First report of dasheen mosaic virus infecting calla lilies in South Korea.

In April 2022, leaves showing virus-like symptoms including mosaic, feathery chlorotic mottle and distortions were observed on calla lilies (Zantedeschia sp.) growing in a greenhouse in Jeolla province, South Korea. Leaf samples from nine symptomatic plants from the same greenhouse were collected and tested for Zantedeschia mosaic virus (ZaMV), Zantedeschia mild mosaic virus (ZaMMV) and Dasheen mosaic virus (DaMV) by reverse transcription-polymerase chain reaction (RT-PCR) with specific primers, ZaMV-F/R (Wei et al. 2008), ZaMMV-F/R (5'-GACGATCAGCAACAGCAGCAACAGCAGAAG-3'/5'-CTGCAAGGCTGAGATCCCGAGTAGCGAGTG-3') and DsMV-CPF/CPR, respectively. In previous surveys, ZaMV and ZaMMV were detected in calla lily fields in South Korea. Of 9 symptomatic samples, 8 were positive for ZaMV and ZaMMV but no PCR product was obtained from the ninth sample, which showed a yellow feather-like pattern. To identify the causal virus, total RNA from a leaf sample of the symptomatic calla lily was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 150 nt paired end reads. De novo assembly of the 88,171,036 reads was performed using Trinity software (r20140717) while the 113,140 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. One contig of 10,007 bp (GenBank LC723667) shared 79.89-87.08% nucleotide (nt) identities to the available genomes of other DsMV isolates including Colocasia esculenta isolates Et5 (MG602227, 87.08%; Ethiopia) and CTCRI-II-14 (KT026108, 85.32%; India), and a calla lily isolate (AJ298033, 84.95%; China). No contigs representing other plant viruses were identified. To confirm the presence of DsMV, and because the virus was not detected using DsMV-CPF/CPR, RT-PCR was performed using new virus-specific primers DsMV-F/R (5'-GATGTCAACGCTGGCACCAGT-3'/5'-CAACCTAGTAGTAACGTTGGAGA-3'), designed based on the contig sequence. PCR products of the expected 600 bp were obtained from the symptomatic plant, cloned into the pGEM-T Easy Vector (Promega, USA), and two independent clones were bidirectionally sequenced (BIONEER, Korea), and shown to be identical. The sequence was deposited in GenBank as acc. no. LC723766, and shared 100% nt identity to the full-length contig LC723667, and 91.83% identity to the Chinese calla lily DsMV isolate (AJ298033). DsMV, a member of the genus Potyvitus in the family Potyviridae, is one of the major viruses infecting taro in South Korea, showing mosaic and chlorotic feathering symptoms (Kim et al. 2004); however, there is no record in the literature of the identification of this virus in South Korea in ornamental species including calla lily. To survey the sanitary status of other calla lilies, 95 samples with or without symptoms were collected from other regions and subjected to RT-PCR detection for DsMV. Ten of these samples were positive with primers DsMV-F/R, including seven mixed infections (DsMV+ZaMV or DsMV+ZaMV+ZaMMV). To our knowledge, this is the first report of DsMV infecting calla lilies in South Korea. The virus is easily spread by vegetative propagation (Babu et al. 2011) and by aphids (Reyes et al. 2006). This study will help the management of viral diseases on calla lilies in South Korea.

First report of pepino mosaic virus infecting tomato in South Korea.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus in the family Alphaflexiviridae, has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in South Korea. In December 2020, virus-like symptoms (foliar interveinal chlorosis and unevenly discolored fruits) were observed on ~5% of tomato (Solanum lycopersicum) plants growing in a greenhouse in Jeolla province, South Korea. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. De novo assembly of the 74,417,192 reads was performed using Trinity software (r20140717) while the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6,419 and 6,391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities with isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains (Abrahamian et al., 2020) also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the same greenhouse were tested by reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank. The 848 bp amplicon (accession no. LC637517) showed 99.65% nt identity to the JKT1 genome (LC656469) and 94.69% identity to a CH2 isolate (JN835466); the 625 bp amplicon (LC637518) had 99.36% nt identity to the JKT2 genome (LC656470) and 97.28% identity to a US1 isolate (FJ940225). Primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of PepMV strains CH2 and US1. The PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between (JKT1/JKT2) two JKT1-derived sequences (LC683791 and LC683792) and two JKT2-derived sequences (LC683793 and LC683794), further supporting the presence of mixed infections in the samples. To our knowledge, this is the first report of PepMV infecting tomato in South Korea. The virus is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and the severe strain CH2 may be a serious threat to tomato production in South Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants.

Inhibitory Effect of Chitosan and Phosphate Cross-linked Chitosan against Cucumber Mosaic Virus and Pepper Mild Mottle Virus.

Cucumber mosaic virus (CMV) and Pepper mild mottle virus (PMMoV) causes severe economic loss in crop productivity of both agriculture and horticulture crops in Korea. The previous surveys showed that naturally available biopolymer material - chitosan (CS), which is from shrimp cells, reduced CMV accumulation on pepper. To improve the antiviral activity of CS, it was synthesized to form phosphate cross-linked chitosan (PCS) and compared with the original CS. Initially, the activity of CS and PCS (0.01%, 0.05%, and 0.1% concentration) compound against PMMoV infection and replication was tested using a half-leaf assay on Nicotiana glutinosa leaves. The total number of local lesions represented on a leaf of N. glutinosa were counted and analyzed with phosphate buffer treated leaves as a negative control. The leaves treated with a 0.1% concentration of CS or PCS compounds exhibited an inhibition effect by 40-75% compared with the control leaves. The same treatment significantly reduced about 40% CMV accumulation measured by double antibody sandwich enzyme-linked immunosorbent assay and increased the relative expression levels of the NPR1, PR-1, cysteine protease inhibitor gene, LOX, PAL, SRC2, CRF3 and ERF4 genes analyzed by quantitative reverse transcriptase-polymerase chain reaction, in chili pepper plants.

First report of Cucurbit chlorotic yellows virus infecting Cucumis melo (muskmelon and oriental melon) in Korea.

In December 2018, virus-like symptoms (yellowing, vein clearing) were observed on 2% of muskmelon (Cucumis melo L.) plants in plastic houses on a farm in Gyeongsang province, Korea Total RNA from two symptomatic and two asymptomatic plants was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) for high throughput sequencing (HTS). After pre-processing and Ribo-Zero rRNA removal, a cDNA library was prepared (Illumina TruSeq Stranded Total RNA kit) and sequenced (Illumina NovaSeq 6000 system: Macrogen Inc. Korea). De novo assembly of 88,222,684 HTS reads with Trinity software (r20140717) yielded 146,269 contigs of 201-28,442 bp, which were screened against the NCBI viral genome database by BLASTn. Contigs from cucumber mosaic virus (CMV), melon necrotic spot virus (MNSV), tobacco mosaic virus (TMV) and watermelon mosaic virus (WMV) were identified, all previously reported in Korea. Two contigs (8,539 and 8,040 bp) with 99.9% sequence identity to distinct cucurbit chlorotic yellows virus (CCYV) isolates (JN641883, RNA1, Taiwan; MH819191, RNA2, China) were also identified. The ten sequences most closely related to each RNA of the Korean isolate (≥99% coverage, ≥99.6% nt identity) were from Japan, China, Taiwan, or Israel. CCYV presence was confirmed by reverse transcription-PCR (RT-PCR) using newly designed specific primers, RdRp-F/RdRp-R (5'-ACCGAACACTTGGCTATCCAA-3'/5'-CTTAATGCCGCGTATGAACTCA-3') span style="font-family:'Times New Roman'; letter-spacing:-0.5pt">and HSP-F/HSP-R (5'-TGAACGACACTGAGTTCATTCCTA-3'/5'-CGCCAAGATCGTACATGAGGAA-3'), against RNA dependent RNA polymerase (RdRp; RNA1) and the heat shock protein 70 homolog (HSP70h; RNA2). Symptomatic samples yielded products of expected sizes (RdRp,450 bp; HSP70h, 510 bp) while asymptomatic samples did not. The amplicons were cloned, and two clones of each were sequenced (BIONEER, Korea; GenBank acc. nos. LC592226 and LC592227) showing 100% and 99.2% nt identity with RdRp and HSP70h genes of Chinese CCYV isolate SD (MH819190 and MH819191, respectively) and other Asian isolates. Primers specific for CMV, WMV, beet pseudo-yellows virus (BPYV) (Okuda et al., 2007), TMV (Kim et al., 2018), MNSV (F/R, 5'-ATCTCGCATTTGGCATTACTC-3'/5'-ATTTGTAGAGATGCCAACGTA-3'), cucurbit yellow stunting disorder virus (CYSDV; Zeng et al., 2011) and cucurbit aphid-borne yellows virus (CABYV; F/R, 5'-CGGTCTATTGTCTGCAGTACCA-3'/5'- GTAGAGGATCTTGAATTGGTCCTCA-3') were also used. None of these viruses were detected in the symptomatic samples, but both asymptomatic plants were positive for CMV and WMV, and one also for MNSV. In June and September 2020, muskmelon and oriental melon (Cucumis melo L. var. makuwa) plants with yellowing disease (incidence 80-90%) and whiteflies were observed in all investigated plastic houses of one muskmelon and one oriental melon farm in Gyeonggi and Jeolla provinces. Symptomatic samples (14 muskmelon; 6 oriental melon) were collected and RT-PCR tested as above; 19/20 samples were positive for CCYV, but none for the other viruses. The oriental melon sequence (LC592895, LC592230) showed 99.7% and 100% nt identity with the RdRp and HSP70h genes of Chinese isolate SD, respectively. CCYV was first reported in Japan (Okuda et al., 2010), Taiwan, and China (Huang et al., 2010; Gu et al., 2011); to our knowledge, this is the first report of CCYV infecting muskmelon and oriental melon in Korea. Whitefly-transmitted CCYV could present a serious threat of yield losses to cucurbit crops in Korea, requiring control of vector populations to prevent spread of CCYV.

First report of a resistance-breaking strain of Tomato spotted wilt orthotospovirus infecting Capsicum annuum carrying the Tsw resistance gene in South Korea.

Tomato spotted wilt orthotospovirus (TSWV) was first reported in 2004 from paprika in South Korea (Kim et al., 2004), where it is currently widespread. TSWV infections were reported in chili pepper, tomato, weeds, and ornamental plant species in South Korea (Choi et al., 2014; Choi and Choi, 2015; Yoon et al., 2016; Yoon et al., 2018; Yoon et al., 2019). One of the best strategies for TSWV management is planting resistant cultivars containing the Tsw gene. In 2019 virus-like symptoms were observed in chili pepper (Capsicum annuum) plants bearing the Tsw gene in Anseong-si, South Korea. The infected chili peppers showed mosaic and wilting followed by necrosis on leaves and fruits in the field. To identify the causal virus, symptomatic leaf samples were analyzed using ImmunoStrip kits (Agdia, USA); we detected three pepper-infecting viruses: Pepper mild mottle virus, Cucumber mosaic virus, and TSWV. TSWV was only detected from 40 naturally infected chili pepper plants exhibiting virus-like symptoms. To further confirm the presence of TSWV (named TSWV-P1), we amplified reverse-transcription polymerase chain reaction (RT-PCR) products for L, M, and S RNA segments using tospovirus-specific and TSWV-specific primers (Batuman et al., 2014). Expected fragments of 445, 868, and 777 bp in length were amplified and sequenced. The complete genome sequences of TSWV-P1 from a symptomatic chili pepper plant were also determined using TSWV-specific primers (Choi et al., 2014; Lian et al., 2013). The complete genome sequences of TSWV-P1 were deposited to GenBank (LC549179, LC549180, and LC549181). The sequences of each fragment were identical to a consensus sequence, showing 99.1%, 98.5%, and 98.6% identity with TSWV-L, M, and S RNA (KP008132, AY744492, and KP008134), respectively. These results clearly showed only a single TSWV infection among the naturally infected chili pepper plants, without reassortment between TSWV and another tospovirus. To confirm whether TSWV-P1 is a resistance-breaking (RB) strain, Nicotiana rustica was mechanically inoculated with sap from leaves of the infected pepper samples to propagate TSWV-P1. A non-RB TSWV isolate (TSWV-Kor-lisianthus) from lisianthus was used as a control (Yoon et al., 2017). Two resistant (with Tsw) and two susceptible chili pepper cultivars (20 plants per cultivar) were mechanically inoculated with sap from leaves of the TSWV-infected N. rustica. The incidence rates of disease caused by TSWV-P1 were 90-100% for resistant and 95-100% for susceptible cultivars. In contrast, TSWV-Kor-lisianthus caused symptoms only in the susceptible pepper cultivars (90-100% incidence). TSWV infection in representative plants was confirmed using the TSWV- ImmunoStrip kit and RT-PCR. The NSs gene of TSWV-P1 consists of 1,404 nucleotides (468 amino acids); sequence analysis of the TSWV-P1 NSs gene showed high nucleotide (99.7%) and amino acid identities (99.8%) with the NSs sequences of two TSWV isolates (FR693035, CBX24121). Protein sequence analysis of TSWV-P1 NSs revealed that no amino acid mutation was associated with those of a representative TSWV RB strain, as previously described (Almási et al., 2017), suggesting that TSWV-P1 is a RB strain. Because this TSWV-P1 can overcome resistance conferred by the Tsw gene in commercially grown chili pepper cultivars, it represents a potential threat to pepper production in South Korea.

Effects of Long-Term Subcultured Arbuscular Mycorrhizal Fungi on Red Pepper Plant Growth and Soil Glomalin Content.

Arbuscular mycorrhizal fungi (AMF) are well-known for their ability to improve plant growth and help plants withstand abiotic stress conditions. Unlike other fungi and bacteria, AMF cannot be stored, as they are obligate biotrophs. Long-term preservation of AMF spores is challenging and may lead to the loss of viability and efficiency. This study aimed to understand the effect of prolonged subculture of AMF species on the growth and glomalin-related soil protein (GRSP) from red pepper (Capsicum annuum L.). AMF spores were mass-produced using different techniques and subcultured in pots with sorghum sudangrass as the host plant for 3 years. Experimental soil samples were collected from natural grassland. Five different AMF inocula were used in triplicate as treatments. After 70 days of growth, red pepper plants were harvested and plant dry weight, plant nutrient content, mycorrhizal colonization, AMF spore count, and soil glomalin content were determined. AMF-treated plants displayed higher dry weight than controls, with only fruit dry weight being significantly different. Similarly, significant differences in phosphorous and potassium contents of the above-ground plant parts were observed between mycorrhizal and control treatments. In addition, soil GRSP content was significantly higher in plants inoculated with Rhizophagus sp. and Gigaspora margarita. The increased plant growth and GRSP content suggest that AMF can be maintained for 3 years without losing their efficiency if subcultured regularly with different symbiotic host plants.

HR-Mediated Defense Response is Overcome at High Temperatures in Capsicum Species.

Resistance to Tomato spotted wilt virus isolated from paprika (TSWV-Pap) was overcome at high temperatures (30 ± 2°C) in both accessions of Capsicum annuum S3669 (Hana Seed Company) and C. chinense PI15225 (AVRDC Vegetable Genetic Resources). S3669 and PI15225, which carrying the Tsw gene, were mechanically inoculated with TSWV-Pap, and then maintained in growth chambers at temperatures ranging from 15 ± 2°C to 30 ± 2°C (in 5°C increments). Seven days post inoculation (dpi), a hypersensitivity reaction (HR) was induced in inoculated leaves of PI152225 and S3669 plants maintained at 25°C ± 2°C. Meanwhile, necrotic spots were formed in upper leaves of 33% of PI15225 plants maintained at 30 ± 2°C, while systemic mottle symptoms developed in 50% of S3669 plants inoculated. By 15 dpi, 25% of S3669 plants had recovered from systemic mottling induced at 30 ± 2°C. These results demonstrated that resistance to TSWV-Pap can be overcome at higher temperatures in both C. chinense and C. annuum. This is the first study reporting the determination of temperatures at which TSWV resistance is overcome in a C. annuum genetic resource expressing the Tsw gene. Our results indicated that TSWV resistance shown from pepper plants possess the Tsw gene could be overcome at high temperature. Thus, breeders should conduct evaluation of TSWV resistance in pepper cultivars at higher temperature than 30°C (constant temperature).

Temperature and CO2 Level Influence Potato leafroll virus Infection in Solanum tuberosum.

We determined the effects of atmospheric temperature (10-30 ± 2°C in 5°C increments) and carbon dioxide (CO2) levels (400 ± 50 ppm, 540 ± 50 ppm, and 940 ± 50 ppm) on the infection of Solanum tuberosum cv. Chubaek by Potato leafroll virus (PLRV). Below CO2 levels of 400 ± 50 ppm, the PLRV infection rate and RNA content in plant tissues increased as the temperature increased to 20 ± 2°C, but declined at higher temperatures. At high CO2 levels (940 ± 50 ppm), more plants were infected by PLRV at 30 ± 2°C than at 20 or 25 ± 2°C, whereas PLRV RNA content was unchanged in the 20-30 ± 2°C temperature range. The effects of atmospheric CO2 concentration on the acquisition of PLRV by Myzus persicae and accumulation of PLRV RNA in plant tissues were investigated using a growth chamber at 20 ± 2°C. The M. persicae PLRV RNA content slightly increased at elevated CO2 levels (940 ± 50 ppm), but this increase was not statistically significant. Transmission rates of PLRV by Physalis floridana increased as CO2 concentration increased. More PLRV RNA accumulated in potato plants maintained at 540 or 940 ± 50 ppm CO2, than in plants maintained at 400 ± 50 ppm. This is the first evidence of greater PLRV RNA accumulation and larger numbers of S. tuberosum plants infected by PLRV under conditions of combined high CO2 levels (940 ± 50 ppm) and high temperature (30 ± 2°C).

Virulence determines beneficial trade-offs in the response of virus-infected plants to drought via induction of salicylic acid.

It has been hypothesized that plants can get beneficial trade-offs from viral infections when grown under drought conditions. However, experimental support for a positive correlation between virus-induced drought tolerance and increased host fitness is scarce. We investigated whether increased virulence exhibited by the synergistic interaction involving Potato virus X (PVX) and Plum pox virus (PPV) improves tolerance to drought and host fitness in Nicotiana benthamiana and Arabidopsis thaliana. Infection by the pair PPV/PVX and by PPV expressing the virulence protein P25 of PVX conferred an enhanced drought-tolerant phenotype compared with single infections with either PPV or PVX. Decreased transpiration rates in virus-infected plants were correlated with drought tolerance in N. benthamiana but not in Arabidopsis. Metabolite and hormonal profiles of Arabidopsis plants infected with the different viruses showed a range of changes that positively correlated with a greater impact on drought tolerance. Virus infection enhanced drought tolerance in both species by increasing salicylic acid accumulation in an abscisic acid-independent manner. Viable offspring derived from Arabidopsis plants infected with PPV increased relative to non-infected plants, when exposed to drought. By contrast, the detrimental effect caused by the more virulent viruses overcame potential benefits associated with increased drought tolerance on host fitness.

Potato Virus Y HCPro Suppression of Antiviral Silencing in Nicotiana benthamiana Plants Correlates with Its Ability To Bind In Vivo to 21- and 22-Nucleotide Small RNAs of Viral Sequence.

We have investigated short and small RNAs (sRNAs) that were bound to a biologically active hexahistidine-tagged Potato virus Y (PVY) HCPro suppressor of silencing, expressed from a heterologous virus vector in Nicotiana benthamiana plants, and purified under nondenaturing conditions. We found that RNAs in purified preparations were differentially enriched in 21-nucleotide (nt) and, to a much lesser extent, 22-nt sRNAs of viral sequences (viral sRNAs [vsRNAs]) compared to those found in a control plant protein background bound to nickel resin in the absence of HCPro or in a purified HCPro alanine substitution mutant (HCPro mutB) control that lacked suppressor-of-silencing activity. In both controls, sRNAs were composed almost entirely of molecules of plant sequence, indicating that the resin-bound protein background had no affinity for vsRNAs and also that HCPro mutB failed to bind to vsRNAs. Therefore, PVY HCPro suppressor activity correlated with its ability to bind to 21- and 22-nt vsRNAs. HCPro constituted at least 54% of the total protein content in purified preparations, and we were able to calculate its contribution to the 21- and the 22-nt pools of sRNAs present in the purified samples and its binding strength relative to the background. We also found that in the 21-nt vsRNAs of the HCPro preparation, 5'-terminal adenines were overrepresented relative to the controls, but this was not observed in vsRNAs of other sizes or of plant sequences.IMPORTANCE It was previously shown that HCPro can bind to long RNAs and small RNAs (sRNAs) in vitro and, in the case of Turnip mosaic virus HCPro, also in vivo in arabidopsis AGO2-deficient plants. Our data show that PVY HCPro binds in vivo to sRNAs during infection in wild-type Nicotiana benthamiana plants when expressed from a heterologous virus vector. Using a suppression-of-silencing-deficient HCPro mutant that can accumulate in this host when expressed from a virus vector, we also show that sRNA binding correlates with silencing suppression activity. We demonstrate that HCPro binds at least to sRNAs with viral sequences of 21 nucleotides (nt) and, to a much lesser extent, of 22 nt, which were are also differentially enriched in 5'-end adenines relative to the purified controls. Together, our results support the physical binding of HCPro to vsRNAs of 21 and 22 nt as a means to interfere with antiviral silencing.

A Model to Explain Temperature Dependent Systemic Infection of Potato Plants by Potato virus Y.

The effect of temperature on the rate of systemic infection of potatoes (Solanum tuberosum L. cv. Chu-Baek) by Potato virus Y (PVY) was studied in growth chambers. Systemic infection of PVY was observed only within the temperature range of 16°C to 32°C. Within this temperature range, the time required for a plant to become infected systemically decreased from 14 days at 20°C to 5.7 days at 28°C. The estimated lower thermal threshold was 15.6°C and the thermal constant was 65.6 degree days. A systemic infection model was constructed based on experimental data, using the infection rate (Lactin-2 model) and the infection distribution (three-parameter Weibull function) models, which accurately described the completion rate curves to systemic infection and the cumulative distributions obtained in the PVY-potato system, respectively. Therefore, this model was useful to predict the progress of systemic infections by PVY in potato plants, and to construct the epidemic models.

Erratum: The Effects of High Temperature on Infection by Potato virus Y, Potato virus A, and Potato leafroll virus.

[This corrects the article on p. 321 in vol. 32, PMID: 27493607.].

D-PSA-K: A Model for Estimating the Accumulated Potential Damage on Kiwifruit Canes Caused by Bacterial Canker during the Growing and Overwintering Seasons.

We developed a model, termed D-PSA-K, to estimate the accumulated potential damage on kiwifruit canes caused by bacterial canker during the growing and overwintering seasons. The model consisted of three parts including estimation of the amount of necrotic lesion in a non-frozen environment, the rate of necrosis increase in a freezing environment during the overwintering season, and the amount of necrotic lesion on kiwifruit canes caused by bacterial canker during the overwintering and growing seasons. We evaluated the model's accuracy by comparing the observed maximum disease incidence on kiwifruit canes against the damage estimated using weather and disease data collected at Wando during 1994-1997 and at Seogwipo during 2014-2015. For the Hayward cultivar, D-PSA-K estimated the accumulated damage as approximately nine times the observed maximum disease incidence. For the Hort16A cultivar, the accumulated damage estimated by D-PSA-K was high when the observed disease incidence was high. D-PSA-K could assist kiwifruit growers in selecting optimal sites for kiwifruit cultivation and establishing improved production plans by predicting the loss in kiwifruit production due to bacterial canker, using past weather or future climate change data.

The Effects of High Temperature on Infection by Potato virus Y, Potato virus A, and Potato leafroll virus.

We examined the effects of temperature on acquisition of Potato virus Y-O (PVY-O), Potato virus A (PVA), and Potato leafroll virus (PLRV) by Myzus persicae by performing transmission tests with aphids that acquired each virus at different temperatures. Infection by PVY-O/PVA and PLRV increased with increasing plant temperature in Nicotiana benthamiana and Physalis floridana, respectively, after being transmitted by aphids that acquired them within a temperature range of 10-20°C. However, infection rates subsequently decreased. Direct qRT-PCR of RNA extracted from a single aphid showed that PLRV infection increased in the 10-20°C range, but this trend also declined shortly thereafter. We examined the effect of temperature on establishment of virus infection. The greatest number of plants became infected when N. benthamiana was held at 20°C after inoculation with PVY-O or PVA. The largest number of P. floridana plants became infected with PLRV when the plants were maintained at 25°C. PLRV levels were highest in P. floridana kept at 20-25°C. These results indicate that the optimum temperatures for proliferation of PVY-O/PVA and PLRV differed. Western blot analysis showed that accumulations of PVY-O and PVA coat proteins (CPs) were lower at 10°C or 15°C than at 20°C during early infection. However, accumulation increased over time. At 25°C or 30°C, the CPs of both viruses accumulated during early infection but disappeared as time passed. Our results suggest that symptom attenuation and reduction of PVY-O and PVA CP accumulation at higher temperatures appear to be attributable to increased RNA silencing.

Effects of Temperature on Systemic Infection and Symptom Expression of Turnip mosaic virus in Chinese cabbage (Brassica campestris).

Using the Chinese cabbage (Brassica campestris) cultivar 'Chun-goang' as a host and turnip mosaic virus (TuMV) as a pathogen, we studied the effects of ambient temperature (13°C, 18°C, 23°C, 28°C and 33°C) on disease intensity and the speed of systemic infection. The optimal temperature for symptom expression of TuMV was 18-28°C. However, symptoms of viral infection were initiated at 23-28°C and 6 days post infection (dpi). Plants maintained at 33°C were systemically infected as early as 6 dpi and remained symptomless until 12 or 22 dpi, depending on growth stage at the time of inoculation. It took 45 days for infection of plants grown at 13°C. Quantitative real-time polymerase chain reaction (q-PCR) results showed that the accumulation of virus coat protein was greater in plants grown at 23-28°C. The speed of systemic infection increased linearly with rising ambient temperature, up to 23°C. The zero-infection temperature was 10.1°C. To study the effects of abruptly elevated temperatures on systemic infection, plants inoculated with TuMV were maintained at 10°C for 20 d; transferred to a growth chamber at temperatures of 13°C, 18°C, 23°C, 28°C, or 33°C for 1, 2, or 3 d; and then moved back to 10°C. The numbers of plants infected increased as duration of exposure to higher temperatures and dpi increased.

Effects of Elevated CO2and Temperature on Pathogenicity Determinants and Virulence of Potato virus X/Potyvirus-Associated Synergism.

Infections of plants by multiple viruses are common in nature and may result in synergisms in pathologies. Several environmental factors influence plant-virus interactions and act on virulence and host defense responses. Mixed viral infections may be more frequent under environmental conditions associated with global warming. Here, we address how changes in the two main parameters behind global warming, carbon dioxide concentrations ([CO2]) and temperature, may affect virulence of Potato virus X (PVX)/potyvirus-associated synergism compared with single infections in Nicotiana benthamiana. Elevated [CO2] resulted in attenuated virulence of single infection by PVX, which correlated with a lower accumulation of virus. In contrast, virulence of PVX/potyvirus-associated synergism was maintained at elevated [CO2]. On the other hand, elevated temperature decreased markedly both virulence and virus titers in the synergistic infection. We also show that the HR-like response elicited by transient coexpression of PVX P25 together with the potyviral helper component-proteinase protein was significantly enhanced by elevated temperature, whereas it was reduced by elevated [CO2]. Both proteins are main pathogenicity determinants in PVX-associated synergisms. These findings indicate that, under environmental conditions associated with global warming, virulence of PVX/potyvirus-associated synergisms is expected to vary relative to single infections and, thus, may have pathological consequences in the future.

High Temperature, High Ambient CO2 Affect the Interactions between Three Positive-Sense RNA Viruses and a Compatible Host Differentially, but not Their Silencing Suppression Efficiencies.

We compared infection of Nicotiana benthamiana plants by the positive-sense RNA viruses Cucumber mosaic virus (CMV), Potato virus Y (PVY), and by a Potato virus X (PVX) vector, the latter either unaltered or expressing the CMV 2b protein or the PVY HCPro suppressors of silencing, at 25°C vs. 30°C, or at standard (~401 parts per million, ppm) vs. elevated (970 ppm) CO2 levels. We also assessed the activities of their suppressors of silencing under those conditions. We found that at 30°C, accumulation of the CMV isolate and infection symptoms remained comparable to those at 25°C, whereas accumulation of the PVY isolate and those of the three PVX constructs decreased markedly, even when expressing the heterologous suppressors 2b or HCPro, and plants had either very attenuated or no symptoms. Under elevated CO2 plants grew larger, but contained less total protein/unit of leaf area. In contrast to temperature, infection symptoms remained unaltered for the five viruses at elevated CO2 levels, but viral titers in leaf disks as a proportion of the total protein content increased in all cases, markedly for CMV, and less so for PVY and the PVX constructs. Despite these differences, we found that neither high temperature nor elevated CO2 prevented efficient suppression of silencing by their viral suppressors in agropatch assays. Our results suggest that the strength of antiviral silencing at high temperature or CO2 levels, or those of the viral suppressors that counteract it, may not be the main determinants of the observed infection outcomes.