Dock3 Participate in Epileptogenesis Through rac1 Pathway in Animal Models.

Epilepsy is one of the most common and severe neurologic diseases. The mechanisms of epilepsy are still not fully understood. Dock3 (dedicator of cytokinesis 3) is one of the new kinds of guanine-nucleotide exchange factors (GEF) and plays an important role in neuronal synaptic plasticity and cytoskeleton rearrangement; the same mechanisms were also found in epilepsy. However, little is known regarding the expression of Dock3 in the epileptic brain and whether Dock3 interventions affect the epileptic process. In this study, we showed that the expression of Dock3 significantly increased in IE patients and a lithium-pilocarpine epilepsy model compared with the controls. Inhibition of Dock3 by Dock3 shRNA impaired the severity of status epilepticus in the acute stage and decreased the spontaneous recurrent seizures times in the chronic stage of lithium-pilocarpine model and decreased the expression of rac1-GTP. Consistent with decreased expression of Dock3, the latent period in a pentylenetetrazole kindling model also increased. Our results demonstrated that the increased expression of Dock3 in the brain is associated with epileptogenesis and specific inhibition of Dock3 may be a potential target in preventing the development of epilepsy in patients.

Association of Alpha-Soluble NSF Attachment Protein with Epileptic Seizure.

Alpha-soluble N-ethylmaleimide-sensitive factor (NSF) attachment protein (αSNAP) is a ubiquitous and indispensable component of membrane fusion machinery. There is accumulating evidence that mild alterations of αSNAP expression may be associated with specific pathological conditions in several neurological disorders. This study aimed to assess αSNAP expression in temporal lobe epilepsy (TLE) patients and pilocarpine-induced rat model and to determine whether altered αSNAP expression leads to increased susceptibility to seizures. The expression of αSNAP was assessed in the temporal lobe from patients with TLE and pilocarpine-induced epileptic rats. In addition, αSNAP expression was silenced by lentivirus pLKD-CMV-GFP-U6-NAPA (primer: GGAAGCATGCGAGATCTATGC) in animals. At day 7, the animals were kindled by pilocarpine and then the time of latency to seizure and the incidence of chronic idiopathic epilepsy seizures were assessed. The immunoreactivity to alpha-SNAP was utilized to measure expression of this protein in the animal. By immunohistochemistry, immunofluorescence, and western blotting, we found significantly lower αSNAP levels in patients with TLE. αSNAP expression showed no obvious change in pilocarpine-induced epileptic rats, from 6 h to 3 days after seizure, compared with the control group, in the acute stage; however, αSNAP levels were significantly lower in the chronic phase (day 7, months 1 and 2) in epileptic rats. Importantly, behavioral data revealed that αSNAP-small interfering RNA (siRNA) could decrease the time of latency to seizure and increase the incidence of chronic idiopathic epilepsy seizures compared with the control group. αSNAP is mainly expressed in the neuron brain tissue of patients with TLE and epileptic animals. Our findings suggest that decreasing αSNAP levels may increase epilepsy susceptibility, providing a new strategy for the treatment of this disease.

5-HT6 Receptor Recruitment of mTOR Modulates Seizure Activity in Epilepsy.

Approximately 30% of epilepsy cases are refractory to current pharmacological treatments. Thus, novel therapeutic approaches that prevent or reverse the molecular and cellular mechanisms of epilepsy are required. 5-HT6 receptor (HTR6) blockade can modulate multiple neurotransmitter systems, and HTR6 may be a potential therapeutic treatment for neurological diseases, including epilepsy. Here, we investigated the role of HTR6 in epilepsy. We detected HTR6 expression both in human epileptic tissues and the pilocarpine rat model by western blotting. We observed behavioral changes after administration of pilocarpine in rats pretreated with a selective HTR6 antagonist, SB-399885, and recorded the electrophysiological index in the pilocarpine rat model pre- or posttreated with SB-399885 by electroencephalogram (EEG) and whole-cell clamp. We measured the activity of mammalian target of rapamycin (mTOR) in the pilocarpine rat model pretreated with the mTOR-specific inhibitor, rapamycin, and SB-399885 using western blotting. We found that HTR6 expression was upregulated in both human tissues and the pilocarpine rat model, and that SB-399885 could suppress epileptic seizures and mTOR activity in epileptic seizures. These results suggest that HTR6 plays an important role in modulating seizure activity and that the blockade of the HTR6/mTOR pathway could be a potential therapeutic target for epilepsy treatment.