Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 16 de 16
Filtrar
Más filtros











Intervalo de año de publicación
1.
Heliyon ; 9(1): e12757, 2023 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-36685395

RESUMEN

Plant invasive success is attributed to invaders' ecological advantages over their native neighbors. However, increasing evidence suggests that these advantages are expected to attenuate over time because of natural enemy accumulation, ecological evolution of native species and autotoxicity. We determined how an invasive Ageratina adenophora could remain its competitive advantages over time by avoiding its autotoxicity. Our results highlighted that the autotoxicity of A. adenophora in its invaded soil was reduced by some microbes. Moreover, an autotoxic allelochemical, 2-coumaric acid glucoside, detected in the invaded soil, demonstrated distinctly autotoxic effects on its seed germination and seedling growth. However, the autotoxic effects were greatly alleviated by a bacterium Bacillus cereus, accumulated by A. adenophora. Furthermore, the allelochemical could be almost completely degraded by B. cereus within 96 h. Accordingly, we speculate that A. adenophora could aggregate B. cereus to release its autotoxicity maintaining its competitive advantages over time.

2.
China Tropical Medicine ; (12): 1194-2022.
Artículo en Chino | WPRIM (Pacífico Occidental) | ID: wpr-973821

RESUMEN

@#Abstract: Objective To understand the distribution and drug resistance of pathogenic bacteria of bloodstream infection in Fujian Province, and to provide reference for clinical rational drug use. Methods Bacteria identification and antimicrobial susceptibility test were carried out on the isolated strains of blood culture samples in 31 medical institutions in Fujian Province according to the unified plan. The data were statistically analyzed by WHONET 5.6 software according to the Clinical and Laboratory Standards Institute (CLSI) drug sensitivity executive standard in 2021. Results After removing the duplicate strains, 10 356 strains of bacteria were collected, including 3 668 strains of Gram-positive bacteria (35.4%) and 6 688 strains of Gram-negative bacteria (64.6%). The top 5 bacteria are Escherichia coli, Klebsiella pneumoniae, coagulase negative Staphylococcus, Staphylococcus aureus and Pseudomonas aeruginosa. In this study, the detection rate of methicillin-resistant Staphylococcus aureus (MRSA) was 24.5%, and the detection rate of methicillin-resistant coagulase-negative Staphylococcus aureus (MRCNS) was 76.8%. Vancomycin, teicoplanin and linezolid resistant staphylococci were not found. The detection rate of penicillin resistant Streptococcus pneumoniae was 3.2%. Vancomycin resistant Enterococcus faecalis and Enterococcus faecium were 0.8% and 1.1% respectively. The resistance rate of Escherichia coli to carbapenems was 0.8%, and the resistance rate to levofloxacin was 41.9%; the resistance rate of Klebsiella pneumoniae to carbapenems was 15.0%. The resistance rate of Acinetobacter baumannii to carbapenems was 45.1%; the detection rate of Pseudomonas aeruginosa was only 14.2%, and it maintained a high sensitivity to most drugs. Conclusions Most bloodstream infections in Fujian Province are caused by Escherichia coli, Klebsiella pneumoniae and Staphylococcus. The drug resistance of some strains is not optimistic, so we should continue to strengthen the clinical application management of antibiotics and use them correctly and reasonably. Keywords: Bloodstream infection; bacteria; antibiotics; drug resistance monitoring

3.
Clin Lab ; 66(10)2020 Oct 01.
Artículo en Inglés | MEDLINE | ID: mdl-33073959

RESUMEN

BACKGROUND: Lung cancer is the most prevalent and deadliest cancer worldwide. The present study aims to determine the prognosis value of low expression long non-coding RNAs (lncRNAs) in LUAD. METHODS: RNA-seq data and clinical information were downloaded from The Cancer Genome Atlas (TCGA) data-base. Dysregulated genes between LUAD and paracancerous tissue were screened by GeneSpringGX. Prognostic lncRNAs which were low expressed in LUAD were filtrated by Ualcan, then further verified through the TCGA database. The association between clinicopathological features and the expression level of these lncRNAs was tested by chi-square test. Cox regression analysis was performed to test independent prognosis risk factors. Diagnostic efficiency was predicted by receiver operating characteristic (ROC) analysis. Gene Ontology (GO) functional and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed to explore potential functions of these prognostic signatures. RESULTS: Nine prognostic lncRNAs (LINC00092, LINC00908, WWC2-AS2, RPL13AP17, CHIAP2, SFTA1P, SIGLEC17P, CYP2B7P1, CYP4Z2P) were screened out through Ualcan and further verified by TCGA. Among them, six lncRNAs (RPL13AP17, CHIAP2, SFTA1P, SIGLEC17P, CYP2B7P1, CYP4Z2P) were pseudogene transcripts. Multivariate Cox regression analysis showed that three lnRNAs (LINC00908, WWC2-AS2 CYP2B7P) were independent prognostic risk factors for OS and two lncRNAs (WWC2-AS2, SIGLEC17P) were independent prognostic risk factors for RFS in LUAD patients. Meanwhile, they showed powerful diagnostic value by ROC curve analysis. GO analysis revealed correlation genes of prognostic signatures were mainly enriched in plasma membrane, plasma membrane part, purine nucleotide binding, cytoskeleton and ribonucleotide binding and KEGG pathway analysis showed mainly enriched in cell adhesion molecules. CONCLUSIONS: The results illuminated that four lncRNAs (LINC00908, WWC2-AS2, CYP2B7P, SIGLEC17P) may be a powerful diagnostic and prognostic assessment tool for human LUAD.


Asunto(s)
Adenocarcinoma del Pulmón , Neoplasias Pulmonares , ARN Largo no Codificante , Adenocarcinoma del Pulmón/diagnóstico , Adenocarcinoma del Pulmón/genética , Regulación Neoplásica de la Expresión Génica , Humanos , Neoplasias Pulmonares/diagnóstico , Neoplasias Pulmonares/genética , Pronóstico , ARN Largo no Codificante/genética
4.
Zhongguo Shi Yan Xue Ye Xue Za Zhi ; 27(3): 893-898, 2019 Jun.
Artículo en Chino | MEDLINE | ID: mdl-31204950

RESUMEN

OBJECTIVE: To investigate the gene mutation types and spectrum of α, ß-thalassemia in Fuzhou area of China. METHODS: Thalassemia gene screening was performed in the women receiving physical, prenatal, and pre-pregnancy examination, and the patients with suspected thalassemia in our hospital from July 2013 to March 2018.Genotypes of thalassem were detected by Gap-PCR and RDB-PCR. RESULTS: 1042 were positive among 2074 suspected cases with a positive rate of 50.24%; 618 cases were confirmed to be α-thalassemia and with a positive rate of 29.8%; 409 cases were confirmed to be ß-thalassemia with a positive rate of 19.72%. 15 cases were confirmed to be α-ß complex thalassemia with a positive rate of 0.72%. the --SEA/αα(76.54%) was the most common genotype among α-thalassemia, -α3.7/αα(10.03%) and -α4.2/αα(2.91%) in hot pursuit. In addition, IVS-II-55 (T->G) and IVS-II-119 (-G, +CTCGGCCC) were newly found alpha mutations; the IVS-2-654 (C→T) (40.83%) was the most common genotype among ß-thalassemia, CD41-42 (-TCTT) (35.94%) and CD17 (A→T) (9.78%) in hot pursuit. CONCLUSION: The genotype of thalassemia in Fuzhou area is highly heterogenic, --SEA/αα is the most common genotype among α-thalassemia, IVS-2-654 (C→T) is the most common genotype among ß-thalassemia, Meanwhile, two α-mutation sites are found in this study which were not reported in the Database of Human Hemoglobin Variants and Thalassemias.


Asunto(s)
Talasemia alfa , Talasemia beta , China , Femenino , Genotipo , Humanos , Mutación , Embarazo
5.
Sci Rep ; 9(1): 511, 2019 01 24.
Artículo en Inglés | MEDLINE | ID: mdl-30679591

RESUMEN

In weed management, using native parasites to control exotic weeds is considered a better alternative than classical biological control. But the risk must be assessed because of the potential damage caused by these agents. We conducted this project to investigate the mechanism driving the choice of a native obligate parasite, Cuscuta australis, between the exotic, Humulus scandens, and native plants as its host through field and pot experiments. The results showed that C. australis preferred the exotic weed over native (naturalized) hosts and caused a notable reduction in the biomass of H. scandens in the field. In contrast, the results of the pot experimentindicated that C. australis preferred a mix of native (naturalized) hosts over the exotic weed. Both texperiments indicated that the parasitic preference of C. australis was induced more by light irradiance than plant water, carbon (C), nitrogen (N) and phosphorus (P) contents, indicating that the native parasite can only be used to control H. scandens when the exotic weed forms mono-cultures or dominates the community. Accordingly, induction and release of C. australis to control H. scandens should be conducted with great caution.


Asunto(s)
Cuscuta/fisiología , Humulus/parasitología , Malezas/fisiología , Biomasa , Carbono/metabolismo , Interacciones Huésped-Parásitos , Nitrógeno/metabolismo , Fósforo/metabolismo , Agua/metabolismo , Control de Malezas
6.
Ying Yong Sheng Tai Xue Bao ; 24(5): 1335-40, 2013 May.
Artículo en Chino | MEDLINE | ID: mdl-24015552

RESUMEN

In 2008-2009, an investigation was conducted on the effects of three typical forest restoration approaches, i. e., naturally restored secondary forest, artificially restored native species Pinus massoniana plantation (Masson pine plantation), and introduced species Pinus elliottii plantation (slash pine plantation), on the soil quality in red soil region of Southern China. The results showed that the soil moisture content, bulk density, particle composition, and the contents of total carbon (C), total nitrogen (N), total phosphorus (P), organic C, available N, available P, and available potassium (K) in natural secondary forest were all superior to those in artificial plantations. The soil physical, chemical, and microbial properties were integrated into a soil quality index, which was significantly higher (1.20 +/- 0.10) in natural secondary forest than in Masson pine plantation (0.59 +/- 0.03) and slash pine plantation (0.59 +/- 0.06). Our results suggested as compared with the restoration with native species P. massoniana and with introduced P. elliottii, natural restoration could be a better forest restoration approach to improve the soil quality in red soil region of Southern China.


Asunto(s)
Conservación de los Recursos Naturales/métodos , Ecosistema , Monitoreo del Ambiente/métodos , Suelo/química , Árboles/crecimiento & desarrollo , China , Agua/análisis
7.
Zhonghua Nei Ke Za Zhi ; 52(4): 309-12, 2013 Apr.
Artículo en Chino | MEDLINE | ID: mdl-23925358

RESUMEN

OBJECTIVE: To investigate the association of urinary albumin-to-creatinine ratio (UACR) and the diameter of retinal vessel in population with essential hypertension in Fujian coastal area. METHODS: Central retinal artery and vein equivalents (CRAE and CRVE) were measured from the avoiding mydriatic digitized photographs and semi-automatic fundus analysis software, as well as albumin and urine creatinine. RESULTS: There were significant differences in CRAE levels among the normal control group, normoalbuminuria with essential hypertension group and microalbuminuria with essential hypertension group [(135.68 ± 10.10) µm, (129.79 ± 10.48) µm, (125.29 ± 11.17) µm, all P values < 0.01]. The CRAE levels were significantly negative correlated with UACR (r = -0.29, P < 0.01). Linear regression analysis showed CRAE was associated with UACR in the patients with hypertension(ß = -5.0, P < 0.01). Logistic regression analysis showed, systolic blood pressure (ß = 1.08, P = 0.02) was risk factor for CRAE abnormality. The CRAE abnormality was increased in turn in the normal control group, normoalbuminuria with the essential hypertension group and microalbuminuria with essential hypertension group (P < 0.01). CONCLUSION: The reduction of central retinal artery diameter are associated with the hypertensive renal damage. UACR and CRAE could be used to evaluate the microvascular lesions and be used as an indicator to assess the target organs damage in essential hypertension patients.


Asunto(s)
Albuminuria/epidemiología , Presión Sanguínea/fisiología , Hipertensión/fisiopatología , Vasos Retinianos/anatomía & histología , Anciano , Albuminuria/diagnóstico , Albuminuria/etiología , Creatinina/orina , Hipertensión Esencial , Humanos , Riñón , Análisis de Regresión , Arteria Retiniana/anatomía & histología , Vena Retiniana/anatomía & histología , Vasos Retinianos/fisiopatología , Retinoscopía , Factores de Riesgo
8.
Zhonghua Xin Xue Guan Bing Za Zhi ; 41(10): 876-81, 2013 Oct.
Artículo en Chino | MEDLINE | ID: mdl-24377896

RESUMEN

OBJECTIVE: To observe the cardiovascular risk factors and vascular damage status of pre- and hypertensive population in the coastal areas of Fujian province. METHODS: This cross-sectional study surved 3344 Fujian coastal people aged older than 30 years. Glycolipids, uric acid, urine, microalbumin, brachial-ankle pulse wave velocity(baPWV) and central retinal arteriolar equivalent(CRAE) measurements were performed. Variance analysis and binary logistic regression were applied to evaluate cardiovascular risk factors and vascular damage of prehypertensive as well as hypertensive population. RESULTS: (1) The morbidity of prehypertension as well as hypertension was 30.0% in coastal population of Fujian Province, there were more than 3 cardiovascular risk factors in 65.5% (909/1388) of the hypertensive population and 37.5% of the prehypertensive population.(2) The abnormal rates of creatinine ratio(UACR), baPWV, and CRAE in hypertensive [25.7% (357/1388) , 84.2% (1169/1388) , 29.5% (409/1388) ] and prehypertensive population [20.0% (176/880) , 29.1% (256/880) , 25.6% (225/880)] were significantly higher than those of normotensive individuals [8.5% (91/1076), 8.9% (96/1076), 18.8% (202/1076), all P < 0.05].(3) Prehypertension and hypertension served as independent risk factors of UACR, baPWV and CRAE according to logistic regression analysis. The odds ratios (OR) value and 95% confidence intervals were 1.496 (1.095-2.044) , 2.477 (1.815-3.381) , 0.700 (0.549-0.891) in prehypertensive population, and 1.976 (1.454-2.686) , 7.707 (12.938-24.235) , 0.591 (0.474-0.736) in hypertensive population. CONCLUSION: Multiple cardiovascular risk factors coexist in prehypertensive and hypertensive population in the coastal area of coastal areas of Fujian province and there is more morbidity of vascular damage in prehypertensive and hypertensive individuals compared to normotensive subjects in these areas.


Asunto(s)
Presión Sanguínea , Enfermedades Cardiovasculares/complicaciones , Hipertensión/epidemiología , Hipertensión/fisiopatología , Prehipertensión/epidemiología , Prehipertensión/fisiopatología , Anciano , Índice Tobillo Braquial , Enfermedades Cardiovasculares/fisiopatología , China/epidemiología , Estudios Transversales , Femenino , Humanos , Modelos Logísticos , Masculino , Persona de Mediana Edad , Factores de Riesgo
9.
Zhongguo Gu Shang ; 25(8): 634-8, 2012 Aug.
Artículo en Chino | MEDLINE | ID: mdl-25058951

RESUMEN

OBJECTIVE: To explore therapeutic effects of bone setting manipulation for the treatment of over degree II supination-eversion fractures of ankle,and analyze manipulative reduction mechanism. METHODS: From 2005 to 2008, 95 patients with over degree II supination-eversion fractures of ankle were treated respectively by manipulation and operation. There were 43 cases [11 males and 32 females with an average age of (44.95 +/- 12.65) years] in manipulation group, and 2 cases were degree II, 11 cases were degree III, and 30 cases were degree IV. There were 52 cases [21 males and 31 females with an average age of (39.96 +/- 13.28) years] in operative group,and 6 cases were degree II, 18 cases were degree III, and 28 cases were degree IV. Bone setting manipulation and hard splint external fixation were applied to manipulative group. Operative reduction internal fixation was performed in operative group. X-ray was used to evaluate reduction of fracture before and after treatment, 2 months after treatment. Ankle joint function was evaluated according to Olerud-Molander scoring system after 6 months treatment. RESULTS: All patients were followed up with good reduction. Three cases occurred wound complication in operative group, but not in manipulative group. In manipulation group, 19 cases got excellent results, 20 cases good and 4 cases fair; while in operative group, 30 cases got excellent results, 20 cases good and 2 cases poor. There were no significant differences in fracture reduction and ankle joint function recovery between two groups (P > 0.05). Efficacy of operative treatment was better than that of manipulative treatment at degree IV fracture (P < 0.05). CONCLUSION: Bone setting manipulation is a good method for treating supination-eversion ankle joint fractures, which has advantages of simple and safe operation, reliable efficacy. For ankle join fracture at degree IV, manipulative reduction should be adopted earlier, and operative treatment also necessary


Asunto(s)
Traumatismos del Tobillo/terapia , Articulación del Tobillo/fisiología , Fracturas Óseas/terapia , Manipulación Ortopédica/métodos , Supinación , Adulto , Traumatismos del Tobillo/fisiopatología , Estudios de Casos y Controles , Femenino , Fracturas Óseas/fisiopatología , Humanos , Masculino
10.
Ying Yong Sheng Tai Xue Bao ; 22(3): 565-70, 2011 Mar.
Artículo en Chino | MEDLINE | ID: mdl-21657008

RESUMEN

A pot experiment with litter bags was conducted to study the relationships between the initial chemical composition of 8 kind forest leaf litters and 4 kind mixed leaf litters and their decomposition rates in degraded red soil hilly region of Southern China. Comparing with needle-leaf litters, broad-leaf litters had significantly higher contents of N, P, K, and Mg, but significantly lower contents of lignin and C. The decomposition rates of test litters were significantly positively correlated with the litters initial contents of N, P, K, and Mg (P < 0.05), and negatively correlated with the initial contents of lignin and C as well as the lignin/N, lignin/P, and C/P ratios (P < 0. 05). The lignin content explained 54.3% of the variation in litter decomposition rates, being the key affecting factor. Litters C, N, and P contents also had close correlations with the decomposition rates, and together with lignin content, contributed 81.4% of the variation. It was suggested that in the process of vegetation restoration in degraded red soil hilly region of Southern China, introducing broad-leaf trees with lower lignin and higher N and P contents would benefit the acceleration of forest litters decomposition and the restoration of soil fertility.


Asunto(s)
Ecosistema , Nitrógeno/análisis , Fósforo/análisis , Hojas de la Planta/química , Árboles/química , China , Sedimentos Geológicos/química , Suelo/análisis , Suelo/química , Árboles/crecimiento & desarrollo
11.
Yi Chuan ; 32(1): 49-53, 2010 Jan.
Artículo en Chino | MEDLINE | ID: mdl-20085885

RESUMEN

To detect the mutations of fibrillin-1 (FBN1) gene in the patients with Marfan syndrome (MFS), polymerase chain reaction (PCR) and denaturing high-performance liquid chromatography (DHPLC) were conducted to screen for the mutations in FBN1 gene. Sequence analyses were carried out when the DNA amplification fragments of the DHPLC elution profiles showed difference from the corresponding normal elution profile. Two novel mutations were detected in two families with MFS, respectively. One was a multiplex mutation in exon 55 containing a deletion mutation c.6862_6871delGGCTGTGTAG (p.Gly2288MetfsX109), a synonymous mutation (c.6861A>G) and an intronic mutation c.[6871+1_6871+11delGTAAGAGGATC; 6871+34dupCATCAGAAGTGACAGTGGACA], and the other was a missense mutation in exon 20 c.2462G>A (p.Cys821Tyr). The results indicated that the deletion mutation c.[6862_6871delGGCTGT GTAG; 6871+1_6871+11delGTAAGAGGATC] (p.Gly2288MetfsX109) and the missense mutation c.2462G>A (p.Cys821Tyr) of FBN1 gene may cause the two family patients with MFS respectively.


Asunto(s)
Pueblo Asiatico/genética , Síndrome de Marfan/genética , Proteínas de Microfilamentos/genética , Mutación , Pueblo Asiatico/etnología , Secuencia de Bases , China , Exones , Femenino , Fibrilina-1 , Fibrilinas , Humanos , Intrones , Masculino , Síndrome de Marfan/etnología , Conformación Molecular , Datos de Secuencia Molecular , Linaje
12.
Huan Jing Ke Xue ; 29(8): 2377-84, 2008 Aug.
Artículo en Chino | MEDLINE | ID: mdl-18839604

RESUMEN

Reservoirs are significant sources of emissions of the greenhouse gases. Discussing greenhouse gas emission from the reservoirs and its influence factors are propitious to evaluate emission of the greenhouse gas accurately, reduce gas emission under hydraulic engineering and hydropower development. This paper expatiates the mechanism of the greenhouse gas production, sums three approaches of the greenhouse gas emission, which are emissions from nature emission of the reservoirs, turbines and spillways and downstream of the dam, respectively. Effects of greenhouse gas emission were discussed from character of the reservoirs, climate, pH of the water, vegetation growing in the reservoirs and so on. Finally, it has analyzed the heterogeneity of the greenhouse gas emission as well as the root of the uncertainty and carried on the forecast with emphasis to the next research.


Asunto(s)
Contaminantes Atmosféricos/análisis , Dióxido de Carbono/análisis , Monitoreo del Ambiente/métodos , Metano/análisis , Agua Dulce/análisis , Efecto Invernadero , Abastecimiento de Agua/análisis
14.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 24(4): 440-2, 2007 Aug.
Artículo en Chino | MEDLINE | ID: mdl-17680538

RESUMEN

OBJECTIVE: To detect novel mutations in the fibrillin 1 (FBN1) and transforming growth factor beta receptor type II (TGFBR2) genes by screening the genes from 14 patients with Marfan syndrome. METHODS: Denaturing high performance liquid chromatography (DHPLC) was introduced to screen for FBN1 and TGFBR2 mutations exon-by-exon. The DNA amplification fragments which DHPLC elution profiles showed different from the corresponding normal elution profile were sequenced to identify the positions and types of mutations. Restriction fragment length polymorphism (RFLP) was employed to further prove the mutations when needed. RESULTS: Two gene mutations of the FBN1 were found in the patients with Marfan syndrome. They were a novel substitutional mutation (Intron29 +4A > T) of FBN1 and a recurrent nonsense mutation (8080C >T) of FBN1. CONCLUSION: Intron29 +4A > T and 8080C > T of FBN1 are possibly the pathogenesis of the MFS patients.


Asunto(s)
Síndrome de Marfan/genética , Proteínas de Microfilamentos/genética , Mutación , Proteínas Serina-Treonina Quinasas/genética , Receptores de Factores de Crecimiento Transformadores beta/genética , Adolescente , Secuencia de Bases , Análisis Mutacional de ADN , Femenino , Fibrilina-1 , Fibrilinas , Humanos , Masculino , Reacción en Cadena de la Polimerasa , Polimorfismo de Longitud del Fragmento de Restricción , Receptor Tipo II de Factor de Crecimiento Transformador beta
15.
Huan Jing Ke Xue ; 28(5): 1126-30, 2007 May.
Artículo en Chino | MEDLINE | ID: mdl-17633190

RESUMEN

Utilization of different carbon source type in Biolog-GN microplates by soil microbial communities under different forest restoration types was studied. The results shows that metabolic capacity of soil microbial commuinty under natural secondary forest are higher than those of three plantations. Carbohydrates, carboxylic acids and amino acids are the main carbon sources possessing higher utilization efficiency or utilization intensity. At the same time, the three carbon source types contributed to the differentiation of soil microbial communities from four forest restoration types. And the three types of carbon sources were sensitive to change of soil microbial communities. These results possessed important referenced significance for substrate selection during the study on soil microbial communities and their functional diversity with incubating methods.


Asunto(s)
Bacterias/metabolismo , Carbono/metabolismo , Microbiología del Suelo , Árboles/crecimiento & desarrollo , Bacterias/clasificación , Bacterias/crecimiento & desarrollo , Biodiversidad , Recuento de Colonia Microbiana , Ecosistema , Árboles/clasificación
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA