RESUMEN
A checklist of the grasses of India is presented, as compiled from survey of all available literature. Of the twelve subfamilies of grasses, ten are represented in India. Most subfamilies have been examined by taxonomic experts for up-to-date nomenclature. The list includes 1506 species plus infraspecific taxa and presents information on types, synonyms, distribution within India, and habit. Twelve new combinations are made, viz. Arctopoa tibetica (Munro ex Stapf) Prob. var. aristulata (Stapf) E.A. Kellogg, comb. nov.; Chimonocalamus nagalandianus (H.B. Naithani) L.G. Clark, comb. nov.; Chionachne digitata (L.f.) E.A. Kellogg, comb. nov.; Chionachne wallichiana (Nees) E.A. Kellogg, comb. nov.; Dinebra polystachyos (R. Br.) E.A. Kellogg, comb. nov.; Moorochloa eruciformis (Sm.) Veldkamp var. divaricata (Basappa & Muniv.) E.A. Kellogg, comb. nov.; Phyllostachys nigra (Lodd. ex Lindl.) Munro var. puberula (Miq.) Kailash, comb. & stat. nov.; Tzveleviochloa schmidii (Hook. f.) E.A. Kellogg, comb. nov.; Urochloa lata (Schumach.) C.E. Hubb. var. pubescens (C.E. Hubb.) E.A. Kellogg, comb. nov.; Urochloa ramosa (L.) T.Q. Nguyen var. pubescens (Basappa & Muniy.) E.A. Kellogg, comb. nov.; Urochloa semiundulata (Hochst. ex A. Rich.) Ashalatha & V.J. Nair var. intermedia (Basappa & Muniy.) E.A. Kellogg, comb. nov.
RESUMEN
The history of ecology and evolutionary biology is rife with attempts to define and delimit species. However, there has been confusion between concepts and criteria, which has led to discussion, debate, and conflict, eventually leading to lack of consistency in delimitation. Here, we provide a broad review of species concepts, a clarification of category versus concept, an account of the general lineage concept (GLC), and finally a way forward for species discovery and delimitation. Historically, species were considered as varieties bound together by reproduction. After over 200 years of uncertainty, Mayr attempted to bring coherence to the definition of species through the biological species concept (BSC). This has, however, received much criticism, and the last half century has spawned at least 20 other concepts. A central philosophical problem is that concepts treat species as 'individuals' while the criteria for categorization treats them as 'classes'. While not getting away from this problem entirely, the GLC attempts to provide a framework where lineage divergence is influenced by a number of different factors (and correlated to different traits) which relate to the different species concepts. We also introduce an 'inclusive' probabilistic approach for understanding and delimiting species. Finally, we provide aWallacean (geography related) approach to the Linnaean problem of identifying and delimiting species, particularly for cases of allopatric divergence, and map this to the GLC. Going one step further, we take a morphometric terrain approach to visualizing and understanding differences between lineages. In summary, we argue that while generalized frameworks may work well for concepts of what species are, plurality and 'inclusive' probabilistic approaches may work best for delimitation.
Asunto(s)
ADN Mitocondrial/genética , Genes Mitocondriales/genética , Haplotipos , Filogenia , Animales , ADN Mitocondrial/clasificación , Variación Genética , Humanos , Fenotipo , Reproducción/genética , Especificidad de la EspecieRESUMEN
The global economy of the international trade of herbal products has been increasing by 15% annually, with the raw material for most herbal products being sourced from South and Southeast Asian countries. In India, of the 8000 species of medicinal plants harvested from the wild, approximately 960 are in the active trade. With increasing international trade in herbal medicinal products, there is also increasing concern about the widespread adulteration and species admixtures in the raw herbal trade. The adverse consequences of such species adulteration on the health and safety of consumers have only recently begun to be recognised and documented. We provide a comprehensive review of the nature and magnitude of species adulteration in the raw herbal trade, and identify the underlying drivers that might lead to such adulteration. We also discuss the possible biological and chemical equivalence of species that are used as adulterants and substitutes, and the consequences thereof to consumer health and safety, and propose a framework for the development of a herbal trade authentication service that can help regulate the herbal trade market.
Asunto(s)
Seguridad de Productos para el Consumidor/normas , Contaminación de Medicamentos , Medicina de Hierbas/normas , Plantas Medicinales , Cromatografía Líquida de Alta Presión , Código de Barras del ADN Taxonómico , Humanos , India , Equivalencia TerapéuticaRESUMEN
Rohitukine, a chromone alkaloid, has gained considerable international attention in recent years because of its novel semi-synthetic derivative, flavopiridol and P-276-00. Both these molecules are in advanced stages of clinical development and trial for cancer treatment. Recently, flavopiridol was approved as an orphan drug for treatment of chronic lymphocytic leukemia cancer. The natural occurrence of rohitukine is restricted to only four plant species, Amoora rohituka and Dysoxylum binectariferum (both from the Meliaceae family) and from Schumanniophyton magnificum and Schumanniophyton problematicum (both from the Rubiaceae family). Recently, an endophytic fungi isolated from D. binectariferum was reported to produce rohitukine in culture. In this study, we report the production of rohitukine and its subsequent attenuation by endophytic fungi, Fusarium oxysporum (MTCC-11383), Fusarium oxysporum (MTCC-11384) and Fusarium solani (MTCC-11385), all isolated from D. binectariferum and Gibberella fujikuroi (MTCC-11382) isolated from Amoora rohituka. The fungal rohitukine which was analyzed by HPLC, LC-MS and LC-MS/MS was identical to reference rohitukine and that produced by the plant. The rohitukine content in the mycelial samples ranged from 192.78µg to 359.55µg100g(-1) of dry weight of and in broth it ranged from 14.10 to 71.90µg100ml(-1). In all the fungal cultures, the production declined from first to fourth sub-culture. Studies are underway to unravel the mechanism by which the fungi produce the host metabolite in culture.
Asunto(s)
Cromonas/metabolismo , Endófitos/metabolismo , Meliaceae/microbiología , Piperidinas/metabolismoRESUMEN
The Indian monsoons are a major seasonal climatic event over the Indian subcontinent, heralding the arrival of the wet season. Many features of life, biological and cultural, are intimately synchronized to this seasonality. In this paper, we show that the Indian monsoons might have played an important role in shaping the fruiting time and hence dispersal phenology of plant species in the subcontinent.
Asunto(s)
Clima , Fenómenos Fisiológicos de las Plantas , Lluvia , Cambio Climático , Ecosistema , Frutas , India , Modelos Estadísticos , Plantas , Estaciones del Año , ÁrbolesRESUMEN
Camptothecine (CPT), a quinoline alkaloid, is a potent inhibitor of eukaryotic topoisomerase I. Because of this activity, several semi-synthetic derivatives of CPT are in clinical use against ovarian and small lung cancers. Together with its derivatives, CPT is the third largest anti-cancer drug in the world market. CPT is produced by several plant species belonging to the Asterid clade. In the recent past, several studies have reported the production of CPT by endophytic fungal associates of some of these plant species. In this paper, we report the production of CPT by endophytic bacteria isolated from Miquelia dentata Bedd. (Icacinaceae). Besides CPT, the bacteria also produced 9-methoxy CPT (9-MeO-CPT), in culture, independent of the host tissue. The chemical nature of CPT and 9-MeO-CPT was determined by LC-MS and ESI-MS/MS analysis, and was shown to be similar to that produced by the host tissue. One of the bacterial isolates examined, showed indications of attenuation of CPT production through sub-culture. This is the first report of production of CPT by endophytic bacteria. The identity of the bacteria was ascertained by Gram staining and 16s rRNA sequencing. We discuss the possible mechanisms that might be involved in the synthesis of CPT by endophytic bacteria.
Asunto(s)
Antineoplásicos Fitogénicos/biosíntesis , Camptotecina/biosíntesis , Endófitos/aislamiento & purificación , Magnoliopsida/microbiología , Camptotecina/aislamiento & purificación , Endófitos/química , Endófitos/metabolismoRESUMEN
In this study, the production of camptothecine and its derivatives, in thirteen species of the family Icacinaceae, namely, Apodytes dimidiata, Codiocarpus andamanicus, Gomphandra comosa, Gomphandra coriacea, Gomphandra polymorpha, Gomphandra tetrandra, Iodes cirrhosa, Iodes hookeriana, Miquelia dentata, Miquelia kleinii, Natsiatum herpeticum, Pyrenacantha volubilis and Sarcostigma kleinii is reported. Seeds of M. dentata were found to produce the highest content of camptothecine (1.0-1.4% by dry weight of seeds). Full scan LC-MS and ESI-MS/MS analysis of M. dentata revealed, besides camptothecine, a number of other derivatives, namely, 10-hydroxycamptothecine, 9-methoxycamptothecine, 20-deoxycamptothecine. Crude extract preparations of the seeds of M. dentata were effective against a breast cancer cell line (IC50=3.82 µg/ml for MDA MB273 cell lines) and two ovarian cancer cell lines (IC50=2.8 µg/ml for NCI/ADR-RES and 4.5 µg/ml for SKOV). These results are the first reports of camptothecine and its derivatives in these species and offer rich alternative plant sources for the anticancer compound, camptothecine.
Asunto(s)
Antineoplásicos Fitogénicos/uso terapéutico , Neoplasias de la Mama/tratamiento farmacológico , Camptotecina/uso terapéutico , Magnoliopsida/química , Neoplasias Ováricas/tratamiento farmacológico , Fitoterapia , Extractos Vegetales/uso terapéutico , Camptotecina/análogos & derivados , Camptotecina/análisis , Línea Celular Tumoral , Femenino , Humanos , SemillasRESUMEN
The styles of flowers may represent an arena for pollen competition in the race to fertilize ovules. Accordingly, selection should favour a longer 'race' to better discriminate among variable pollen by increasing style length. Sampling across a taxonomically diverse range of wild and outcrossed species, we found that the distribution of style lengths within plants were skewed towards longer styles, as predicted. In self-pollinated domesticated species, where discrimination among pollen is less important, we found no such pattern. We conclude that style length is under directional selection towards longer styles as a mechanism for mate choice among pollen of variable quality.
Asunto(s)
Flores/fisiología , Plantas , Polinización , Selección GenéticaRESUMEN
Biological diversity and its constituent chemical diversity have served as one of the richest sources of bioprospecting leading to the discovery of some of the most important bioactive molecules for mankind. Despite this excellent record, in the recent past, however, bioprospecting of biological resources has met with little success; there has been a perceptible decline in the discovery of novel bioactive compounds. Several arguments have been proposed to explain the current poor success in bioprospecting. Among them, it has been argued that to bioprospect more biodiversity may not necessarily be productive, considering that chemical and functional diversity might not scale with biological diversity. In this paper, we offer a critique on the current perception of biodiversity and chemodiversity and ask to what extent it is relevant in the context of bioprospecting. First, using simple models, we analyze the relation among biodiversity, chemodiversity and functional redundancies in chemical plans of plants and argue that the biological space for exploration might still be wide open. Second, in the context of future bioprospecting, we argue that brute-force high throughput screening approaches alone are insufficient and cost ineffective in realizing bioprospecting success. Therefore, intelligent or non-random approaches to bioprospecting need to be adopted. We review here few examples of such approaches and show how these could be further developed and used in the future to accelerate the pace of discovery.
Asunto(s)
Biodiversidad , FilogeniaRESUMEN
Camptothecin (CPT), a monoterpene indole alkaloid, is a potent inhibitor of eukaryotic toposiomerase-I. Several derivatives of CPT are in clinical use against ovarian and lung cancers. CPT has been reported from several plant species belonging to the order Asterids, with the highest concentration in Nothapodytes nimmoniana (family Icacinaceae). In this paper, we report an intriguing observation of chrysomelid beetles (Kanarella unicolor Jacobby) feeding on the leaves of N. nimmoniana without any apparent adverse effect. LC-MS/MS analysis of the beetles indicated that 54.9% of the ingested CPT's was recovered from the wings, followed by lesser amounts in the head and abdomen. LC-HRMS analysis revealed that most of the CPT in the insect body was in the parental form available in the plants without any major metabolizable products, including sulfated and glucuronilated forms. The mechanism by which the beetles are able to tolerate substantially high levels of CPT in their body tissue is under investigation.
Asunto(s)
Antineoplásicos Fitogénicos/metabolismo , Camptotecina/metabolismo , Escarabajos/metabolismo , Magnoliopsida/metabolismo , Magnoliopsida/parasitología , Animales , Hojas de la Planta/metabolismo , Hojas de la Planta/parasitologíaRESUMEN
ETHNOPHARMACOLOGICAL RELEVANCE: Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. AIM OF THE STUDY: To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. MATERIALS AND METHODS: Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF - GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR - CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. RESULTS: Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. CONCLUSION: Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.
Asunto(s)
ADN de Cloroplastos/aislamiento & purificación , Procesamiento Automatizado de Datos , Phyllanthus/genética , Extractos Vegetales/química , Análisis de Secuencia de ADN , India , Medicina Tradicional , Phyllanthus/clasificación , Filogenia , Extractos Vegetales/normas , Reacción en Cadena de la Polimerasa , Control de Calidad , Especificidad de la EspecieRESUMEN
This article documents the addition of 411 microsatellite marker loci and 15 pairs of Single Nucleotide Polymorphism (SNP) sequencing primers to the Molecular Ecology Resources Database. Loci were developed for the following species: Acanthopagrus schlegeli, Anopheles lesteri, Aspergillus clavatus, Aspergillus flavus, Aspergillus fumigatus, Aspergillus oryzae, Aspergillus terreus, Branchiostoma japonicum, Branchiostoma belcheri, Colias behrii, Coryphopterus personatus, Cynogolssus semilaevis, Cynoglossus semilaevis, Dendrobium officinale, Dendrobium officinale, Dysoxylum malabaricum, Metrioptera roeselii, Myrmeciza exsul, Ochotona thibetana, Neosartorya fischeri, Nothofagus pumilio, Onychodactylus fischeri, Phoenicopterus roseus, Salvia officinalis L., Scylla paramamosain, Silene latifo, Sula sula, and Vulpes vulpes. These loci were cross-tested on the following species: Aspergillus giganteus, Colias pelidne, Colias interior, Colias meadii, Colias eurytheme, Coryphopterus lipernes, Coryphopterus glaucofrenum, Coryphopterus eidolon, Gnatholepis thompsoni, Elacatinus evelynae, Dendrobium loddigesii Dendrobium devonianum, Dysoxylum binectariferum, Nothofagus antarctica, Nothofagus dombeyii, Nothofagus nervosa, Nothofagus obliqua, Sula nebouxii, and Sula variegata. This article also documents the addition of 39 sequencing primer pairs and 15 allele specific primers or probes for Paralithodes camtschaticus.
RESUMEN
This article documents the addition of 396 microsatellite marker loci to the Molecular Ecology Resources Database. Loci were developed for the following species: Anthocidaris crassispina, Aphis glycines, Argyrosomus regius, Astrocaryum sciophilum, Dasypus novemcinctus, Delomys sublineatus, Dermatemys mawii, Fundulus heteroclitus, Homalaspis plana, Jumellea rossii, Khaya senegalensis, Mugil cephalus, Neoceratitis cyanescens, Phalacrocorax aristotelis, Phytophthora infestans, Piper cordulatum, Pterocarpus indicus, Rana dalmatina, Rosa pulverulenta, Saxifraga oppositifolia, Scomber colias, Semecarpus kathalekanensis, Stichopus monotuberculatus, Striga hermonthica, Tarentola boettgeri and Thermophis baileyi. These loci were cross-tested on the following species: Aphis gossypii, Sooretamys angouya, Euryoryzomys russatus, Fundulus notatus, Fundulus olivaceus, Fundulus catenatus, Fundulus majalis, Jumellea fragrans, Jumellea triquetra Jumellea recta, Jumellea stenophylla, Liza richardsonii, Piper marginatum, Piper aequale, Piper darienensis, Piper dilatatum, Rana temporaria, Rana iberica, Rana pyrenaica, Semecarpus anacardium, Semecarpus auriculata, Semecarpus travancorica, Spondias acuminata, Holigarna grahamii, Holigarna beddomii, Mangifera indica, Anacardium occidentale, Tarentola delalandii, Tarentola caboverdianus and Thermophis zhaoermii.
RESUMEN
Nothapodytes nimmoniana is a medicinally important tree species that occur in the Western Ghats, a megadiversity hotspot in southern India. Inner stem bark of the tree contains an important anti-cancer alkaloid, camptothecin for which the natural population of the tree is heavily harvested. In this paper, we report the isolation and characterization of eight polymorphic microsatellite loci using enrichment hybridization protocol. Analysis of 36 individuals representing two populations revealed three to 12 alleles per locus. Observed heterozygosity ranged from 0.21 to 0.94 for the two populations. None of the loci tested showed linkage disequilibrium. These markers are invaluable for evaluating the genetic structure and assessing the genetic impacts of harvesting of N. nimmoniana in the Western Ghats to formulate strategies for conservation of the species.
RESUMEN
Camptothecin (CPT), a monoterpene alkaloid, is an important anti-cancer compound obtained from several plant sources including Camptotheca acuminta (from China) and Nothapodytes nimmoniana (from India). Currently, by far the highest levels of CPT (approximately 0.3% w/w) are reported from Nothapodytes nimmoniana, a small tree distributed in the Western Ghats, India. In recent years because of the heavy demand, there has been a serious threat of extinction of the populations of the tree in the Western Ghats forest of south India. Several studies have chemically profiled populations of the species in the Western Ghats to identify sources of high yield and therefore to enable the sustainable production and harvesting of CPT. In this study, using both high-performance liquid chromatography and liquid chromatography-mass spectrometry, we report for the first time the identification of trees that produce at least 5- to 8-fold more CPT than hitherto reported. Furthermore, we show for the first time the production of a few minor camptothecines, including 10-hydroxy camptothecin, in the stem and root bark extracts of the tree. These results have important implications for not only harnessing the high-yielding individuals for clonal multiplication but also for exploiting some of the minor camptothecines, which also have been shown to have important anti-cancer and anti-viral activity.
Asunto(s)
Alcaloides/aislamiento & purificación , Camptotecina/aislamiento & purificación , Magnoliopsida/química , Cromatografía Líquida de Alta Presión/métodos , Espectrometría de Masas/métodos , Corteza de la Planta/química , Raíces de Plantas/química , Tallos de la Planta/químicaRESUMEN
Even since Linnaeus,naturalists and taxonomists have been systematically describing species new to science. Besides indicating gaps in taxonomic effort, understanding the temporal patterns of species discovery could help in identifying drivers that determine discovery. In this study we report the patterns of discovery of eight taxa--birds, butterflies, frogs, tiger beetles, grasses, asters, ferns and orchids--in the Western Ghats, a megadiversity centre in India. Our results indicate that the discovery curves for birds and butter flies have been saturated while those for frogs and grasses continue to increase. Within each taxon, the major drivers of discovery were commonness of the species and their size. The average years taken for discovery across taxa were directly related to the per cent endemicity and species richness of the taxa. We discuss the trajectories of discovery with respect to rarity or endemicity of the species and life history features, and the implications these might have for strategizing the discovery process in India.
Asunto(s)
Especificidad de la Especie , Animales , IndiaRESUMEN
Given the increasing anthropogenic pressures on forests, the various protected areas--national parks, sanctuaries, and biosphere reserves--serve as the last footholds for conserving biological diversity. However, because protected areas are often targeted for the conservation of selected species, particularly charismatic animals, concerns have been raised about their effectiveness in conserving nontarget taxa and their genetic resources. In this paper, we evaluate whether protected areas can serve as refugia for genetic resources of economically important plants that are threatened due to extraction pressures. We examine the population structure and genetic diversity of an economically important rattan, Calamus thwaitesii, in the core, buffer and peripheral regions of three protected areas in the central Western Ghats, southern India. Our results indicate that in all the three protected areas, the core and buffer regions maintain a better population structure, as well as higher genetic diversity, than the peripheral regions of the protected area. Thus, despite the escalating pressures of extraction, the protected areas are effective in conserving the genetic resources of rattan. These results underscore the importance of protected areas in conservation of nontarget species and emphasize the need to further strengthen the protected-area network to offer refugia for economically important plant species.
Asunto(s)
Calamus/genética , Conservación de los Recursos Naturales , ADN de Plantas/genética , ADN de Plantas/aislamiento & purificación , Variación Genética , Geografía , IndiaRESUMEN
Dalbergia sissoo, a wind-dispersed tropical tree, exhibits high intrafruit seed abortion. Of the four to five ovules in the flower, generally one and occasionally two or three develop to maturity. It has been proposed that the seed abortion is a consequence of intense sibling competition for maternal resources and that this competition occurs as an inverse function of the genetic relatedness among the developing seeds. Accordingly, developing seeds compete intensely when they are genetically less related but tend to develop together when genetically more related. We tested this hypothesis by comparing the genetic similarity among the pairs of seeds developing within a pod with that among (a) random pairs from the pool of all seeds, (b) random pairs from single-seeded pods, and (c) random pairs from two-seeded pods, using both randomly amplified polymorphic DNA (RAPD) and isozymes in five trees. We found that the pairs of seeds developing within a pod are genetically more similar than any random pairs of seeds in a tree. Thus the formation of two-seeded pods appear to be associated with increased genetic relatedness among the developing seeds. We discuss the results in the context of possible fitness advantages and then discuss the possible mechanisms that promote tolerance among related seeds.
RESUMEN
In Pongamia pinnata only one of the two ovules develops into a seed in most of the pods. Since pollen was not found to be limiting and reduced fertilization could not completely explain the observed frequency of seed abortion, it implied an effect of postfertilization factors. Aqueous extracts of developing seeds and maternal tissue (placenta) did not influence abortion in vitro, suggesting that abortion may not be mediated by a chemical. Experimental uptake of (14)C sucrose in vitro indicated that both the stigmatic and the peduncular seed have similar inherent capacities of drawing resources, but the peduncular seed is deprived of resources in the presence of the stigmatic seed. This deprivation of the peduncular seed could be offset by supplying an excess of hormones leading to the subsequent formation of two seeds in a pod. The prevalence of single-seeded pods in P. pinnata seems therefore to be a result of competition between the two seeds for maternal resources. The evolutionary significance of single-seeded pods in P. pinnata is discussed with respect to possible dispersal advantage enjoyed by such pods.