Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 3 de 3
Filtrar
Más filtros











Intervalo de año de publicación
1.
Rev. bras. pesqui. méd. biol ; Braz. j. med. biol. res;48(1): 39-45, 01/2015. graf
Artículo en Inglés | LILACS | ID: lil-730436

RESUMEN

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

2.
Braz J Med Biol Res ; 48(1): 39-45, 2015 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-25493381

RESUMEN

The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

3.
Clin Exp Rheumatol ; 32(2): 162-7, 2014.
Artículo en Inglés | MEDLINE | ID: mdl-24480124

RESUMEN

OBJECTIVES: We sought to determine the effect of statin therapy on the levels of proinflammatory/prothrombotic markers and disease activity scores in patients with SLE in a multi-ethnic, multi-centre cohort (LUMINA). METHODS: Plasma/serum samples from SLE patients placed on statins (n=21) therapy taken before and after at least 6 months of treatment were tested. Disease activity was assessed using SLAM-R scores. Interleukin (IL)-1ß, IL-6, IL-8, tumour necrosis factor (TNF)-α, vascular endothelial growth factor (VEGF) and soluble CD40 ligand (sCD40L) levels were determined by a multiplex immunoassay. Soluble intercellular cell adhesion molecule (ICAM)-1, vascular cell adhesion molecule (VCAM)-1 and anticardiolipin (aCL) antibodies were evaluated using ELISA assays while high sensitivity C-reactive protein (hsCRP) was assessed by nephelometry. Plasma/serum samples from frequency- matched healthy donors were used as controls. RESULTS: Levels of IL-6, VEGF, sCD40L and TNF-α were significantly elevated in SLE patients versus controls. Statin therapy resulted in a significant decrease in SLAM-R scores (p=0.0199) but no significant changes in biomarker levels were observed. There was no significant association of biomarkers with SLAM-R scores. CONCLUSIONS: Statin therapy resulted in significant clinical improvement in SLE patients, underscoring the use of statins in the treatment of SLE.


Asunto(s)
Biomarcadores/sangre , Inhibidores de Hidroximetilglutaril-CoA Reductasas/farmacología , Lupus Eritematoso Sistémico , Adulto , Proteína C-Reactiva/análisis , Ligando de CD40/sangre , Etnicidad , Femenino , Humanos , Molécula 1 de Adhesión Intercelular/sangre , Interleucinas/sangre , Estudios Longitudinales , Lupus Eritematoso Sistémico/sangre , Lupus Eritematoso Sistémico/diagnóstico , Lupus Eritematoso Sistémico/tratamiento farmacológico , Lupus Eritematoso Sistémico/fisiopatología , Masculino , Gravedad del Paciente , Puerto Rico/epidemiología , Proyectos de Investigación , Resultado del Tratamiento , Factor de Necrosis Tumoral alfa/sangre , Estados Unidos/epidemiología , Molécula 1 de Adhesión Celular Vascular/sangre
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA