Atopy manifestations in pediatric patients with acute lymphoblastic leukemia: correlation assessment with interleukin-4 (IL-4) and IgE level.

BACKGROUND: Acute lymphoblastic leukemia (ALL) is the most common type of cancer in the age range of under 15 years old and accounts for 25-30% of all childhood cancers. Although conventional chemotherapy regimens are used to improve the overall survival rate, it has been associated with some complications, amongst which allergic manifestations with unknown mechanisms are more common. METHODS: Our study compared serum IgE and IL-4 concentration, as a hallmark of allergic responses in pediatric ALL patients before and after 6 months of intensive (high-dose) chemotherapy, to show whether changes in the level of these markers may be associated with atopy. Serum level of IL-4 and IgE was measured using enzyme-linked immunosorbent assay (ELISA) method. RESULTS: The results showed that the level of IgE and IL-4 increased following chemotherapy in both ALL patients with and without atopy. In addition, post-chemotherapy treatment IgE and IL-4 levels were significantly elevated in patients with atopy compared to those without it. The difference between baseline and post-chemotherapy level of IgE and IL-4 was significantly higher in patients with atopy compared to those without it. CONCLUSIONS: To the best of our knowledge, this is the first study that showed a connection between post-chemotherapy allergic manifestations in pediatric ALL patients and IL-4 and IgE level. Flow cytometry analysis of the T-helper 2 (Th2) lymphocytes and other allergy-related T cell subsets like Tc2 and Th9 as well as the study of the genetic variations in atopy-related genes like IL-4/IL-4R, IL-5, IL-9, IL-13, and high affinity FcεRI IgE receptor and also HLA genes is necessary to clearly define the underlying mechanism responsible for post-chemotherapy hypersensitivity reaction in pediatric ALL patients.

Assessment of the HScore as a predictor of disease outcome in patients with COVID-19.

Severe coronavirus disease 2019 (COVID-19) accompanies hypercytokinemia, similar to secondary hemophagocytic lymphohistiocytosis (sHLH). We aimed to find if HScore could predict disease severity in COVID-19. HScore was calculated in hospitalized children and adult patients with a proven diagnosis of COVID-19. The need for intensive care unit (ICU), hospital length of stay (LOS), and in-hospital mortality were recorded. The median HScore was 43.0 (IQR 0.0-63.0), which was higher in those who needed ICU care (59.7, 95% CI 46.4-72.7) compared to those admitted to non-ICU medical wards (38.8, 95% CI 32.2-45.4; P = 0.003). It was also significantly higher in patients who died of COVID-19 (105.1, 95% CI 53.7-156.5) than individuals who survived (41.5, 95% CI 35.8-47.1; P = 0.005). Multivariable logistic regression analysis revealed that higher HScore was associated with a higher risk of ICU admission (adjusted OR = 4.93, 95% CI 1.5-16.17, P = 0.008). The risk of death increased by 20% for every ten units increase in HScore (adjusted OR 1.02, 95% CI 1.00-1.04, P = 0.009). Time to discharge was statistically longer in high HScore levels than low levels (HR = 0.41, 95% CI 0.24-0.69). HScore is much lower in patients with severe COVID-19 than sHLH. Higher HScore is associated with more ICU admission, more extended hospitalization, and a higher mortality rate. A modified HScore with a new cut-off seems more practical in predicting disease severity in patients with severe COVID-19.

Relationship of glucose-6-phosphate dehydrogenase deficiency and neonatal sepsis: a single-center investigation on the major cause of neonatal morbidity and mortality.

Introduction: Neonatal sepsis is a serious disease with distinct clinical and laboratory findings. G6PD deficiency is known as the most common human erythrocyte-enzyme deficiency. This study was designed to investigate the relationship between G6PD deficiency and neonatal sepsis, since it is a major cause of neonatal morbidity and mortality. Methods: A cross-sectional case-control study was designed and performed on 50 neonates who had been admitted to the neonatal intensive-care unit and diagnosed with sepsis and 50 normal neonate controls. Quantitative G6PD-enzyme activity was assessed in the case and control groups. Results: Quantitative G6PD-level assessment showed that five (5%) subjects in the case group vs one (1%) of the control group were severely deficient and nine (9%) cases vs one (1%) control were moderately deficient. Enzyme-level differences were statistically significant (P=0.003). Conclusion: Our study showed higher incidence of G6PD deficiency in neonates who had been admitted due to sepsis. We suggest quantitative G6PD-level assessment instead of the routine qualitative methods in prevalent G6PD deficiency. It is also recommended that neonates with G6PD deficiency be under close supervision during the first month of life, especially those with other risks of neonatal sepsis, such as prematurity or low birth weight.

Acquired Vitamin K Deficiency as Unusual Cause of Bleeding Tendency in Adults: A Case Report of a Nonhospitalized Student Presenting with Severe Menorrhagia.

We report a rare case of acquired vitamin K deficiency presenting with severe menorrhagia and without any gynecological problem. Partial thromboplastin time (59.2 seconds) and prothrombin time (33.1 seconds, INR: 5.97) were considerably prolonged in laboratory evaluations. A complete coagulation factor assay test was performed for the patient: factor IX, 24%; factor II, 41%; factor VII, 3%; and factor X, 52%. She had been taking many high-energy drinks and she had inadequate dietary intake for the past 6 months. Given that she had vitamin K deficiency (VKD), a course of vitamin K therapy was started for her in the hospital. This case showed the potential for menorrhagia due to VKD with use of high-energy drinks and the value of a complete and detailed history in early diagnosis.

Introduction of novel α1-hemoglobin gene mutation with transfusion-dependent phenotype.

OBJECTIVE AND IMPORTANCE: Thalassemia is the most frequently monogenetic disorders around the world that is inherited as a recessive single-gene disease, resulting from mutations in α- or ß-globin gene clusters. The aim of this report was to present a new insertional mutation in the α1 globin gene which causes transfusion-dependent anemia in α-thalassemic patients. CLINICAL PRESENTATION: Two 5-year-old girls with blood transfusion-dependent α-thalassemia anemia and another girl with moderate α-thalassemia have been presented among patients who have been referred to Hematology and Thalassemia Research Center, Dastgheib Hospital, Shiraz, Iran. They were not relatives. All children were stunted and pale; they were put on regular blood transfusion every 14-21 days. INTERVENTION: Sequencing of the ß-globin gene was normal in all cases and their parents; but, α-globin gene sequencing results were remarkable. An insertion of 21 base pairs (IVS II+3ins (+21nt)(+GACCCGGTCAACTTCAAGGTG) in the α1-globin gene was detected in all three cases and one of their parents. In two cases, this insertion was accompanied by MED deletion and in one child by POLY A1 mutation. MED deletion was detected by gap-PCR. CONCLUSION: This new 21 base pair insertion cannot affect blood parameters on its own, but can present as continuous blood transfusion-dependent α-thalassemia. Thus, it is important to take this point into account for detecting the carriers, like ß-thalassemia carriers, which can present as transfusion-dependent children in parents with α-thalassemia trait.

Effectiveness of ß-thalassemia prenatal diagnosis in Southern Iran: a cohort study.

AIM: The aim of this study was to evaluate the effectiveness of prenatal diagnosis (PND) for the prevention of thalassemia in Southern Iran. METHODS: From 2004 to 2012 1346 couples with ß-thalassemia minor were referred to our center. Mutation analyses utilized different methods including polymerase chain reaction-based technique of amplification refractory mutation system (ARMS), Restriction Fragment Length Polymorphism Analysis of PCR-Amplified Fragments (PCR-RFLP) and Gel Electrophoresis and direct sequencing. Haplotype analysis of the ß-globin gene cluster was done routinely using the PCR-RFLP technique. RESULTS: Of the 1346 couples, 884 (66%) requested PND. They had a total of 985 pregnancies (954 singleton and 31 twin pregnancies): the 1016 fetuses underwent chorionic villus sampling (CVS). Thalassemia major was diagnosed in 266 cases (26.2%), and termination of pregnancy was requested by the parents in 264 of them (99%). Thalassemia trait was detected in 499 (49.1%) and 251 cases (24.7%) showed no ß-thalassemia mutations. There were three misdiagnoses (0.4%) (affected children diagnosed as carriers at PND). A unique pattern of thalassemia mutations was present in the study population, with IVS II-I (G→A), C36-37(-T), IVS I-5(G>C), -25bpdel (252-276), IVS I-110(G>A) and C44 (-C) being present in 62% of cases. CONCLUSION: The pattern of distribution of thalassemia mutations differs among ethnic groups within the same country.

Primary tonsillar lymphomas according to the new World Health Organization classification: to report 87 cases and literature review and analysis.

The present study aimed to define the natural history, World Health Organization (WHO) classification, prognostic factors, and treatment outcome of 87 patients with primary lymphoma of the palatine tonsil and literature review and analysis. Between 1990 and March 2008, 87 consecutive patients diagnosed with primary lymphoid malignancy of the palatine tonsil. All pathologic specimens were reviewed and reclassified according to the recent WHO classification. To investigate the association of tonsillar lymphomas with Epstein-Barr virus (EBV), in situ hybridization was performed for 24 tonsillar lymphomas (23 diffuse large B-cell lymphoma (DLBC) and one classic Hodgkin's disease) and ten normal tonsils as control group. In literature review, we found 26 major related series including 1,602 patients with primary tonsillar lymphoma. The median age of our patients was 52 years (range 11-86 years). There were 39 women and 48 men with a median follow-up of 67 months for living patients. The vast majority (95%) of patients had B-cell phenotype. DLBC was the most frequent histology. In situ hybridization revealed none of 23 DLBC to be positive for EBV. The 5-year disease-free and overall survival rates were 78.9% and 86%, respectively. In the literature review and by analyzing the data collection from 26 major reported series, the median age was 55 years and male/female ratio was 1.3:1. Intermediate grade tumors consisted of 72% of all tonsillar lymphomas and B-cell lymphomas constituted 82% of all cell immunophenotypes. The 5-year disease-free and overall survival rates were 61% and 67%, respectively. The vast majority of tonsillar lymphomas are of B-cell origin and with intermediate to high-grade histology. These neoplasms tend to present in early stage disease and to have favorable outcome. WHO classification predicts more accurately treatment outcome of patients with tonsillar lymphoma. The association of DLBC in the palatine tonsil with EBV infection is infrequent.