TOB1 inhibits the gastric cancer progression by focal adhesion pathway and ERK pathway based on transcriptional and metabolic sequencing.

Gastric cancer is one of the most malignant digestive tract tumors worldwide and its progression is associated with gene expression and metabolic alteration. We revealed that the gastric cancer patients with lower expression level of TOB1 exhibited poorer overall survivals according to the data in Kaplan-Meier Plotter. The unphosphorylated TOB1 protein which is effective expressed lower in gastric cancer cells. The gastric cancer cells with TOB1 gene depletion performed higher abilities of proliferation, migration and invasion and lower ability of apoptosis in vitro. The TOB1 gene depletion also promoted the tumorigenesis of gastric cancer cells in vivo. The gastric cancer cells with TOB1 gene overexpression had the converse behaviors. The transcriptional and metabolic sequencing was performed. The analyzation results showed that genes correlate-expressed with TOB1 gene were enriched in the pathways related to ERK pathway, including focal adhesion pathway, which was verified using real-time quantitative PCR. After inhibiting ERK pathway, the proliferation, colony formation and migration abilities were reduced in gastric cancer cells with low phosphorylated TOB1 protein expression level. Moreover, Pearson correlation analysis was adopted to further analyze the correlation of enriched metabolic products and differentially expressed genes. The expression of Choline, UDP-N-acetylglucosamine, Adenosine and GMP were related to the function of TOB1. This study demonstrates the genes and metabolites related to focal adhesion pathway and ERK pathway are the potential diagnosis and therapeutic targets to gastric cancer with TOB1 depletion.

MiR-375 promotes cisplatin sensitivity of lung adenocarcinoma.

BACKGROUND: Cisplatin-based chemotherapy has been widely used in the treatment of lung adenocarcinoma (LUAD). However, the development of cisplatin resistance becomes a major obstacle impeding the curative effect. It remains necessary to uncover the molecular mechanism of cisplatin resistance. METHODS: Based on the CCLE database, lung cancer cell lines were divided into cisplatin-resistant and cisplatin-sensitive groups. The differentially expressed miRNAs were filtered and further identified by survival prognosis analysis. After transfection with miR-375 inhibitor or mimic, cell cytotoxicity assay, flow cytometry and western blot were conducted to validate the role of miR-375. The transcription factor (TF)-miRNA network was constructed based on TransmiR. The target genes of miR-375 were predicted by Starbase and further verified by RT-qPCR and immunohistochemistry results in the Human Protein Atlas. Functional enrichment analysis was performed with GO terms and KEGG. RESULTS: In this study, miR-375 showed the ability to promote cisplatin sensitivity and apoptosis of LUAD. Genes correlated with miR-375 in LUAD were analyzed and ABCC8 showed the strongest positive correlation. Moreover, transcription factors that regulate miR-375 expression were predicted. MBNL1, PTPN3, PRKD1 and RPN1 were identified as the target genes of miR-375. Enrichment analysis demonstrated that miR-375-related genes associated with promoting cell proliferation and anti-apoptosis were involved in the MAPK signaling pathway. CONCLUSION: Overall, this study provides new insights into the role of miR-375 in the cisplatin sensitivity of LUAD. Our present findings may serve as a theoretical basis for new therapeutic strategies and predictive models of cisplatin resistance in LUAD.

Identification and characterization of the compound heterozygous variants of TYR gene in a northern Chinese family with Oculocutaneous albinism type 1.

Oculocutaneous albinism (OCA) is a genetically heterogeneous disease and is most inherited in an autosomal recessive manner. The characteristic manifestation of OCA is due to disfunction of melanin synthesis. OCA1 is the most severe subtype of OCA and is caused by homozygous or compound heterozygous variants in tyrosinase (TYR) gene, which is the key gene for melanin synthesis. This study aimed to identify the genetic variants of a northern Chinese family with OCA1. Clinical information and peripheral blood samples were collected. PCR amplification and Sanger sequencing were used to detect the entire exons and adjacent flanking sequences of TYR gene. Functional prediction of variants was performed by various bioinformatic analyses, while the pathogenicity classification of variants was evaluated according to ACMG standards and guidelines. A missense variant NM_000372.5:c.107G > C;NP_000363.1:p.C36S was discovered in TYR gene which converted cysteine to serine. Another variant in intron, NM_000372.5:c.1037-7 T > A, also affected the function of TYR gene. We verified the pathogenicity of the intron variant with a pCAS2 mini-gene based splicing assay and found that c.1037-7 T > A led to an insertion of 5 bp upstream from the common acceptor site of exon 3, which caused a frameshift TYR:c.1037-7 T > A:p.G346Efs*11. The results showed that the compound heterozygous variants c.107G > C:p.C36S and c.1037-7 T > A:p.G346Efs*11 of TYR gene were the pathogenic variants for this OCA1 family.

A novel extrachromosomal circular DNA related genes signature for overall survival prediction in patients with ovarian cancer.

OBJECTIVE: Ovarian cancer (OV) has a high mortality rate all over the world, and extrachromosomal circular DNA (eccDNA) plays a key role in carcinogenesis. We wish to study more about the molecular structure of eccDNA in the UACC-1598-4 cell line and how its genes are associated with ovarian cancer prognosis. METHODS: We sequenced and annotated the eccDNA by Circle_seq of the OV cell line UACC-1598-4. To acquire the amplified genes of OV on eccDNA, the annotated eccDNA genes were intersected with the overexpression genes of OV in TCGA. Univariate Cox regression was used to find the genes on eccDNA that were linked to OV prognosis. The least absolute shrinkage and selection operator (LASSO) and cox regression models were used to create the OV prognostic model, as well as the receiver operating characteristic curve (ROC) curve and nomogram of the prediction model. By applying the median value of the risk score, the samples were separated into high-risk and low-risk groups, and the differences in immune infiltration between the two groups were examined using ssGSEA. RESULTS: EccDNA in UACC-1598-4 has a length of 0-2000 bp, and some of them include the whole genes or gene fragments. These eccDNA originated from various parts of chromosomes, especially enriched in repeatmasker, introns, and coding regions. They were annotated with 2188 genes by Circle_seq. Notably, the TCGA database revealed that a total of 198 of these eccDNA genes were overexpressed in OV (p < 0.05). They were mostly enriched in pathways associated with cell adhesion, ECM receptors, and actin cytoskeleton. Univariate Cox analysis showed 13 genes associated with OV prognosis. LASSO and Cox regression analysis were used to create a risk model based on remained 9 genes. In both the training (TCGA database) and validation (International Cancer Genome Consortium, ICGC) cohorts, a 9-gene signature could successfully discriminate high-risk individuals (all p < 0.01). Immune infiltration differed significantly between the high-risk and low-risk groups. The model's area under the ROC curve was 0.67, and a nomograph was created to assist clinician. CONCLUSION: EccDNA is found in UACC-1598-4, and part of its genes linked to OV prognosis. Patients with OV may be efficiently evaluated using a prognostic model based on eccDNA genes, including SLC7A1, NTN1, ADORA1, PADI2, SULT2B1, LINC00665, CILP2, EFNA5, TOMM.

Involvement of TOB1 on autophagy in gastric cancer AGS cells via decreasing the activation of AKT/mTOR signaling pathway.

BACKGROUND: We previously identified the tumor suppressor gene TOB1 as related to gastric cancer. The purpose of this study was to explore whether TOB1 induces autophagy through the AKT/mTOR signaling pathway in gastric cancer. METHODS: Western blotting was used to detect the protein levels of TOB1, LC3, AKT, mTOR, phosphorylated (p) AKT, and p-mTOR. A double fluorescent GFP-RFP-LC3 fusion protein was used to trace autophagy by laser confocal microscopy. Autophagosomes were observed by transmission electron microscopy. RESULTS: The conversion of LC3-I to LC3-II and the LC3-II/LC3-I ratio were significantly increased in AGS cells overexpressing TOB1 compared with control cells. Fluorescence imaging showed LC3 puncta at 48 h, and these puncta increased significantly at 72 h after TOB1 transfection compared with control tumor cells. The presence of autophagosomes in AGS cells was observed at 72 h after TOB1 transfection by transmission electron microscopy, and no autophagosomes were found in the control cells. Moreover, the levels of p-AKT and p -mTOR were lower in AGS cells than in control cancer cells. CONCLUSION: Our results provide novel insight that TOB1 might suppress gastric cancer by inducing autophagy, possibly through decreasing phosphorylation and the subsequent activation of the AKT/mTOR signaling pathway.

The rs9953490 polymorphism of DAL-1 gene is associated with gastric cancer risk in the Han population in Northeast China.

BACKGROUND: DAL-1 gene was reported to inhibit proliferation, migration, invasion, and epithelial to mesenchymal transition (EMT) of gastric cancer (GC) cells in our previous study. The association between the genomic variants in DAL-1 gene with risk of GC is still unclear. METHODS: In this study, 505 GC cases and 544 healthy controls (HCs) were collected to evaluate the association between six single nucleotide polymorphisms (SNPs) (rs7240736, rs73937194, rs3817466, rs8082898, rs73381527, rs9953490) of DAL-1 gene and GC risk in the Han population in Northeast China. RESULTS: The TA + AA genotypes of rs9953490 were significantly associated with an increased risk in N3 compared with N0 subgroup (adjusted OR = 4.56, 95% CI = 1.49-13.98, P = 0.008), and also showed evident association with an increased risk in TNM stage III compared with stage I-II (adjusted OR = 2.33, 95% CI = 1.16-4.67, P = 0.017). CONCLUSION: The rs9953490 of DAL-1 gene may play an important role in the occurrence and development of GC in the Han population in Northeast China.

Molecular structure and evolution mechanism of two populations of double minutes in human colorectal cancer cells.

Gene amplification chiefly manifests as homogeneously stained regions (HSRs) or double minutes (DMs) in cytogenetically and extrachromosomal DNA (ecDNA) in molecular genetics. Evidence suggests that gene amplification is becoming a hotspot for cancer research, which may be a new treatment strategy for cancer. DMs usually carry oncogenes or chemoresistant genes that are associated with cancer progression, occurrence and prognosis. Defining the molecular structure of DMs will facilitate understanding of the molecular mechanism of tumorigenesis. In this study, we re-identified the origin and integral sequence of DMs in human colorectal adenocarcinoma cell line NCI-H716 by genetic mapping and sequencing strategy, employing high-resolution array-based comparative genomic hybridization, high-throughput sequencing, multiplex-fluorescence in situ hybridization and chromosome walking techniques. We identified two distinct populations of DMs in NCI-H716, confirming their heterogeneity in cancer cells, and managed to construct their molecular structure, which were not investigated before. Research evidence of amplicons distribution in two different populations of DMs suggested that a multi-step evolutionary model could fit the module of DM genesis better in NCI-H716 cell line. In conclusion, our data implicated that DMs play a very important role in cancer progression and further investigation is necessary to uncover the role of the DMs.

Disease causing property analyzation of variants in 12 Chinese families with polycystic kidney disease.

BACKGROUND: Polycystic kidney disease (PKD) is an inherited disease that is life-threatening. Multiple cysts are present in the bilateral kidneys of PKD patients. The progressively enlarged cysts cause structural damage and loss of kidney function. METHODS: This study examined and analyzed 12 families with polycystic kidney disease. Whole exome sequencing (WES) or whole genome sequencing (WGS) of the probands was performed to detect the pathogenic genes. The candidate gene segments for lineal consanguinity in the family were amplified by the nest PCR followed by Sanger sequencing. The variants were assessed by pathogenic and conservational property prediction analysis and interpreted according to the American College of Medical Genetics and Genomics. RESULTS: Nine of the 12 pedigrees were identified the disease causing variants. Among them, four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) were detected. After assessment, the four novel variants were considered to be pathogenic variants and cause autosomal dominant polycystic kidney disease in family. The detected variants were interpreted. CONCLUSION: The four novel variants in PKD1, c.6930delG:p.C2311Vfs*3, c.1216T>C:p.C406R, c.8548T>C:p.S2850P, and c.3865G>A:p.V1289M (NM_001009944.2) are pathogenic variants and cause autosomal dominant polycystic kidney disease in family.

Competitive endogenous network of lncRNA, miRNA, and mRNA in the chemoresistance of gastrointestinal tract adenocarcinomas.

Chemotherapy is one of the main therapeutic strategies used for gastrointestinal tract adenocarcinomas (GTAs), but resistance to anticancer drugs is a substantial obstacle in successful chemotherapy. Accumulating evidence shows that non-coding RNAs, especially long non-coding RNAs (lncRNAs) and microRNAs (miRNAs), can affect the drug resistance of tumor cells by forming a ceRNA regulatory network with mRNAs. The efficiency of the competing endogenous RNAs (ceRNAs) network can be affected by the number and integrality of miRNA recognition elements (MREs). Dynamic factors such as RNA editing, alternative splicing, single nucleotide polymorphism (SNP), RNA-binding proteins and RNA secondary structure can influence the MRE activity, which may in turn be involved in the regulation of chemoresistance-associated ceRNA network by prospective approaches. Besides activities in a single tumor cell, the components of the tumor micoenvironment (TME) also affect the ceRNA network by regulating the expression of non-coding RNA directly or indirectly. The alternation of the ceRNA network often has an impact on the malignant phenotype of tumor including chemoresistance. In this review, we focused on how MRE-associated dynamic factors and components of TME affected the ceRNA network and speculated the potential association of ceRNA network with chemoresistance. We also summarized the ceRNA network of lncRNAs, miRNAs, and mRNAs which efficiently triggers chemoresistance in the specific types of GTAs and analyzed the role of each RNA as a "promoter" or "suppressor" of chemoresistance.

Combinatorial approach of in silico and in vitro evaluation of MLH1 variant associated with Lynch syndrome like metastatic colorectal cancer.

Colorectal cancer (CRC) is the third most developing cancer worldwide and Lynch syndrome (LS) accounts for 3-4% of CRC. Genetic alteration in any of DNA mismatch repair (MMR) gene is the major cause of LS that disrupt the normal upstream and downstream MMR events. Germline mutation of MLH1 in heterozygous state have an increased risk for CRC. Defective MMR pathway mostly results in microsatellite instability (MSI) that occurs in high percentage of CRC associated tumors. Here, we reported a patient with LS like metastatic CRC (mCRC) associated with other related cancers. Whole exome sequencing (WES) of the proband was performed to identify potential causative gene. Genetic screening validated by Sanger sequencing identified a heterozygous missense mutation in exon 12 of MLH1 (c.1151T>A, p.V384D). The clinical significance of identified variant was elucidated on the basis of clinicopathological data, computational predictions and various in vitro functional analysis. In silico predictions classified the variant to be deleterious and evolutionary conserved. In vitro functional studies revealed a significant decrease in protein expression because of stability defect leading to loss of MMR activity. Mutant residue found in MutL transducer domain of MLH1 that localized in the nucleus but translocation was not found to be significantly disturbed. In conclusion, our study give insight into reliability of combinatorial prediction approach of in silico and in vitro expression analysis. Hence, we highlighted the pathogenic correlation of MLH1 variant with LS associated CRC as well as help in earlier diagnosis and surveillance for improved management and genetic counselling.

A heterozygous duplication variant of the HOXD13 gene caused synpolydactyly type 1 with variable expressivity in a Chinese family.

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Identification of a pathogenic mutation in a Chinese pedigree with polycystic kidney disease.

Polycystic kidney disease (PKD) is a life­threatening inherited disease with a morbidity of 1:500­1,000 worldwide. Numerous progressively enlarging cysts are observed in the bilateral kidneys of patients with PKD, inducing structural damage and loss of kidney function. The present study analyzed one family with PKD. Whole exome sequencing of the proband was performed to detect the pathogenic gene present in the family. Candidate gene segments for lineal consanguinity in the family were amplified by nest polymerase chain reaction, followed by Sanger sequencing. One novel duplication variant (NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX) and one missense mutation (c.G9022A:p.V3008M) were detected in PKD1. Additionally, the pathogenic substitutions in PKD1 published from the dataset were analyzed. Following analysis and confirmation, the duplication variant NM_001009944.2:c.9359dupA:p.Y3120_E3121delinsX in PKD1, within the polycystin­1, lipoxygenase, α­toxin domain, was considered to be the pathogenic factor in the examined family with autosomal dominant PKD. Additionally, based on the analysis of 4,805 pathogenic substitutions in PKD1 within various regions, the presence of the missense mutation in the N­terminal domain of polycystin­1 may present high pathogenicity in ADPKD.

The distribution of three candidate cold-resistant SNPs in six minorities in North China.

BACKGROUND: Heilongjiang Province located in northeast China is a multi-ethnic region with people who have lived in cold conditions for several generations. Fatty acids are important to people with cold resistance. CPT1A encodes a protein that imports long-chain fatty acids into the mitochondria for fatty-acid oxidation. FADS is an essential enzyme for the synthesis of long-chain polyunsaturated fatty acids. RESULTS: In the present study, we investigated the distributions of three cold resistance-related SNPs (rs80356779 G > A in CPT1A, rs7115739 T > G in FADS3 and rs174570 C > T in FADS2) from six populations that included 1093 individuals who have lived in Heilongjiang Province for at least three generations. The frequencies of rs174570 and rs7115739 were different in our six north minorities compared to the Chinese Dai in Xishuangbanna (CDX) in southern China. All the SNPs in Hezhen were significantly different from other five studied populations. In addition, the genetic distribution of rs174570 in Daur was significantly different from Manchu and Korea, and the frequency of rs7115739 in Ewenki was significantly different from the other populations. The results also showed that the frequencies of the three SNPs in the six minorities were different from those of Greenlandic Inuit and Siberian population. CONCLUSIONS: Our results showed the distributions of the three cold resistance-related SNPs from six populations that included 1093 individuals in northern China. Distributions of the allele frequencies for the cold resistance-related SNPs in northern China were statistically different from those in southern China. These data help to establish the DNA genome database for the six populations and fully preserve existing minority genetic information.