RESUMEN
Oncolytic virotherapy is a rapidly progressing field that uses oncolytic viruses (OVs) to selectively infect malignant cells and cause an antitumor response through direct oncolysis and stimulation of the immune system. Despite demonstrated pre-clinical efficacy of OVs in many cancer types and some favorable clinical results in glioblastoma (GBM) trials, durable increases in overall survival have remained elusive. Recent evidence has emerged that tumor-associated macrophage/microglia (TAM) involvement is likely an important factor contributing to OV treatment failure. It is prudent to note that the relationship between TAMs and OV therapy failures is complex. Canonically activated TAMs (i.e., M1) drive an antitumor response while also inhibiting OV replication and spread. Meanwhile, M2 activated TAMs facilitate an immunosuppressive microenvironment thereby indirectly promoting tumor growth. In this focused review, we discuss the complicated interplay between TAMs and OV therapies in GBM. We review past studies that aimed to maximize effectiveness through immune system modulation-both immunostimulatory and immunosuppressant-and suggest future directions to maximize OV efficacy.
Asunto(s)
Glioblastoma , Viroterapia Oncolítica , Virus Oncolíticos , Glioblastoma/patología , Humanos , Microglía/patología , Viroterapia Oncolítica/métodos , Virus Oncolíticos/genética , Microambiente Tumoral , Macrófagos Asociados a TumoresRESUMEN
Glioblastoma multiforme (GBM) is an aggressive primary brain cancer that includes focal amplification of PDGFRα and for which there are no effective therapies. Herein, we report the development of a genetically engineered mouse model of GBM based on autocrine, chronic stimulation of overexpressed PDGFRα, and the analysis of GBM signaling pathways using proteomics. We discover the tubulin-binding protein Stathmin1 (STMN1) as a PDGFRα phospho-regulated target, and that this mis-regulation confers sensitivity to vinblastine (VB) cytotoxicity. Treatment of PDGFRα-positive mouse and a patient-derived xenograft (PDX) GBMs with VB in mice prolongs survival and is dependent on STMN1. Our work reveals a previously unconsidered link between PDGFRα activity and STMN1, and highlight an STMN1-dependent cytotoxic effect of VB in GBM.
Asunto(s)
Neoplasias de la Mama/metabolismo , Resistencia a Antineoplásicos , Glioblastoma/metabolismo , Receptor beta de Factor de Crecimiento Derivado de Plaquetas/metabolismo , Estatmina/metabolismo , Vinblastina/farmacología , Animales , Antineoplásicos/farmacología , Apoptosis , Ciclo Celular , Supervivencia Celular , Células Cultivadas , Biología Computacional , Modelos Animales de Enfermedad , Femenino , Regulación Neoplásica de la Expresión Génica , Humanos , Imagen por Resonancia Magnética , Masculino , Ratones , Trasplante de Neoplasias , Fosforilación , Proteómica , Transducción de SeñalRESUMEN
Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA ß-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.
Asunto(s)
Citomegalovirus/aislamiento & purificación , Sarcoma de Parte Blanda Alveolar/virología , Citomegalovirus/genética , Humanos , Hibridación in Situ , Reacción en Cadena de la PolimerasaRESUMEN
Glioblastoma multiforme (GBM) is an aggressive brain cancer for which there is no effective treatment. Oncolytic HSV vectors (oHSVs) are attenuated lytic viruses that have shown promise in the treatment of human GBM models in animals, but their efficacy in early phase patient trials has been limited. Instead of attenuating the virus with mutations in virulence genes, we engineered four copies of the recognition sequence for miR-124 into the 3'UTR of the essential ICP4 gene to protect healthy tissue against lytic virus replication; miR-124 is expressed in neurons but not in glioblastoma cells. Following intracranial inoculation into nude mice, the miR-124-sensitive vector failed to replicate or show overt signs of pathogenesis. To address the concern that this safety feature may reduce oncolytic activity, we inserted the miR-124 response elements into an unattenuated, human receptor (EGFR/EGFRvIII)-specific HSV vector. We found that miR-124 sensitivity did not cause a loss of treatment efficiency in an orthotopic model of primary human GBM in nude mice. These results demonstrate that engineered miR-124 responsiveness can eliminate off-target replication by unattenuated oHSV without compromising oncolytic activity, thereby providing increased safety.