10.1 per 10 000 person-years), with an adjusted hazard ratio (aHR) of 2.58 (95% confidence interval [CI]: 2.24-2.98). The risk of ED increased with increasing age and number of comorbidities. Patients with depression were at a higher risk of ED (aHR: 1.97; 95% CI: 1.49-2.63) compared with the subjects without depression. IBS patients had a higher risk of developing ED compared with non-IBS subjects. Ageing and comorbidities including diabetes, cardiovascular disease, chronic kidney disease and depression were associated with the risk of ED.
Asunto(s)
Disfunción Eréctil/epidemiología , Síndrome del Colon Irritable/epidemiología , Adulto , Envejecimiento , Enfermedades Cardiovasculares/complicaciones , Estudios de Cohortes , Comorbilidad , Depresión/complicaciones , Complicaciones de la Diabetes , Disfunción Eréctil/complicaciones , Humanos , Incidencia , Síndrome del Colon Irritable/complicaciones , Masculino , Persona de Mediana Edad , Insuficiencia Renal Crónica/complicaciones , Estudios Retrospectivos , Riesgo , TaiwánRESUMEN
Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5'CCGACATTGCCGTCAGCGATCACG3' and rv-5'AGCGTTCTTGGGTGTGTTGAGCATTTG3' (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.
RESUMEN
Eustoma (Eustoma russellianum) is an economically important cut flower in Taiwan. Each year more than 1.7 million dozen flowers, mainly exported to Japan in the winter, are produced in greenhouses. In January 2011, eustoma plants with stem and leaf blight symptoms were observed in some greenhouses in Changhua County, Taiwan, at an incidence of 2%. Brown and rotten lesions were presented on the stem and nearby leaves, with white mycelia growing on the surface and black sclerotia (up to 7 mm long) produced inside the stem. Infected plants were completely blighted and eventually died. Diseased stem tissues collected from the field were surface sterilized for 3 min in 0.6% NaOCl, rinsed with sterilized distilled water, and plated on potato dextrose agar. White fungal colonies were consistently isolated. The cultures produced large sclerotia at the peripheries of the plates. Internal transcribed spacer (ITS) sequences of two voucher isolates were determined and deposited in GenBank (Accession Nos. JQ653934 and JQ653935). The sequences were 100% identical to that of Sclerotinia sclerotiorum strain ATCC MYA-4521 (Accession No. FJ810516). In addition, PCR amplified DNA fragments (approximately 630 bp) were obtained by the S. sclerotiorum specific primer pair MP_SsF and MP_UniR (1). On the basis of morphology, ITS sequence homology, and the specific PCR detection, the fungus was identified as S. sclerotiorum. The two fungal isolates (BCRC34830 and BCRC34831) were deposited in Bioresource Collection and Research Center, Hsinchu, Taiwan. Pathogenicity tests were conducted on 1-month-old, second flush eustoma cultivars Ex Rosa Pink Flash and Rosina Blue Ver. 2 after primary flowers had been harvested in the greenhouse. Fungal inoculum consisting of Tref horticultural substrate and wet sterilized rice colonized by S. sclerotiorum BCRC34830 (substrate-rice-water ratio of 2:1:1) was placed near the base of the plants. Ten plants of each cultivar were inoculated with about 800 g of the mixture. Sterile mixture applied to an equal number of plants served as negative controls. Eight plants of each cultivar showed blight symptoms after 1 month of incubation at an average temperature of 26°C. All control plants remained healthy. The pathogen reisolated from the inoculated stems produced sclerotia identical to those isolated in the field, fulfilling Koch's postulates. The pathogenicity test was repeated with similar results. S. sclerotiorum has been reported on eustoma in Argentina (2). To our knowledge, this is the first report of Sclerotinia blight on eustoma in Taiwan. Although the disease was not prevalent on eustoma, the inoculum could be dormant in the greenhouse soil. Awareness of the potential perennial problem could increase the quality of the flowers exported and benefit the flower industry. References: (1) S. Hirschhäuser and J. Fröhlich. Int. J. Food Microbiol. 118:151, 2007. (2) S. Wolcan et al. Plant Dis. 80:223, 1996.
RESUMEN
Gynura bicolor (Roxb. ex Willd.) DC., known as Okinawa spinach or hong-feng-cai, is a commonly consumed vegetable in Asian countries. In May 2010, plants with blight and wilt symptoms were observed in commercial vegetable farms in Changhua, Taiwan. Light brown-to-black blight lesions developed from the top of the stems to the petioles and extended to the base of the leaves. Severely infected plants declined and eventually died. Disease incidence was approximately 20%. Samples of symptomatic tissues were surface sterilized in 0.6% NaOCl and plated on water agar. A Phytophthora sp. was consistently isolated and further plated on 10% unclarified V8 juice agar, with daily radial growths of 7.6, 8.6, 5.7, and 2.4 mm at 25, 30, 35, and 37°C, respectively. Four replicates were measured for each temperature. No hyphal growth was observed at 39°C. Intercalary hyphal swellings and proliferating sporangia were produced in culture plates flooded with sterile distilled water. Sporangia were nonpapillate, obpyriform to ellipsoid, base tapered or rounded, and 43.3 (27.5 to 59.3) × 27.6 (18.5 to 36.3) µm. Clamydospores and oospores were not observed. Oospores were present in dual cultures with an isolate of P. nicotianae (p731) (1) A2 mating type, indicating that the isolate was heterothallic. A portion of the internal transcribed spacer sequence was deposited in GenBank (Accession No. HQ717146). The sequence was 99% identical to that of P. drechsleri SCRP232 (ATCC46724) (3), a type isolate of the species. The pathogen was identified as P. drechsleri Tucker based on temperature growth, morphological characteristics, and ITS sequence homology (3). To evaluate pathogenicity, the isolated P. drechsleri was inoculated on greenhouse-potted G. bicolor plants. Inoculum was obtained by grinding two dishes of the pathogen cultured on potato dextrose agar (PDA) with sterile distilled water in a blender. After filtering through a gauze layer, the filtrate was aliquoted to 240 ml. The inoculum (approximately 180 sporangia/ml) was sprayed on 24 plants of G. bicolor. An equal number of plants treated with sterile PDA processed in the same way served as controls. After 1 week, incubation at an average temperature of 29°C, blight and wilt symptoms similar to those observed in the fields appeared on 12 inoculated plants. The pathogen was reisolated from the lesions of diseased stems and leaves, fulfilling Koch's postulates. The controls remained symptomless. The pathogenicity test was repeated once with similar results. G. bicolor in Taiwan has been recorded to be infected by P. cryptogea (1,2), a species that resembles P. drechsleri. The recorded isolates of P. cryptogea did not have a maximal growth temperature at or above 35°C (1,2), a distinctive characteristic to discriminate between the two species (3). To our knowledge, this is the first report of P. drechsleri being associated with stem and foliar blight of G. bicolor. References: (1) P. J. Ann. Plant Pathol. Bull. 5:146, 1996. (2) H. H. Ho et al. The Genus Phytophthora in Taiwan. Institute of Botany, Academia Sinica, Taipei, 1995. (3) R. Mostowfizadeh-Ghalamfarsa et al. Fungal Biol. 114:325, 2010.
RESUMEN
Asian pear tree (Pyrus pyrifolia) is an important fruit crop in Asian countries. Between the autumn of 2008 and the summer of 2009, stem cankers and twig diebacks of Asian pear trees were observed in middle Taiwan. Necrotic lesions extending from branch scars progressed with age, resulting in darkened vascular discoloration. Two cultivars of Asian pear, Taichung No. 2 grown in Changhwa County and Heng-shan grown in Taichung County, showed the same symptoms. Disease incidence increased rapidly after a rain or storm event, eventually exceeding 50%. Pycnidia on severely infected branches contained one-celled, fusiform to ellipsoidal, smooth- and thin-walled hyaline conidia, with an average length (L) and width (W) of 19.1 (11.3 to 24.8) × 5.9 (4.5 to 8.0) µm and a L/W ratio of 3.2 (n = 44). Diseased branch tissues collected from the two locations were surface sterilized in 0.6% NaOCl, rinsed with water, and plated on potato dextrose agar (PDA). Fungal isolates, recovered from both locations, produced white, aerial mycelium and became dull gray within a week after incubating plates at 25°C. To confirm the identities of the isolates, the internal transcribed spacer (ITS) regions amplified with primers ITS1/ITS4 were deposited in GenBank (Accession Nos. GU395186 and GU395187). Both of the sequences were 99% identical to that of Neofusicoccum parvum (Accession No. EU882162) over a 534-bp alignment. Thus, both morphological and molecular characters confirmed this species as N. parvum (3), reported as the anamorph of Botryosphaeria parva (1). The two voucher isolates (BCRC34605 and BCRC34609) were deposited in Bioresource Collection and Research Center, Hsinchu, Taiwan. Pathogenicity tests were first conducted on 2-year-old greenhouse-potted Asian pear trees utilizing N. parvum isolate BCRC34605. Ten plants of the cv. Mi-li were stem wounded with a 5-mm cork borer at a depth of 2 mm. Inoculation consisted of inserting 5-mm mycelium plugs of the pathogen into the wounds and wrapping with Parafilm. Sterile PDA plugs applied to an equal number of plants with the same methods served as the controls. After 2 months incubation at an average temperature of 21°C, all inoculated plants exhibited necrotic lesions with a mean length of 23.5 mm and the control plants remained symptomless. The pathogen was reisolated from lesions of inoculated stems, thus fulfilling Koch's postulates. Pathogenicity tests were repeated by inoculating the other N. parvum isolate (BCRC34609) on pear cv. Taichung No. 2, resulting in similar results. N. parvum has been reported causing dieback and canker in a wide range of fruit trees, including grapevine (4) and mango trees (2). To our knowledge, this is the first report of N. parvum associated with stem canker and dieback on Asian pear trees. In addition, this is a newly recorded species for the mycobiota of Taiwan. References: (1) P. W. Crous et al. Stud. Mycol. 55:235, 2006. (2) J. Javier-Alva et al. Plant Dis. 93:426, 2009. (3) S. R. Mohali et al. Fungal Divers. 25:103, 2007. (4) J. R. Urbez-Torres and W. D. Gubler. Plant Dis. 93:584, 2009.
RESUMEN
Mung bean sprouts (Vigna radiata (L.) R. Wilczek) are a commonly consumed vegetable in Asian countries. Anthracnose lesions on mung bean sprouts (cv. You-lu-dou from Mayamar) were found in an indoor sprouting facility in Taichung County, Taiwan in May of 2009. The incidence of disease exceeded 90% in some lots. Infected hypocotyls had smooth, diamond-shaped to fusiform brown spots, which became further depressed and enlarged with age. A fungus was isolated on potato dextrose agar (PDA) from symptomatic hypocotyls after surface sterilization in 0.6% NaOCl. Fungal colonies were initially salmon to orange in color and became greenish gray on the surface within a week. Setae were not produced in acervuli that developed on PDA. Conidia in the acervuli were one-celled, cylindrical, and hyaline with an average length and width of 14.8 (7.0 to 23.7) × 4.9 (3.3 to 6.7) µm (n = 53). The internal transcribed spacer (ITS) region was amplified with primers ITS1 and ITS4 (4). The sequence was deposited in GenBank (Accession No. GQ889269). The sequence was 99% identical to that of ATCC 56816 strain of Glomerella acutata (Guerber & J. C. Correll), the teleomorph of Colletotrichum acutatum (J. H. Simmonds) over a 522-bp alignment. Thus, the mung bean pathogen was identified as C. acutatum based on morphological (1) and molecular characters. Pathogenicity of the strain was determined by inoculating mung bean seeds from I-Mei Foods Co. (imported from Australia). The seeds were disinfested in 0.6% NaOCl for 10 min, rinsed with sterile distilled water twice, and immersed in a conidial suspension (1.5 × 104 conidia/ml) of C. acutatum for 10 min. Fifteen inoculated seeds were placed on moistened paper towels, distributed into three flasks, and stored in the dark at 32°C. Symptoms similar to those observed on the original sprouts appeared 3 days later on the hypocotyls of the seedlings and all seedlings were infected by day five. Conidia of C. acutatum were produced on all lesions and colonies of C. acutatum were recovered from symptomatic tissues, fulfilling Koch's postulates. Controls (seed immersed in water) remained symptomless. The pathogenicity test was repeated with similar results. The pathogen has been recorded on mung bean sprouts in Korea (2) and on other Vigna spp. in India (3). To our knowledge, this is the first report of sprout rot of mung bean caused by C. acutatum in Taiwan. References: (1) B. J. Dyko and J. E. M. Mordue. No. 630 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1979. (2) D. K. Kim et al. Plant Pathol. J. 19:203, 2003. (3) K. P. R. Prasanna. Seed Sci. Technol. 13:821, 1985. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, New York, 1990.
RESUMEN
We report bright white-light electroluminescence (EL) from a diode structure consisting of a ZnO nanorod (NR) and a p-type conducting polymer of poly(fluorine) (PF) fabricated using a hydrothermal method. ZnO NRs are successfully grown on an organic layer of PF using a modified seeding layer. The EL spectrum shows a broad emission band covering the entire visible range from 400 to 800 nm. White-light emission is possible because the ZnO-defect-related emission from the ZnO NR/PF heterostructure is enhanced to become over thousand times stronger than that from the usual ZnO NR structure. This strong green-yellow emission associated with the ZnO defects, combined with the blue PF-related emission, results in the white-light emission. Enhancement of the ZnO-defect emission is caused by the presence of Zn(OH)(2) at the interface between the ZnO NRs and PF. Fourier transform infrared spectroscopy reveals that the absorption peaks at 3441, 3502, and 3574 cm(-1) corresponding to the OH group are formed at the ZnO NR/PF heterostructure, which confirms the enhancement of defect emission from the ZnO NR/PF heterostructure. The processing procedure revealed in this work is a convenient and low-cost way to fabricate ZnO-based white-light-emitting devices.
RESUMEN
This study investigates the behavior of water molecules inside Au nanotubes by molecular dynamics. Different sizes of Au nanotubes under three temperatures for three levels of density of Au nanotube have been studied. The structure of each thermodynamic state is analyzed through the characterization of the hydrogen-bond network. An observation of the water molecule distribution reveals that the adsorption of water molecules creates shell-like formation of water near the Au nanotube wall, and such formations are found to be more pronounced within an Au nanotube. Au atoms of different sizes have an affinity for water molecules at different temperatures.
RESUMEN
DDX3 is a human RNA helicase with plethoric functions. Our previous studies have indicated that DDX3 is a transcriptional regulator and functions as a tumor suppressor. In this study, we use a bicistronic reporter to demonstrate that DDX3 specifically represses cap-dependent translation but enhances hepatitis C virus internal ribosome entry site-mediated translation in vivo in a helicase activity-independent manner. To elucidate how DDX3 modulates translation, we identified translation initiation factor eukaryotic initiation factor 4E (eIF4E) as a DDX3-binding partner. Interestingly, DDX3 utilizes a consensus eIF4E-binding sequence YIPPHLR to interact with the functionally important dorsal surface of eIF4E in a similar manner to other eIF4E-binding proteins. Furthermore, cap affinity chromatography analysis suggests that DDX3 traps eIF4E in a translationally inactive complex by blocking interaction with eIF4G. Point mutations within the consensus eIF4E-binding motif in DDX3 impair its ability to bind eIF4E and result in a loss of DDX3's regulatory effects on translation. All these features together indicate that DDX3 is a new member of the eIF4E inhibitory proteins involved in translation initiation regulation. Most importantly, this DDX3-mediated translation regulation also confers the tumor suppressor function on DDX3. Altogether, this study demonstrates regulatory roles and action mechanisms for DDX3 in translation, cell growth and likely viral replication.
Asunto(s)
ARN Helicasas DEAD-box/fisiología , Factor 4E Eucariótico de Iniciación/metabolismo , Hepacivirus/fisiología , Proteínas de Unión a Caperuzas de ARN/metabolismo , ARN Helicasas DEAD-box/genética , Humanos , Mutación Puntual , Biosíntesis de Proteínas , Ribosomas/fisiología , Replicación Viral/fisiologíaRESUMEN
Photon or near-infrared light therapy (NILT) may be an effective neuroprotective method to reduce behavioral dysfunction following an acute ischemic stroke. We evaluated the effects of continuous wave (CW) or pulse wave (P) NILT administered transcranially either 6 or 12 h following embolization, on behavioral outcome. For the studies, we used the rabbit small clot embolic stroke model (RSCEM) using three different treatment regimens: 1) CW power density of 7.5 mW/cm(2); 2) P1 using a frequency of 300 mus pulse at 1 kHz or 3) P2 using a frequency of 2 ms pulse at 100 Hz. Behavioral analysis was conducted 48 h after embolization, allowing for the determination of the effective stroke dose (P(50)) or clot amount (mg) that produces neurological deficits in 50% of the rabbits. Using the RSCEM, a treatment is considered beneficial if it significantly increases the P(50) compared with the control group. Quantal dose-response analysis showed that the control group P(50) value was 1.01+/-0.25 mg (n=31). NILT initiated 6 h following embolization resulted in the following P(50) values: (CW) 2.06+/-0.59 mg (n=29, P=0.099); (P1) 1.89+/-0.29 mg (n=25, P=0.0248) and (P2) 1.92+/-0.15 mg (n=33, P=0.0024). NILT started 12 h following embolization resulted in the following P(50) values: (CW) 2.89+/-1.76 mg (n=29, P=0.279); (P1) 2.40+/-0.99 mg (n=24, P=0.134). At the 6-h post-embolization treatment time, there was a statistically significant increase in P(50) values compared with control for both pulse P1 and P2 modes, but not the CW mode. At the 12-h post-embolization treatment time, neither the CW nor the P1 regimens resulted in statistically significant effect, although there was a trend for an improvement. The results show that P mode NILT can result in significant clinical improvement when administered 6 h following embolic strokes in rabbits and should be considered for clinical development.
Asunto(s)
Terapia por Luz de Baja Intensidad/métodos , Actividad Motora/efectos de la radiación , Accidente Cerebrovascular/radioterapia , Animales , Conducta Animal , Modelos Animales de Enfermedad , Relación Dosis-Respuesta en la Radiación , Embolia Intracraneal/complicaciones , Masculino , Actividad Motora/fisiología , Conejos , Índice de Severidad de la Enfermedad , Análisis Espectral , Accidente Cerebrovascular/etiología , Factores de Tiempo , Resultado del TratamientoRESUMEN
Two virus cultures, RC4 and YC5, were isolated in Taiwan from calla lily (Zantedeschia spp.) cv. Black magic displaying yellow spot and stripe on leaves. Both isolates were mechanically transmitted to various hybrids of Zantedeschia and induced systemic symptoms similar to those observed on diseased Black magic. In addition to Zantedeschia spp., the two virus isolates also infected several cruciferous species and induced mosaic symptoms. Electron microscopy revealed the presence of flexuous virus particles about 750 nm in length. The two isolates were propagated in and purified from mustard plants and were used as immunogens for production of antisera in rabbits. In enzyme-linked immunosorbent assay and sodium dodecyl sulfate-immunodiffusion tests, both antisera reacted strongly with their homologous antigens and with antigens of two Turnip mosaic virus (TuMV) isolates from radish (TuMV-R) and lisianthus (TuMV-L), but not with 21 other different potyviruses tested. In reciprocal tests, antisera against TuMV-R and TuMV-L also reacted strongly with RC4 and YC5 antigens, indicating that these two calla lily isolates are serologically indistinguishable from other known TuMV strains. Cloning and sequence analyses confirmed that both isolates shared 95 to 99% of deduced amino acid sequence identities in the coat protein genes with those of various known TuMV strains. This investigation represents the first record of the natural infection of TuMV in calla lily.
RESUMEN
The extension of the phases of the structure factors of the organic crystal C(25)H(25)NO(2) from 77 starting individual phases using the maximum-entropy method is reported. These starting phases were determined from 90 experimental triplet phases calculated from 215 measured psi-scan three-beam and four-beam diffraction profiles obtained with a rotating-anode X-ray source, where the psi scans were around the reciprocal-lattice vectors of the 001, 002 and 003 reflections. The extension of the structure factors with phase values was carried out using the maximum-entropy method for 2040 measured two-beam Bragg diffraction intensities with 77 starting phases and the symmetry of the space group as the constraints. Use of structure-factor triplets as constraints for entropy maximization was also attempted. The minimum chi(2) criteria were applied to the maximum-entropy extrapolation to discern the best phase set to be used as the new constraints for the next step of generating new phases. With this phase-extension procedure, more than 100 phases were determined and an electron-density map at 1.97 A was deduced.
RESUMEN
Two experiments were conducted to investigate the relationships among reproductive performance, serum gamma-globulin level, carbon clearance ability, and immune responses to phytohemagglutinin and SRBC in the Taiwan Country chicken. In Experiment 1, 480 pullets from 82 sires and 204 dams were used to evaluate the relationship between reproductive performance and immunity. In Experiment 2, 480 pullets, offspring from 55 sires and 173 dams expressing a high or low percentage of serum gamma-globulin and their reciprocal crosses, were used to examine if the level of serum gamma-globulin is associated with reproductive performance and immunity. Results of these experiments indicated that 1) the Taiwan Country chicken had relatively high serum gamma-globulin level compared with those in other reports, 2) serum gamma-globulin level in the Taiwan Country chicken is heritable with an estimate around 0.3 to 0.4, and 3) the high serum gamma-globulin level is genetically associated with low fertility.
Asunto(s)
Pollos/crecimiento & desarrollo , Pollos/genética , Fertilidad/genética , gammaglobulinas/análisis , Crianza de Animales Domésticos/métodos , Animales , Pollos/inmunología , Femenino , Pruebas de Hemaglutinación/veterinaria , Masculino , Reproducción , gammaglobulinas/inmunología , gammaglobulinas/fisiologíaRESUMEN
The relative abundance of serotonin 6 receptor (5HT6) in some limbic regions and the high affinity of some antipsychotics for 5HT6 suggest that the 5HT6 gene might play a role in the pathogenesis of schizophrenic disorders. A recent study reported an association between a C267T polymorphism of the 5HT6 gene and schizophrenia. In order to test whether the 5HT6 gene plays a role in the pathogenesis of schizophrenic disorders, patients (n = 148) and control subjects (n = 160) were genotyped for 5HT6. We also investigated the relationship between genotypes and patients' age at onset and cognitive function in schizophrenic patients. Cognitive function in the patients was evaluated by the Mini-Mental State Examination (MMSE). The results demonstrated no significant differences in genotype or allele frequencies between controls and patients. In the patient group, age at onset and MMSE score did not differ significantly among the three 5HT6 genotpyes. The results of this study suggest that the 5HT6 C267T polymorphism plays no major role in susceptibility to the development of schizophrenia and is not related to cognitive impairment or age at onset in schizophrenic patients. Further studies of the relation between 5HT6 polymorphism and the symptoms and the therapeutic response in schizophrenic patients may help to elucidate the role of 5HT6 in the pathogenesis of schizophrenia.
Asunto(s)
Trastornos del Conocimiento/etiología , Polimorfismo Genético , Receptores de Serotonina/genética , Esquizofrenia/genética , Adulto , Edad de Inicio , Femenino , Genotipo , Humanos , Masculino , Esquizofrenia/patologíaRESUMEN
The effects of anomalous dispersion (resonance) on multiple reflection of x rays and their interference in crystals at atomic absorption edges are studied. Intensity ratios of two inversion-symmetry-related multiple diffractions at or near absorption edges exhibit highly phase-sensitive profiles with strong asymmetric characteristics, unlike those far from the edges. A new resonance perturbation Bethe approach is developed to explain this behavior. This leads to direct determination of the phase change for x-ray reflections at resonance.