Attention-deficit/hyperactive-impulsive disorder symptoms among grade 1 students with reading disorder in Thailand.

BACKGROUND: Reading disorder is the most common comorbid condition with attention-deficit/hyperactive-impulsive disorder (ADHD) in school-aged children. PURPOSE: This study compared symptoms of ADHD among children in grade 1 at risk of reading disorder with children not at risk. METHODS: This cross-sectional study included 703 students in grade 1 aged 6-8 years from 8 schools in Pathumthani Province, Thailand, in 2019. Reading disorder was assessed using tools developed by Vibulpatanavong and Evans for Thai teachers, whereas the Thai parent and teacher versions of the Swanson, Nolan, and Pelham IV Rating Scale (SNAP-IV) was used to evaluate ADHD symptoms. Demographic data were collected from parents using a self-reported questionnaire. RESULTS: Among the 703 students with almost equal number of male (n=350) and female (n=353), and the average age of 6.56±0.57 years, 95 (13.51%) were classified (significantly male) at risk of reading disorder. The mean SNAP-IV scores of children with reading disorder reported by parents and teachers (20.23±10.95 and 20.75±15.08, respectively) were significantly higher than those of neurotypical children (16.04 ±8.59 and 9.00±10.14, respectively, P<0.05). Of the 95 students with reading disorder reported by parents and teachers, 29 (30.53%) and 20 (21.05%) respectively, were defined as having ADHD according to the standard cutoff SNAP-IV scores, which were significantly higher than 608 neurotypical students at 108 (17.76%) and 20 (5.59%) (P<0.05). The odds ratios of children with reading disorder having ADHD symptoms according to teacher reports were 3.32 (95% confidence interval [CI], 1.14-9.67; P<0.05), 3.75 (95% CI, 1.60-8.79; P<0.05), and 4.41 (95% CI, 1.20-16.15; P<0.05) for inattentive, hyperactive, and combined presentations, respectively. CONCLUSION: Grade 1 students with reading disorder had a significantly higher prevalence of ADHD symptoms than neurotypical students. Therefore, children with reading disorders should undergo ADHD assessments and receive proactive intervention.

Novel SOX10 Mutations in Waardenburg Syndrome: Functional Characterization and Genotype-Phenotype Analysis.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung's disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung's disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung's disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype-phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30∗), c.207_8 delCG (p.Cys71Hisfs∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype-phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

Development of clinical prediction rule for diagnosis of autistic spectrum disorder in children.

PURPOSE: This study aims to develop a clinical prediction rule for the diagnosis of autistic spectrum disorder (ASD) in children. DESIGN/METHODOLOGY/APPROACH: This population-based study was carried out in children aged 2 to 5 years who were suspected of having ASD. Data regarding demographics, risk factors, histories taken from caregivers and clinical observation of ASD symptoms were recorded before specialists assessed patients using standardized diagnostic tools. The predictors were analyzed by multivariate logistic regression analysis and developed into a predictive model. FINDINGS: An ASD diagnosis was rendered in 74.8 per cent of 139 participants. The clinical prediction rule consisted of five predictors, namely, delayed speech for their age, history of rarely making eye contact or looking at faces, history of not showing off toys or favorite things, not following clinician's eye direction and low frequency of social interaction with the clinician or the caregiver. At four or more predictors, sensitivity was 100 per cent for predicting a diagnosis of ASD, with a positive likelihood ratio of 16.62. ORIGINALITY/VALUE: This practical clinical prediction rule would help general practitioners to initially diagnose ASD in routine clinical practice.

Quality of life and comprehensive health supervision for children with Down syndrome in Thailand.

Children with Down syndrome often require several specialty doctors and multidisciplinary teams for their associated anomalies. This may impact their quality of life and creates gaps in treatment monitoring. No studies have yet been conducted in Thailand to measure their quality of life and level of comprehensive health supervision. Therefore, we aimed to study the quality of life among children with Down syndrome and determine if they receive comprehensive health supervision for their condition. In this descriptive research, data were collected from a medical record review of children with Down syndrome during a 1-year period in our Pediatric Outpatient Clinic; 50 children and 39 caregivers participated. Mean total quality of life score of the children was 67.9/100 points. The children had the highest scores (73.6 ± 12.8) in emotional functioning and the lowest (57.2 ± 25.6) in cognitive functioning. It appears that the quality of life may be lower in Down syndrome patients than in Thai children without it. Regarding health supervision, all 50 were screened for thyroid function, and 48 received cardiac evaluations. However, only 17 (34%) received "complete basic assessment" of 5 screening combinations with developmental evaluations and growth monitoring. Furthermore, none received "comprehensive" evaluations for all recommended conditions. While these findings show a need for health supervision improvement for children with Down syndrome within our hospital, they may also be indicative for most care facilities throughout Thailand.

Thailand's national universal developmental screening programme for young children: action research for improved follow-up.

INTRODUCTION: In low-income and middle-income countries, it is estimated that one in every three preschool-age children are failing to meet cognitive or socioemotional developmental milestones. Thailand has implemented a universal national developmental screening programme (DSPM) for young children to enable detection of developmental disorders and early intervention that can improve child health outcomes. DSPM implementation is being hampered by low attendance at follow-up appointments when children fail the initial screening. METHODS: Action research, using qualitative methods was conducted with 19 caregivers, 5 health workers and 1 chief at two Health Promotion Hospitals to explore the factors affecting attendance at follow-up appointments. Transcripts and notes were analysed using descriptive content analysis. Findings were then discussed with 48 health workers, managers, researchers and policymakers. RESULTS: The high workload of health workers during busy vaccination clinics, and inadequate materials prevented clear communication with caregivers about the screening, how to stimulate child development and the screening result. Caregivers, particularly grandparents, had a lack of understanding about how to stimulate child development, and did not fully understand failed screening results. Caregivers felt blamed for not stimulating their child's development, and were either worried that their child was severely disabled, or they did not believe the screening result and therefore questioned its usefulness. This led to a lack of attendance at follow-up appointments. CONCLUSION: Task-sharing, mobile health (mhealth), community outreach and targeted interventions for grandparent caregivers might increase awareness about child development and screening, and allow health workers more time to communicate effectively. Sharing best practices, communication training and mentoring of DSPM workers coupled with mhealth job aids could also improve caregiver attendance at follow-up. Engagement of caregivers in understanding the barriers to attendance at follow-up and engagement of stakeholders in the design and implementation of interventions is important to ensure their effectiveness.

Parent Evaluation of Developmental Status (PEDS) in screening: The Thai experience.

BACKGROUND: Parent Evaluation of Developmental Status (PEDS) is a feasible developmental screening tool but it is not commonly used in Thailand. To examine the potential of PEDS as a screening tool, PEDS was implemented in well-child visits to identify the prevalence of developmental problems, characteristic parental concerns and comments, and to compare it with pediatrician developmental evaluation using Parent Evaluation of Developmental Status: Developmental Milestones, assessment level (PEDS: DM-AL). METHODS: Participants were 266 children at the 9, 18 and 30 month health checkups as well as their parents. The PEDS questionnaire (Thai version) was first used for parents, and then the children were evaluated by pediatricians using PEDS: DM-AL. RESULTS: Using PEDS, 12% and 34% of children were classified as high and moderate risk for developmental and social-emotion disorders. The most common concerns were behavioral problems, social-emotion problems and expressive language. On PEDS: DM-AL, 24% of children had delay in at least one domain of development. When PEDS screening was compared with PEDS: DM-AL, being in the PEDS high-risk group had 27.7% sensitivity and 93.0% specificity. If being in the moderate or high-risk group was used instead, the sensitivity was enhanced to 67.7%, with 60.7% specificity. CONCLUSIONS: Implementation of PEDS in well-child visits could enhance early detection of developmental problems, but many Thai parents were unable to mention their concerns about delayed abilities in the correct PEDS question. Therefore, to ensure higher sensitivity, criteria for referral should be adjusted and a second stage developmental evaluation may be incorporated with PEDS.

Longitudinal Case-Control Study of Imitation in Younger Siblings of Children with Autism Spectrum Disorder.

Background: Siblings of children with autism spectrum disorders (ASD) have higher prevalence of ASD with a recurrence of 19%. Children with ASD demonstrate significant impairment in all types of imitative skills. Imitation is markedly developed in the first few years of life; therefore, a study of imitation in younger siblings in this period may reveal early deviation. Objective: To study the development of imitation skills from 9- to 18-months, specifying types of imitation, in siblings of children with ASD compared with typically developing children. Method and Material: A longitudinal case-control study was conducted on eight siblings of children with ASDs and nineteen typically developing children who were age- and gender-matched. Data collection consisted of parental recording of emerging imitative abilities and structured direct observation of imitative skills at 9, 12 and 18 months. Three types of imitative skills were targeted including vocal, object and gesture imitation. Results: The development of vocal imitation in siblings of children with ASD between 12 to 18 months was delayed in comparison with typically developing children with significant statistical difference at 18 months. Object and gesture imitations were not significantly different between the two groups. Conclusion: Siblings of children with ASDs had some delays in vocal imitation skills at the age of 12 to 18 months, compared with typically developing children.

Depression and burden among caregivers of children with autistic spectrum disorder.

OBJECTIVE: To study depression prevalence and burden among caregivers of children with autistic spectrum disorder and the related factors. MATERIAL AND METHOD: This is a cross-sectional descriptive study. Measures included questionnaires, CES-D and burden interview. Patients' diagnoses andfunctions were obtainedfrom childpsychiatrists and developmental pediatricians responsible for the patients. RESULTS: There were 51 participants. The depression prevalence was 5.9%. Concerning the burden, 45.1% ofthe participants reported little or no burden, and 45.1% reported mild to moderate burden. Only 7.8% and 2.0% experienced moderate to severe and severe burdens, respectively. There was a significant positive correlation between depression and burden (p = 0.012). Significant correlations were also observed between burden and months after diagnosed, the number ofpatient' problems and the number of hours that caregiver spent with patient per day. Moreover the burden was significantly associated with patient's communication problems and patient's inappropriate odd repetitive behaviors (p<0. 05). CONCLUSION: The prevalence of depression in and severe burden on caregivers of autistic childrenfrom the present study was low. Factors related to the burden were months after diagnosed, the number of patient's problems, the number of hours that caregiver spent with patient, patient's communication problems and inappropriate or odd repetitive behaviors.