Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Identification of Novel NSD1 variations in four Pediatric cases with sotos Syndrome.

OBJECTIVE: Sotos syndrome (SOTOS) is an uncommon genetic condition that manifests itself with the following distinctive features: prenatal overgrowth, facial abnormalities, and intellectual disability. This disorder is often associated with haploinsufficiency of the nuclear receptor-binding SET domain protein 1 (NSD1)gene. We investigated four pediatric cases characterized by early-onset overgrowth and developmental delay. The primary objective of this study was to achieve accurate genetic diagnoses. DESIGN&METHODS: A sequential analysis approach comprising chromosomal karyotyping, whole exome sequencing, and microarray analysis was conducted. RESULTS: All four cases exhibited variations in the NSD1 gene, with the identification of four previously unreported de novo variants, each specific to one case.Specifically, Case 1 carried the NSD1 (NM_022455): c.2686 C > T(p.Q896X) variant, Case 2 had the NSD1 (NM_022455): c.2858_2859delCT(p.S953X) variant, Case 3 displayed a chromosomal aberration, chr5: 5q35.2q35.3(176,516,604-176,639,249)×1, which encompassed the 5'-untranslated region of NSD1, and Case 4 harbored the NSD1 (NM_022455): c.6397T > G(p.C2133G) variant. CONCLUSION: This study not only provided precise diagnoses for these cases but also supplied significant evidence to facilitate informed consultations. Furthermore, our findings expanded the spectrum of mutations associated with SOTOS.

SGMS1 facilitates osteogenic differentiation of MSCs and strengthens osteogenesis-angiogenesis coupling by modulating Cer/PP2A/Akt pathway.

Mesenchymal stem cell (MSC)-mediated coupling of osteogenesis and angiogenesis is a critical phenomenon in bone formation. Herein, we investigated the role and mechanism of SGMS1 in the osteogenic differentiation of MSCs and, in combination with osteogenesis and angiogenesis, to discover new therapeutic targets for skeletal dysplasia and bone defects. SGMS1 addition accelerated MSC osteogenic differentiation, whereas SGMS1 silencing suppressed this process. Moreover, SGMS1 overexpression inhibited ceramide (Cer) and promoted sphingomyelin (SM) levels. SM treatment neutralized the suppressive effect of shSGMS1 on osteogenesis. SGMS1 restrained PP2A activity by regulating Cer/SM metabolism and thus enhanced the levels of phosphorylated Akt, Runx2, and vascular endothelial growth factor (VEGF). Furthermore, SGMS1 transcription was regulated by Runx2. SGMS1 increased MSC-mediated angiogenesis by promoting VEGF expression. SGMS1 addition promoted rat bone regeneration in vivo. In conclusion, SGMS1 induces osteogenic differentiation of MSCs and osteogenic-angiogenic coupling through the regulation of the Cer/PP2A/Akt signaling pathway.

Functional assessment of a novel biallelic MYH3 variation causing CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B).

BACKGROUND: The MYH3-associated myosinopathies comprise a spectrum of rare neuromuscular disorders mainly characterized by distal arthrogryposis with or without other features like pterygia and vertebrae fusion. CPSKF1B (contractures, pterygia, and spondylocarpotarsal fusion syndrome1B) is the only known autosomal recessiveMYH3-associated myosinopathy so far, with no more than two dozen cases being reported. MATERIALS AND METHODS: A boy with CPSKF1B was recruited and subjected to a comprehensive clinical and imaging evaluation. Genetic detection with whole-exome sequencing (WES) was performed on the patient and extended family members to identify the causative variation. A series of in silico and in vitro investigations were carried out to verify the pathogenicity of the two variants of the identified compound heterozygous variation. RESULTS: The patient exhibited moderate CPSKF1B symptoms including multiarticular contractures, webbed neck, and spondylocarpotarsal fusion. WES detected a compound heterozygous MYH3 variation consisting of two variants, namely NM_002470.4: c.3377A>G; p. (E1126G) and NM_002470.4: c.5161-2A>C. It was indicated that the NM_002470.4: c.3377A>G; p. (E1126G) variant mainly impaired the local hydrogen bond formation and impacted the TGF-B pathway, while the NM_002470.4: c.5161-2A>C variant could affect the normal splicing of pre-mRNA, resulting in the appearance of multiple abnormal transcripts. CONCLUSIONS: The findings of this study expanded the mutation spectrum of CPSKF1B, provided an important basis for the counseling of the affected family, and also laid a foundation for the functional study of MYH3 mutations.

NTRK1 knockdown induces mouse cognitive impairment and hippocampal neuronal damage through mitophagy suppression via inactivating the AMPK/ULK1/FUNDC1 pathway.

Hippocampal neuronal damage may induce cognitive impairment. Neurotrophic tyrosine kinase receptor 1 (NTRK1) reportedly regulates neuronal damage, although the underlying mechanism remains unclear. The present study aimed to investigate the role of NTRK1 in mouse hippocampal neuronal damage and the specific mechanism. A mouse NTRK1-knockdown model was established and subjected to pre-treatment with BAY-3827, followed by a behavioral test, Nissl staining, and NeuN immunofluorescence (IF) staining to evaluate the cognitive impairment and hippocampal neuronal damage. Next, an in vitro analysis was conducted using the CCK-8 assay, TUNEL assay, NeuN IF staining, DCFH-DA staining, JC-1 staining, ATP content test, mRFP-eGFP-LC3 assay, and LC3-II IF staining to elucidate the effect of NTRK1 on mouse hippocampal neuronal activity, apoptosis, damage, mitochondrial function, and autophagy. Subsequently, rescue experiments were performed by subjecting the NTRK1-knockdown neurons to pre-treatment with O304 and Rapamycin. The AMPK/ULK1/FUNDC1 pathway activity and mitophagy were detected using western blotting (WB) analysis. Resultantly, in vivo analysis revealed that NTRK1 knockdown induced mouse cognitive impairment and hippocampal tissue damage, in addition to inactivating the AMPK/ULK1/FUNDC1 pathway activity and mitophagy in the hippocampal tissues of mice. The treatment with BAY-3827 exacerbated the mouse depressive-like behavior induced by NTRK1 knockdown. The results of in vitro analysis indicated that NTRK1 knockdown attenuated viability, NeuN expression, ATP production, mitochondrial membrane potential, and mitophagy, while enhancing apoptosis and ROS production in mouse hippocampal neurons. Conversely, pre-treatment with O304 and rapamycin abrogated the suppression of mitophagy and the promotion of neuronal damage induced upon NTRK1 silencing. Conclusively, NTRK1 knockdown induces mouse hippocampal neuronal damage through the suppression of mitophagy via inactivating the AMPK/ULK1/FUNDC1 pathway. This finding would provide insight leading to the development of novel strategies for the treatment of cognitive impairment induced due to hippocampal neuronal damage.

Protein Labeling Facilitates the Understanding of Protein Corona Formation via Fluorescence Resonance Energy Transfer and Fluorescence Correlation Spectroscopy.

Once nanoparticles enter into the biological milieu, nanoparticle-biomacromolecule complexes, especially the protein corona, swiftly form, which cause obvious effects on the physicochemical properties of both nanoparticles and proteins. Here, the thermodynamic parameters of the interactions between water-soluble GSH-CdSe/ZnS core/shell quantum dots (GSH-QDs) and human serum albumin (HSA) were investigated with the aid of labeling fluorescence of HSA. It was proved that the labeling fluorescence originating from a fluorophore (BDP-CN for instance) could be used to investigate the interactions between QDs and HSA. Gel electrophoresis displayed that the binding ratio between HSA and QDs was ∼2:1 by direct visualization. Fluorescence resonance energy transfer (FRET) results indicated that the distance between the QDs and the fluorophore BDP-CN in HSA was 7.2 nm, which indicated that the distance from the fluorophore to the surface of the QDs was ∼4.8 nm. Fluorescence correlation spectroscopy (FCS) results showed that HSA formed a monolayer of a protein corona with a thickness of 5.5 nm. According to the spatial structure of HSA, we could speculate that the binding site of QDs was located at the side edge (not the triangular plane) of HSA with an equilateral triangular prism. The elaboration of the thermodynamic parameters, binding ratio, and interaction orientation will highly improve the fundamental understanding of the formation of protein corona. This work has guiding significance for the exploration of the interactions between proteins and nanomaterials.

RBM25 induces trophoblast epithelial-mesenchymal transition and preeclampsia disorder by enhancing the positive feedback loop between Grhl2 and RBM25.

Defects in migration and invasion caused by dysregulation of trophoblast epithelial-mesenchymal transformation (EMT) are one of the key factors in the pathogenesis of preeclampsia (PE). RNA-binding motif protein 25 (RBM25) is an RNA-binding protein involved in a variety of cellular processes, including cell proliferation, apoptosis, cell migration and invasion, and EMT. However, the expression and function of RBM25 in placental of PE remain unclear. In this study, we reveal that the expression of RBM25 is significantly elevated in PE placental tissue. RBM25 depletion and over-expression in trophoblast cells increase and decrease, respectively, cell migration and invasion by regulating EMT marker E-cadherin and Vimentin expression. Mechanistically, Grhl2 is involved in RBM25-regulated trophoblast cell migration, invasion, and EMT through RBM25-facilitated mRNA stabilization. Furthermore, the upregulation of Grhl2 enhances the expression of RBM25 through transcription and forms a positive feedback regulation in the progression of PE. These findings suggest that upregulation of RBM25 induces dysregulation of trophoblast EMT by enhancing positive feedback regulation of Grhl2 and RBM25, leading to defects in cell migration and invasion. Targeting this newly identified regulatory axis may provide benefits in the prevention and treatment of PE.

New Insights on the Size-Dependent Inhibition of Enzymes by Gold Nanoparticles.

Particle size might affect the inhibition behaviors of gold nanoparticles (AuNPs) on enzyme activity by influencing the density of binding sites (ρ), the association constant (Ka), the steric hindrance of enzymes by AuNPs, the binding orientations of the enzyme on AuNPs, as well as the structural changes of enzymes. In previous studies, the effects of the above-mentioned factors, which could not be ignored in the applications of enzymatic electrochemistry, were often overshadowed by the effects of surface area. In order to study the size effect on the inhibition types and inhibitory ability of enzymes by AuNPs, we investigated the inhibition behaviors of chymotrypsin (ChT) by AuNPs with three different sizes (D1-AuNCs, D3-AuNPs, and D6-AuNPs) under the same surface area concentration. The results showed that both of the inhibition types and the inhibition ability varied with the particle size of AuNPs. D1-AuNCs inhibited ChT noncompetitively, while D3/D6-AuNPs inhibited ChT competitively. Contrary to the common sense, D6-AuNPs showed a weaker inhibitory ability than D3-AuNPs. By means of zeta potential, agarose gel electrophoresis, isothermal titration calorimetry, synchronous fluorescence spectroscopy, and circular dichroism, the mechanism of the weak inhibitory ability of D6-AuNPs was found to be the standing binding orientation caused by the small curvature. This work had certain guiding significance for the biosafety of AuNPs, the development of nanoinhibitors, as well as the applications of AuNPs in enzymatic electrochemistry.

Assessment of a novel variation in DHODH gene causing Miller syndrome: The first report in Chinese population.

BACKGROUND: Miller syndrome is a rare type of postaxial acrofacial dysostosis caused by biallelic mutations in the DHODH gene, which is characterized mainly by craniofacial malformations of micrognathia, orofacial clefts, cup-shaped ears, and malar hypoplasia, combined with postaxial limb deformities like the absence of fifth digits. METHODS: In this study, a prenatal case with multiple orofacial-limb abnormities was enrolled, and a thorough clinical and imaging examination was performed. Subsequently, genetic detection with karyotyping, chromosomal microarray analysis (CMA) and whole-exome sequencing (WES) was carried out. In vitro splicing analysis was also conducted to clarify the impact of one novel variant. RESULTS: The affected fetus displayed typical manifestations of Miller syndrome, and WES identified a diagnostic compound heterozygous variation in DHODH, consisting of two variants: exon(1-3)del and c.819 + 5G > A. We conducted a further in vitro validation with minigene system, and the result indicated that the c.819 + 5G > A variant would lead to an exon skipping in mRNA splicing. CONCLUSIONS: These findings provided with the first exonic deletion and first splice site variant in DHODH, which expanded the mutation spectrum of Miller syndrome and offered reliable evidence for genetic counseling to the affected family.

Quantum Dots Meet Enzymes: Hydrophobicity of Surface Ligands and Size Do Matter.

Colloidal quantum dots (QDs) are a class of representative fluorescent nanomaterials with tunable, bright, and sharp fluorescent emission, with promising biomedical applications. However, their effects on biological systems are not fully elucidated. In this work, we investigated the interactions between QDs with different surface ligands and different particle sizes and α-chymotrypsin (ChT) from the thermodynamic and kinetic perspectives. Enzymatic activity experiments demonstrated that the catalytic activity of ChT was strongly inhibited by QDs coated with dihydrolipoic acid (DHLA-QDs) with noncompetitive inhibitions, whereas the QDs coated with glutathione (GSH-QDs) had weak effects. Furthermore, kinetics studies showed that different particle sizes of DHLA-QDs all had high suppressive effects on the catalytic activity of ChT. It was found that DHLA-QDs with larger particle sizes had stronger inhibition effects because more ChT molecules were bound onto the surface of QDs. This work highlights the importance of hydrophobic ligands and particle sizes of QDs, which should be considered as the primary influencing factors in the assessment of biosafety. Meanwhile, the results herein can also inspire the design of nano inhibitors.

Atomically dispersed golds on degradable zero-valent copper nanocubes augment oxygen driven Fenton-like reaction for effective orthotopic tumor therapy.

Herein, we employ a galvanic replacement approach to create atomically dispersed Au on degradable zero-valent Cu nanocubes for tumor treatments on female mice. Controlling the addition of precursor HAuCl4 allows for the fabrication of different atomic ratios of AuxCuy. X-ray absorption near edge spectra indicates that Au and Cu are the predominant oxidation states of zero valence. This suggests that the charges of Au and Cu remain unchanged after galvanic replacement. Specifically, Au0.02Cu0.98 composition reveals the enhanced •OH generation following O2 → H2O2 → •OH. The degradable Au0.02Cu0.98 released Cu+ and Cu2+ resulting in oxygen reduction and Fenton-like reactions. Simulation studies indicate that Au single atoms boot zero-valent copper to reveal the catalytic capability of Au0.02Cu0.98 for O2 → H2O2 → •OH as well. Instead of using endogenous H2O2, H2O2 can be sourced from the O2 in the air through the use of nanocubes. Notably, the Au0.02Cu0.98 structure is degradable and renal-clearable.

Design and construction of competitive, noncompetitive and uncompetitive nano inhibitors of enzymes.

Three common types of reversible inhibitors, namely competitive, noncompetitive and uncompetitive inhibitors, were designed and constructed by using enzymes with different surface charges and gold nanoparticles with different surface ligands and particle sizes. To our knowledge, it is the first time that an uncompetitive nano inhibitor has been discovered.

Genetic analysis of seven pateints with Hereditary Multiple Osteochondromas (HMO).

BACKGROUND: HMO (Hereditary Multiple Osteochondroma), an uncommon autosomal dominant disorder, is characterized by the development of multiple osteochondromas, which are nonmalignant cartilage-capped bone tumors growing outwards from long bone metaphyses. METHODS: The present work retrospectively analyzed seven children with HMO who were enrolled for routine clinical diagnosis and treatment, including X-ray examination. Subsequent genetic detection was carried out using whole exome sequencing (WES). In addition, this work applied Sanger sequencing to be the validation approach. Moreover, this work also examined amino acid (AA) evolutionary conservatism under the influence of certain missense variants. RESULTS: The clinical indications of all seven patients and their family members were thoroughly indexed. WES identified diagnostic variants in the EXT1 or EXT2 gene in these patients. In these variants, four were reported for the first time, namely EXT1: c.1285-2A>T, EXT2: c.1139delT, EXT1: c.203G>A, and EXT1: c.1645_1673del. Familial validation revealed that three of the variants were hereditary, while the other four were de novo, which was consistent with the phenotype in each case. CONCLUSION: Our results expanded HMO variation spectrum, and laid certain foundations for the precise counseling of those affected families.

Prenatal Cases Reflect the Complexity of the COL1A1/2 Associated Osteogenesis Imperfecta.

INTRODUCTION: Osteogenesis imperfecta (OI) is a rare mendelian skeletal dysplasia with autosomal dominant or recessive inheritance pattern, and almost the most common primary osteoporosis in prenatal settings. The diversity of clinical presentation and genetic etiology in prenatal OI cases presents a challenge to counseling yet has seldom been discussed in previous studies. METHODS: Ten cases with suspected fetal OI were enrolled and submitted to a genetic detection using conventional karyotyping, chromosomal microarray analysis (CMA), and whole-exome sequencing (WES). Sanger sequencing was used as the validation method for potential diagnostic variants. In silico analysis of specific missense variants was also performed. RESULTS: The karyotyping and CMA results of these cases were normal, while WES identified OI-associated variants in the COL1A1/2 genes in all ten cases. Six of these variants were novel. Additionally, four cases here exhibited distinctive clinical and/or genetic characteristics, including the situations of intrafamilial phenotypic variability, parental mosaicism, and "dual nosogenesis" (mutations in collagen I and another gene). CONCLUSION: Our study not only expands the spectrum of COL1A1/2-related OI, but also highlights the complexity that occurs in prenatal OI and the importance of clarifying its pathogenic mechanisms.

Long non-coding RNA SNHG16 decreased SMAD4 to induce gemcitabine resistance in pancreatic cancer via EZH2-mediated epigenetic modification.

Gemcitabine resistance (GR) in pancreatic cancer (PC) results in poor patient outcomes. SMAD family member (Smad4) dysregulation is a significant role of GR in PC, and EZH2 is involved in Smad4 expression in tumor progression. Interestingly, lncRNA small nucleolar RNA host gene 16 (SNHG16) might interact with EZH2, indicating a potential pathway to overcome gemcitabine-resistant PC progression. We investigated the role of the SNHG16/EZH2/Smad4 pathway in gemcitabine-resistant PC cells (PANC-1/GR and SW1990/GR). First, we found that SNHG16 was upregulated both in wild-type PC cells and in gemcitabine-resistant PC cells. SNHG16 overexpression reduced gemcitabine cytotoxicity and apoptosis in PC cells. Meanwhile, SNHG16 upregulation caused p-Akt elevation and Smad4 reduction. However, SNHG16 silencing induced the opposite trend. Then, we found that EZH2 was enriched in SNHG16 based on RIP and RNA pulldown. In particular, SNHG16 overexpression promoted the interaction between EZH2 and the Smad4 promoter according to Chromatin immunoprecipitation-quantitative polymerase chain reaction. Finally, both EZH2 inhibition and Smad4 upregulation increased gemcitabine cytotoxicity and apoptosis in PC cells during SNHG16 overexpression. Moreover, both treatments decreased p-Akt and increased Smad4. Collectively, lncRNA SNHG16 decreased Smad4 to induce GR in PC via EZH2-mediated epigenetic modification.

Fluorescent Labeling of Human Serum Albumin by Thiol-Cyanimide Addition and Its Application in the Fluorescence Quenching Method for Nanoparticle-Protein Interactions.

A boron-dipyrromethene (BODIPY)-based fluorescent probe, BDP-CN, was synthesized in this work. It had a fluorescence emission maximum at 512 nm and a high quantum yield (48%). As evidenced by agarose gel electrophoresis and liquid chromatography-mass spectrometry, it could realize the fluorescent labeling of human serum albumin (HSA) through a thiol-cyanimide addition. Interestingly, f-HSA, defined as HSA labeled by BDP-CN, had an even higher quantum yield (77%). In addition, BDP-CN would not affect the secondary structure of HSA. Based on the successful formation of f-HSA, it was further applied to study the interactions with nanoparticles. The fluorescence quenching of f-HSA by dihydrolipoic acid-coated gold nanoclusters (DHLA-AuNCs) obeyed a dynamic mechanism, consistent with the intrinsic fluorescence quenching of HSA by DHLA-AuNCs. The association constant Ka between f-HSA and DHLA-AuNCs at 298 K was 1.5 × 105 M-1, which was the same order of magnitude as that between HSA and DHLA-AuNCs. Moreover, the interactions of f-HSA with glutathione-coated gold nanoclusters confirmed that the labeled fluorescence could replace the intrinsic fluorescence to monitor the interactions between proteins and nanoparticles. By this method, strong fluorescence ensures better stability and reproducibility, excitation at a longer wavelength reduces the damage to the proteins, and covalent conjugation with cysteine residues eliminates the inner filter effects to a great extent. Therefore, the strategy for the fluorescent labeling of HSA can be expanded to investigate a broad class of nanoparticle-protein interactions and inspire even more fluorescent labeling methods with organic dyes.

Rapid preparation of water-soluble Ag@Au nanoclusters with bright deep-red emission.

Deep-red (λem ∼ 710 nm) thiolated Ag@Au nanoclusters with a quantum yield of ∼18% were rapidly (∼12 min) prepared in aqueous solutions. The effects of pH and silver ions were demonstrated. The surface modification further resulted in nanoclusters with a quantum yield of ∼38%, the highest value ever reported for water-soluble red Au nanoclusters. This will highly facilitate their applications in sensing, bioimaging, etc.

Genome sequencing identified a novel exonic microdeletion in the RUNX2 gene that causes cleidocranial dysplasia.

BACKGROUND AND AIMS: Cleidocranial dysplasia (CCD) represents a rare autosomal dominant skeletal dysplasia caused by mutations that induce haploinsufficiency in RUNX2, the important transcription factor of osteoblasts related to bone/cartilage development and maintenance. Clavicular hypoplasia, which involves aberrant tooth/craniofacial bone/skeletal formation, is a feature of classic CCD. RUNX2 mutations can be found in approximately 60-70% of patients with CCD, and around ∼10% of these mutations are microdeletions. The present paper describes the radiological and clinical characteristics of a 5-year-old girl who showed representative CCD features, including extra teeth, aplasia of clavicles, sloping shoulders, marked calvarial hypomineralization, and osteoporosis. MATERIALS AND METHODS: We obtained genomic DNA of her family members and performed whole-genome sequencing (WGS) for samples collected from the proband. Quantitative fluorescent PCR (QF-PCR) and specific PCR plus electrophoresis were then performed as validation assays for all participants. In vitro analysis was performed. Luciferase assay for Runx2 transcription activity and evaluation of mRNA levels of Runx2 downstream osteogenic markers were conducted. RESULTS: WGS identified a 11.38-kb microdeletion in RUNX2 comprising 8-9 exons, which was validated by QF-PCR and specific PCR plus electrophoresis. In vitro experiments confirmed the pathogenicity of this variation. CONCLUSION: The present study identified a 11.38-kb microdeletion in RUNX2 that causes CCD. The deletion in the PST domain of RUNX2 reduces its transcription activity and reduces osteogenic marker levels, eventually decreasing the differentiation of osteoblasts. These findings clarify the role of the CCD-related mechanism in the development of CCD and suggest that it is important to consider copy number variation for the suspected familial patients early.

Metabolic and biophysical study of the MFN2Ile213Thr mutant causing Hereditary Motor and Sensory Neuropathy (HMSN).

Charcot-Marie-Tooth (CMT) 2A disease, a genetic axonal nervous lesion, results from MFN2 pathogenic variation, and this gene plays a pivotal role in mitochondrial dynamics and calcium signaling. However, the underlying mechanism linking MFN2 defect to progressive dying-back of peripheral nerves is still unclear. The present work focused on analyzing one CMT2A patient from multiple perspectives. Clinical and pathologic evaluation was initially conducted on the recruited case. Subsequently, Sanger sequencing and whole-exome sequencing (WES) were performed for genetic detection. To reveal the cell metabolic alteration caused by the identified variant, this study also established and transfected plasmid vectors in HEK293 cells and analyzed cell metabolites through liquid chromatography in combination with quadrupole time-of-flight tandem mass spectrometry (UPLC Q-TOF MS). Additionally, we completed structural modeling and molecular dynamic (MD) simulation to investigate the intramolecular impact of the variant. According to our results, the clinical and neuropathologic manifestations of the proband matched with the diagnosis of CMT. The causative variant MFN2: c.638T>C: (p.Ile213Thr) was identified through genetic analysis. Moreover, metabolic pathway enrichment results demonstrated that this variant significantly affected the metabolism of sphingolipids and glycerophospholipids. MD analysis indicated that this variant crippled the binding ability of MFN2 to GTP. Taken together, our study deduced preliminary clues for the underlying mechanism by which mutant MFN2 affects cell metabolism and provided a novel perspective to understand the cellular and molecular impacts of MFN2 variants.

Regulation of the Enzymatic Activities of Lysozyme by the Surface Ligands of Ultrasmall Gold Nanoclusters: The Role of Hydrophobic Interactions.

Nanomaterials for biological applications would inevitably encounter and interact with biomolecules, which have a profound impact on the properties, functions, and even fates of both nanomaterials and biomolecules. Among the biomolecules, lysozyme (Lys) is of great importance in defending the bacterial intruder and maintaining health. Here, the interactions between fluorescent gold nanoclusters (AuNCs) (∼2 nm) capped with different surface ligands and Lys were thoroughly investigated. Fluorescence spectroscopic studies showed that dihydrolipoic acid (DHLA)-capped and glutathione (GSH)-capped AuNCs both quenched the intrinsic fluorescence of Lys by different quenching mechanisms. Agarose gel electrophoresis and zeta-potential assays showed that statistically one DHLA-AuNC could bind one Lys, while one GSH-AuNC could bind 3-4 Lys, providing new examples for the concept of a "protein complex". Activity assays indicated that DHLA-AuNCs heavily inhibited the enzymatic activity of Lys, while GSH-AuNCs had little effect. By synchronous fluorescence and circular dichroism spectroscopic studies, it was deduced that both AuNCs would interact with Lys by electrostatic attractions due to the distinct surface charges, and then DHLA-AuNCs would further interact with Lys by hydrophobic interactions, probably due to the hydrophobic carbon chain of DHLA and the hydrophobic side chains of amino acid residues in Lys, which was proved by the significant secondary structure changes caused by DHLA-AuNCs. Meanwhile, conformational changes induced by GSH-AuNCs with zwitterionic ligands were neglectable. Therefore, this work provided a comprehensive study of the consequences and mechanisms of the interactions between Lys and AuNCs, which was essential for the design and better use of nanomaterials as biological agents.