First Vanilla planifolia High-Density Genetic Linkage Map Provides Quantitative Trait Loci for Resistance to Fusarium oxysporum.

Fusarium oxysporum f. sp. radicis-vanillae (Forv), the causal agent of root and stem rot disease, is the main pathogen affecting vanilla production. Sources of resistance have been reported in Vanilla planifolia G. Jackson ex Andrews, the main cultivated vanilla species. In this study, we developed the first high-density genetic map in this species with 1,804 genotyping-by-sequencing (GBS)-generated single nucleotide polymorphism (SNP) markers using 125 selfed progenies of the CR0040 traditional vanilla cultivar. Sixteen linkage groups (LG) were successfully constructed, with a mean of 113 SNPs and an average length of 207 cM per LG. The map had a high density with an average of 5.45 SNP every 10 cM and an average distance of 1.85 cM between adjacent markers. The first three LG were aligned against the first assembled chromosome of CR0040, and the other 13 LG were correctly associated with the other 13 assembled chromosomes. The population was challenged with the highly pathogenic Forv strain Fo072 using the root-dip inoculation method. Five traits were mapped, and 20 QTLs were associated with resistance to Fo072. Among the genes retrieved in the CR0040 physical regions associated with QTLs, genes potentially involved in biotic resistance mechanisms, coding for kinases, E3 ubiquitin ligases, pentatricopeptide repeat-containing proteins, and one leucine-rich repeat receptor underlying the qFo72_08.1 QTL have been highlighted. This study should provide useful resources for marker-assisted selection in V. planifolia.

First report of Odontoglossum ringspot virus in Vanilla (Orchidaceae) in Madagascar.

Vanilla (Vanilla planifolia, Orchidaceae) is Madagascar's leading agricultural export resource which provides 80% of world's consumption. During a phytosanitary survey conducted from November 2019 to March 2021 in the main vanilla production regions of Madagascar, 250 plots were indexed for cymbidium mosaic virus (CymMV, Potexvirus genus) and odontoglossum ringspot virus (ORSV, Tobamovirus genus) the two most prevalent viruses of cultivated orchids worldwide (Zettler et al., 1990). For each plot, bulk samples (ten leaves taken at random) were assayed using Immunostrips (AGDIA, ISK 13301). A quarter of the plots (63/250) tested positive for CymMV. The highest prevalence of CymMV was observed in the SAVA region (57 out of 153 plots = 37,2%) where the virus has been reported since 1997 (Grisoni et al., 2010). Six plots located in the district of Mahanoro (Atsinanana) tested positive for ORSV. A few plants in these plots showed chlorotic often annular spots on their leaves. They were individually tested positive for ORSV, and negative for CymMV and potyviruses (Immunostrips AGDIA ISK 27200), the other two viruses reported so far in vanilla in Madagascar. To confirm the diagnosis of ORSV, leaf samples from five of the six infected plots were analysed by Tube Capture-RT-PCR (Grisoni et al., 2017) using two pairs of primers flanking the ORSV coat protein (CP) gene: OrCP1 (GGTCGGTAATGGTGTTAG) / OrCP2 (TGCATTATCGTATGCTCC), and CPOR-F(ATGTCTTACACTATTACAGACC) / CPOR-R(TTAGGAAGAGGTCCAAGTAAG). The five samples gave amplicons of the expected size (820 nt and 476 nt, respectively) and were sequenced with Sanger technology (Macrogen, The Netherlands). The ORSV-CP sequences of the Mahanoro isolates showed very close similarity to 198 ORSV-CP sequences from GenBank (95.8% to 99.6% nucleotide and 94.5 to 100% amino-acid identities), and less than 75.4% nucleotide (80.1% amino-acid) identities with Bell pepper mosaic virus (DQ355023), the tobamovirus closest to ORSV. The five ORSV-CP sequences from vanilla were deposited in GenBank under accessions numbers OM847399 to OM847403. These data confirmed that ORSV infects vanilla vines in Madagascar. To our knowledge, this is the first report of this virus in Madagascar and of its ability to infect symptomatically V. planifolia. The five ORSV isolates from vanilla had more than 98.7 % nucleotide identities of CP gene and clustered into a monophyletic group in maximum likelihood phylogenetic tree, suggesting a single origin of these isolates. To further investigate the origin of ORSV in Madagascar, we made use of RNA sequences isolated at different points in time to infer the timing of evolutionary events (Rieux et al., 2016). We estimated the CP gene substitution rate to 4.8E-4 subst/site/year [95%HPD 2.1E-4 - 8.7E-4] which is close to the estimate of He et al. (2019) based on a slightly different sequences set (1.25E-3 subst/site/year). We dated the initial contamination of vanilla plts by ORSV between 2004 and 2013. Both ORSV and CymMV have deleterious effects on many ornamental orchids, and the pathogenicity of CymMV is exacerbated when co-infecting with ORSV (Lee et al., 2021). Therefore, ORSV represents a new threat to the Malagasy vanilla crop, especially in regions where CymMV is already rife. Given the economic importance of vanilla cultivation in the country, the implementation of prophylactic measures aimed at preventing the spread of ORSV, in particular through the sanitary control of cuttings, should be a priority for the vanilla industry.

Tannin phenotyping of the Vitaceae reveals a phylogenetic linkage of epigallocatechin in berries and leaves.

BACKGROUND AND AIMS: Condensed tannins, responsible for berry and wine astringency, may have been selected during grapevine domestication. This work examines the phylogenetic distribution of condensed tannins throughout the Vitaceae phylogenetic tree. METHODS: Green berries and mature leaves of representative true-to-type members of the Vitaceae were collected before 'véraison', freeze-dried and pulverized, and condensed tannins were measured following depolymerization by nucleophilic addition of 2-mercaptoethanol to the C4 of the flavan-3-ol units in an organic acidic medium. Reaction products were separated and quantified by ultrahigh pressure liquid chromatography/diode array detection/mass spectrometry. KEY RESULTS AND CONCLUSIONS: The original ability to incorporate epigallocatechin (EGC) into grapevine condensed tannins was lost independently in both the American and Eurasian/Asian branches of the Vitaceae, with exceptional cases of reversion to the ancestral EGC phenotype. This is particularly true in the genus Vitis, where we now find two radically distinct groups differing with respect to EGC content. While Vitis species from Asia are void of EGC, 50 % of the New World Vitis harbour EGC. Interestingly, the presence of EGC is tightly coupled with the degree of leaf margin serration. Noticeably, the rare Asian EGC-forming species are phylogenetically close to Vitis vinifera, the only remnant representative of Vitis in Eurasia. Both the wild ancestral V. vinifera subsp. sylvestris as well as the domesticated V. vinifera subsp. sativa can accumulate EGC and activate galloylation biosynthesis that compete for photoassimilates and reductive power.

A chromosome-level, haplotype-phased Vanilla planifolia genome highlights the challenge of partial endoreplication for accurate whole-genome assembly.

Vanilla planifolia, the species cultivated to produce one of the world's most popular flavors, is highly prone to partial genome endoreplication, which leads to highly unbalanced DNA content in cells. We report here the first molecular evidence of partial endoreplication at the chromosome scale by the assembly and annotation of an accurate haplotype-phased genome of V. planifolia. Cytogenetic data demonstrated that the diploid genome size is 4.09 Gb, with 16 chromosome pairs, although aneuploid cells are frequently observed. Using PacBio HiFi and optical mapping, we assembled and phased a diploid genome of 3.4 Gb with a scaffold N50 of 1.2 Mb and 59 128 predicted protein-coding genes. The atypical k-mer frequencies and the uneven sequencing depth observed agreed with our expectation of unbalanced genome representation. Sixty-seven percent of the genes were scattered over only 30% of the genome, putatively linking gene-rich regions and the endoreplication phenomenon. By contrast, low-coverage regions (non-endoreplicated) were rich in repeated elements but also contained 33% of the annotated genes. Furthermore, this assembly showed distinct haplotype-specific sequencing depth variation patterns, suggesting complex molecular regulation of endoreplication along the chromosomes. This high-quality, anchored assembly represents 83% of the estimated V. planifolia genome. It provides a significant step toward the elucidation of this complex genome. To support post-genomics efforts, we developed the Vanilla Genome Hub, a user-friendly integrated web portal that enables centralized access to high-throughput genomic and other omics data and interoperable use of bioinformatics tools.

Drivers of population divergence and species differentiation in a recent group of indigenous orchids (Vanilla spp.) in Madagascar.

With over 25,000 species, orchids are among families with remarkable high rate of diversification. Since Darwin's time, major advances attributed the exceptional diversity of orchids to plant-pollinator interactions. However, unraveling the processes and factors that determine the phenotypic and genotypic variation of natural orchid populations remains a challenge. Here, we assessed genetic population structure and floral differentiation in recently diverged leafless Vanilla species in a world biodiversity hotspot, Madagascar, using seven microsatellite loci and 26 morphometric variables. Additionally, analyses were performed to test for the occurrence of any patterns of isolation by distance, isolation by environment, and isolation by adaptation and to detect possible physical barriers that might have caused genetic discontinuities between populations. Positive inbreeding coefficients detected in 22 populations were probably due to the presence of null alleles, geitonogamy and/or some admixture (sympatric species). In contrast, the only high-altitude population showed an important rate of clonality leading to heterozygote excess. Genetic diversity was maximum in western populations, suggesting a postglacial colonization to the north and south. Clustering analyses identified seven genetic groups characterized by specific floral traits that matched five botanical descriptions in the literature. A contribution of montane refugia and river barriers on population differentiation was detected. We also detected combined effects of IBD/IBE and IBE/IBA on genetic differentiation and suggested this pattern is more likely determined by ecological isolation, although pollinator-mediated divergent selection could not be ruled out for some of the species. Overall, this study provides further insights on speciation in orchids, a group for which Madagascar shows one of the world's highest level of endemism and confirms the importance of the peculiar biogeography of the island in shaping species differentiation.

Plant DNA Barcoding Principles and Limits: A Case Study in the Genus Vanilla.

Powerful DNA barcodes have been much more difficult to define in plants than in animals. In 2009, the international Consortium for the Barcoding Of Life (CBOL) chose the combination of the chloroplast genes (rbcL + matK) as the proposed official barcode for plants. However, this system has got important limits. First, any barcode system will only be useful if there is a clear barcode gap and if species are monophyletic. Second, chloroplast and mitochondrial (COI gene used for animals) barcodes will not be usable for discriminating hybrid species. Moreover, it was also shown that, using chloroplast regions, maximum species discrimination would be around 70% and very variable among plant groups. This is why many authors have more recently advocated for the addition of the nuclear ITS region to this barcode because it reveals more variations and allows the resolution of hybrid or closely related species. We tested different chloroplast genes (rbcL, matK, psaB, psbC) and the nuclear ITS region in the genus Vanilla, a taxonomically complex group and therefore a good model to test for the efficiency of different barcode systems. We found that the CBOL official barcode system performed relatively poorly in Vanilla (76% species discrimination), and we demonstrate that adding ITS to this barcode system allows to increase resolution (for closely related species and to the subspecies level) and to identify hybrid species. The best species discrimination attained was 96.2% because of one paraphyletic species that could not be resolved.

The Intracellular Localization of the Vanillin Biosynthetic Machinery in Pods of Vanilla planifolia.

Vanillin is the most important flavor compound in the vanilla pod. Vanilla planifolia vanillin synthase (VpVAN) catalyzes the conversion of ferulic acid and ferulic acid glucoside into vanillin and vanillin glucoside, respectively. Desorption electrospray ionization mass spectrometry imaging (DESI-MSI) of vanilla pod sections demonstrates that vanillin glucoside is preferentially localized within the mesocarp and placental laminae whereas vanillin is preferentially localized within the mesocarp. VpVAN is present as the mature form (25 kDa) but, depending on the tissue and isolation procedure, small amounts of the immature unprocessed form (40 kDa) and putative oligomers (50, 75 and 100 kDa) may be observed by immunoblotting using an antibody specific to the C-terminal sequence of VpVAN. The VpVAN protein is localized within chloroplasts and re-differentiated chloroplasts termed phenyloplasts, as monitored during the process of pod development. Isolated chloroplasts were shown to convert [14C]phenylalanine and [14C]cinnamic acid into [14C]vanillin glucoside, indicating that the entire vanillin de novo biosynthetic machinery converting phenylalanine to vanillin glucoside is present in the chloroplast.

Two novel Alphaflexiviridae members revealed by deep sequencing of the Vanilla (Orchidaceae) virome.

The genomes of two novel viruses were assembled from 454 pyrosequencing data obtained from vanilla leaves from La Réunion. Based on genome organization and homologies, one agent was unambiguously classified as a member of the genus Potexvirus and named vanilla virus X (VVX). The second one, vanilla latent virus (VLV), is phylogenetically close to three unclassified members of the family Alphaflexiviridae with similarity to allexiviruses, and despite the presence of an additional 8-kDa open reading frame, we propose to include VLV as a new member of the genus Allexivirus. Both VVX and VLV were mechanically transmitted to vanilla plants, resulting in asymptomatic infections.

Fungal endophytes of Vanilla planifolia across Réunion Island: isolation, distribution and biotransformation.

BACKGROUND: The objective of the work was to characterize fungal endophytes from aerial parts of Vanilla planifolia. Also, to establish their biotransformation abilities of flavor-related metabolites. This was done in order to find a potential role of endophytes on vanilla flavors. RESULTS: Twenty three MOTUs were obtained, representing 6 fungal classes. Fungi from green pods were cultured on mature green pod based media for 30 days followed by (1)H NMR and HPLC-DAD analysis. All fungi from pods consumed metabolized vanilla flavor phenolics. Though Fusarium proliferatum was recovered more often (37.6% of the isolates), it is Pestalotiopsis microspora (3.0%) that increased the absolute amounts (quantified by (1)H NMR in µmol/g DW green pods) of vanillin (37.0 × 10(-3)), vanillyl alcohol (100.0 × 10(-3)), vanillic acid (9.2 × 10(-3)) and p-hydroxybenzoic acid (87.9 × 10(-3)) by significant amounts. CONCLUSIONS: All plants studied contained endophytic fungi and the isolation of the endophytes was conducted from plant organs at nine sites in Réunion Island including under shade house and undergrowth conditions. Endophytic variation occured between cultivation practices and the type of organ. Given the physical proximity of fungi inside pods, endophytic biotransformation may contribute to the complexity of vanilla flavors.

Differential Responses of Vanilla Accessions to Root Rot and Colonization by Fusarium oxysporum f. sp. radicis-vanillae.

Root and stem rot (RSR) disease caused by Fusarium oxysporum f. sp. radicis-vanillae (Forv) is the most damaging disease of vanilla (Vanilla planifolia and V. × tahitensis, Orchidaceae). Breeding programs aimed at developing resistant vanilla varieties are hampered by the scarcity of sources of resistance to RSR and insufficient knowledge about the histopathology of Forv. In this work we have (i) identified new genetic resources resistant to RSR including V. planifolia inbreds and vanilla relatives, (ii) thoroughly described the colonization pattern of Forv into selected vanilla accessions, confirming its necrotic non-vascular behavior in roots, and (iii) evidenced the key role played by hypodermis, and particularly lignin deposition onto hypodermal cell walls, for resistance to Forv in two highly resistant vanilla accessions. Two hundred and fifty-four vanilla accessions were evaluated in the field under natural conditions of infection and in controlled conditions using in vitro plants root-dip inoculated by the highly pathogenic isolate Fo072. For the 26 accessions evaluated in both conditions, a high correlation was observed between field evaluation and in vitro assay. The root infection process and plant response of one susceptible and two resistant accessions challenged with Fo072 were studied using wide field and multiphoton microscopy. In susceptible V. planifolia, hyphae penetrated directly into the rhizodermis in the hairy root region then invaded the cortex through the passage cells where it induced plasmolysis, but never reached the vascular region. In the case of the resistant accessions, the penetration was stopped at the hypodermal layer. Anatomical and histochemical observations coupled with spectral analysis of the hypodermis suggested the role of lignin deposition in the resistance to Forv. The thickness of lignin constitutively deposited onto outer cell walls of hypodermis was highly correlated with the level of resistance for 21 accessions tested. The accumulation of p-coumaric and sinapic acids, two phenolic precursors of lignin, was observed in the resistant plants inoculated with Fo072, but not in the susceptible one. Altogether, our analyses enlightened the mechanisms at work in RSR resistant genotypes and should enhance the development of novel breeding strategies aimed at improving the genetic control of RSR of vanilla.

Vanillin formation from ferulic acid in Vanilla planifolia is catalysed by a single enzyme.

Vanillin is a popular and valuable flavour compound. It is the key constituent of the natural vanilla flavour obtained from cured vanilla pods. Here we show that a single hydratase/lyase type enzyme designated vanillin synthase (VpVAN) catalyses direct conversion of ferulic acid and its glucoside into vanillin and its glucoside, respectively. The enzyme shows high sequence similarity to cysteine proteinases and is specific to the substitution pattern at the aromatic ring and does not metabolize caffeic acid and p-coumaric acid as demonstrated by coupled transcription/translation assays. VpVAN localizes to the inner part of the vanilla pod and high transcript levels are found in single cells located a few cell layers from the inner epidermis. Transient expression of VpVAN in tobacco and stable expression in barley in combination with the action of endogenous alcohol dehydrogenases and UDP-glucosyltransferases result in vanillyl alcohol glucoside formation from endogenous ferulic acid. A gene encoding an enzyme showing 71% sequence identity to VpVAN was identified in another vanillin-producing plant species Glechoma hederacea and was also shown to be a vanillin synthase as demonstrated by transient expression in tobacco.

Phenol homeostasis is ensured in vanilla fruit by storage under solid form in a new chloroplast-derived organelle, the phenyloplast.

A multiple cell imaging approach combining immunofluorescence by confocal microscopy, fluorescence spectral analysis by multiphotonic microscopy, and transmission electron microscopy identified the site of accumulation of 4-O-(3-methoxybenzaldehyde) ß-d-glucoside, a phenol glucoside massively stockpiled by vanilla fruit. The glucoside is sufficiently abundant to be detected by spectral analysis of its autofluorescence. The convergent results obtained by these different techniques demonstrated that the phenol glucoside accumulates in the inner volume of redifferentiating chloroplasts as solid amorphous deposits, thus ensuring phenylglucoside cell homeostasis. Redifferentiation starts with the generation of loculi between thylakoid membranes which are progressively filled with the glucoside until a fully matured organelle is obtained. This peculiar mode of storage of a phenolic secondary metabolite is suspected to occur in other plants and its generalization in the Plantae could be considered. This new chloroplast-derived organelle is referred to as a 'phenyloplast'.

Metabolome of Vanilla planifolia (Orchidaceae) and related species under Cymbidium mosaic virus (CymMV) infection.

The genus Vanilla which belongs to the Orchidaceae family comprises more than 110 species of which two are commercially cultivated (Vanilla planifolia and Vanilla xtahitensis). The cured pods of these species are the source of natural vanilla flavor. In intensive cultivation systems the vines are threatened by viruses such as Cymbidium mosaic virus (CymMV). In order to investigate the effect of CymMV on the growth and metabolome of vanilla plants, four accessions grown in intensive cultivation systems under shadehouse, CR01 (V. planifolia), CR17 (V. xtahitensis), CR03 (V. planifolia × V. xtahitensis) and CR18 (Vanilla pompona), were challenged with an isolate of CymMV. CymMV infected plants of CR01, CR03 and CR17 had a reduced growth compared to healthy plants, while there was no significant difference in the growth of CR18 vines. Interestingly, CR18 had qualitatively more phenolic compounds in leaves and a virus titre that diminished over time. No differences in the metabolomic profiles of the shadehouse samples obtained by nuclear magnetic resonance (NMR) were observed between the virus infected vs. healthy plants. However, using in- vitro V. planifolia plants, the metabolomic profiles were affected by virus infection. Under these controlled conditions the levels of amino acids and sugars present in the leaves were increased in CymMV infected plants, compared to uninfected ones, whereas the levels of phenolic compounds and malic acid were decreased. The metabolism, growth and viral status of V. pompona accession CR18 contrasted from that of the other species suggesting the existence of partial resistance to CymMV in the vanilla germplasm.

Evidence of transoceanic dispersion of the genus Vanilla based on plastid DNA phylogenetic analysis.

The phylogeny and the biogeographical history of the genus Vanilla was investigated using four chloroplastic genes (psbB, psbC; psaB and rbcL), on 47 accessions of Vanilla chosen from the ex situ CIRAD collection maintained in Reunion Island and additional sequences from GenBank. Bayesian methods provided a fairly well supported reconstruction of the phylogeny of the Vanilloideae sub-family and more particularly of the genus Vanilla. Three major phylogenetic groups in the genus Vanilla were differentiated, which is in disagreement with the actual classification in two sections (Foliosae and Aphyllae) based on morphological traits. Recent Bayesian relaxed molecular clock methods allowed to test the two main hypotheses of the phylogeography of the genus Vanilla. Early radiation of the Vanilla genus and diversification by vicariance consecutive to the break-up of Gondwana, 95 million years ago (Mya), was incompatible with the admitted age of origin of Angiosperm. Based on the Vanilloideae age recently estimated to 71 million years ago (Mya), we conclude that the genus Vanilla would have appeared approximately 34 Mya in South America, when continents were already separated. Nevertheless, whatever the two extreme scenarios tested, at least three long distance migration events are needed to explain the present distribution of Vanilla species in tropical areas. These transoceanic dispersions could have occurred via transoceanic passageway such as the Rio Grande Ridge and the involvement of floating vegetation mats and migratory birds.

Variation in intron length in caffeic acid O-methyltransferase (COMT) in Vanilla species (Orchidaceae).

Variation in intron length in caffeic acid O-methyltransferase (COMT) in Vanilla was studied and demonstrated that COMT genes in Vanilla are organized with four exons and three introns. At least two to four different versions (either allelic or paralogous) of the COMT multigenic family in the genus Vanilla (in terms of intron sizes) were detected. The three introns were differentially variable, with intron-1 being the most length-polymorphic. Patterns of variations were in accordance with known phylogenetic relationships in the genus obtained with neutral markers. In particular, the genus displayed a strong Old World versus New World differentiation with American fragrant species being characterized by a specific 99bp intron-1 size-variant and a unique 226bp intron-3 variant. Conversely, leafless species of the genus displayed unexpected variations in intron lengths. Due to their role in primary (lignin) and secondary (phenolics, e.g., vanillin, alkaloids) metabolisms, COMT genes might not be neutral markers, and represent candidate functional markers for resistance, aromatic or medicinal properties of Vanilla species. Investigating the orthologous/paralogous status of the different genes revealed (in terms of intron size) will allow the evolution of the COMT genes to be studied.

Natural polyploidy in Vanilla planifolia (Orchidaceae).

Vanilla planifolia accessions cultivated in Reunion Island display important phenotypic variation, but little genetic diversity is demonstrated by AFLP and SSR markers. This study, based on analyses of flow cytometry data, Feulgen microdensitometry data, chromosome counts, and stomatal length measurements, was performed to determine whether polyploidy could be responsible for some of the intraspecific phenotypic variation observed. Vanilla planifolia exhibited an important variation in somatic chromosome number in root cells, as well as endoreplication as revealed by flow cytometry. Nevertheless, the 2C-values of the 50 accessions studied segregated into three distinct groups averaging 5.03 pg (for most accessions), 7.67 pg (for the 'Stérile' phenotypes), and 10.00 pg (for the 'Grosse Vanille' phenotypes). For the three groups, chromosome numbers varied from 16 to 32, 16 to 38, and 22 to 54 chromosomes per cell, respectively. The stomatal length showed a significant variation from 37.75 microm to 48.25 microm. Given that 2C-values, mean chromosome numbers, and stomatal lengths were positively correlated and that 'Stérile' and 'Grosse Vanille' accessions were indistinguishable from 'Classique' accessions using molecular markers, the occurrence of recent autotriploid and autotetraploid types in Reunion Island is supported. This is the first report showing evidence of a recent autopolyploidy in V. planifolia contributing to the phenotypic variation observed in this species.

Patterns of introduction and diversification of Vanilla planifolia (Orchidaceae) in Reunion Island (Indian Ocean).

The cultivated species Vanilla planifolia is a typical example of a crop introduced from its area of origin (America) to new regions where natural pollinators are absent. Although the Vanilla cultivars are exclusively vegetatively propagated, a high degree of phenotypic variation is observed among the cultivars in their introduction areas such as Reunion Island. To test several hypotheses explaining this variation-different introduction events, somatic mutations and sexual reproduction (through manual pollination)-we used AFLP markers to elucidate the patterns of introduction of V. planifolia. Most of the accessions cultivated in the world were derived from a single accession, possibly the Mexican cultivar Mansa. The patterns of diversification of this cultivated species were also studied and compared with other cultivated (V. tahitensis) and wild (V. pompona and V. bahiana) species. Except for one particular phenotype ('Aiguille'), which may come from sexual reproduction, cultivated accessions exhibit very low levels of genetic diversity. They have evolved by the accumulation of point mutations through vegetative multiplication. The genetic diversity revealed could not explain the phenotypic diversity, which may be related to epigenetics or polyploidy. This new understanding of the basis of genetic diversity of vanilla may assist to improve management of genetic resources.