Correlation between post kidney transplant anemia and kidney graft function.

BACKGROUND: Posttransplant anemia (PTA) influences kidney graft function and prognosis; however, there is no consensus regarding target hemoglobin (Hb) levels. METHODS: We examined several cases of PTA to identify any correlation between Hb levels and graft function. We evaluated 84 kidney transplant recipients (50 men and 34 women; mean age, 46.7 years) who were treated at our department between February 2004 and March 2012 and were available for a 2-year post-transplant follow-up. RESULTS: Hb levels and serum creatinine levels before transplantation and at 1, 3, 6, 12, and 24 months after transplantation were compared. We examined the correlation between the degree of anemia and renal function among the patients. Data were analyzed using Spearman's rank correlation coefficient and Friedman tests. The mean pretransplantation Hb level was 10.4 g/dL, whereas Hb levels at 6, 12, and 24 months after transplantation were significantly increased to 11.6, 12.2, and 12.4 g/dL, respectively, suggesting an improvement in anemia after the transplantation. Correlation analysis between anemia and kidney graft dysfunction revealed significant correlations at 1, 3, 12, and 24 months after transplantation. Subjects were stratified for correlation analysis according to Hb level at 24 months after transplantation: <10, 10-10.9, 11.0-11.9, 12.0-12.9, and ≥ 13.0 g/dL. A significant improvement in kidney graft function was noted in patients with an Hb level ≥ 11 g/dL at 2 years after transplantation. Anemia improved significantly by 3 months after transplantation. CONCLUSIONS: A significant correlation between PTA and kidney graft function was apparent, and the prognosis for kidney graft function was poor in patients with Hb levels ≤ 11 g/dL.

Interstitial fibrosis and tubular atrophy on protocol biopsies at 1 year after renal transplantation.

BACKGROUND: Advancements in immunosuppressive therapy have enabled control of early acute rejection and improved long-term kidney transplantation (KT) survival. Chronic histopathologic changes influence graft survival rate. We examined tubulointerstitial changes at 1 year after KT, focusing on the progression of interstitial fibrosis and/or tubular atrophy (IF/TA). METHODS: Using the Banff' 07 classification, we assessed the histological findings obtained at 1 year after transplantation of 38 patients who underwent the procedure between January 2008, and March 2010. In 24 cases, we obtained scores for interstitial fibrosis (ci) >1 and/or tubular atrophy (ct) > 1. We classified the patients into two groups, namely, less than borderline changes (BCs) (t0, i0, or i1; group A) versus BCs and above (t > 1, i2, or i3; group B). We compared their baseline data, renal function, and pathological scores. RESULTS: The mean serum creatinine levels were 1.06 mg/dL for group A and 1.32 mg/dL for group B. The "ct" grading according to the Banff' 07 classification was 0.83 for group A and 1.50 for group B (both P < .05). No significant difference was observed with respect to the percentage of patients with IF/TA (Banff category 5). CONCLUSION: Patients more within 1 year after KT with BCs who show irreversible tubular atrophy by biopsy experience impaired renal function. The presence of BC at the first year may not be associated with IF/TA.

Long-term recurrence-free survival after liver transplantation from an ABO-incompatible living donor for treatment of hepatocellular carcinoma exceeding Milano criteria in a patient with hepatitis B virus cirrhosis: a case report.

The early results of liver transplantations (OLT) in patients with advanced hepatocellular carcinoma (HCC) were poor because of frequent tumor recurrence. However, OLT has significant, theoretical advantage that it removes both the tumor and the organ that is at a risk of malignancy. The Japanese law on organ transplantation limited the availability of cadaveric liver donors until its revision on July 17, 2011. ABO-incompatible OLT was formerly contraindicated because performed anti-A/B antibodies on recipient endothelial cells raised the risk of antibody-mediated humoral graft rejection. We have herein described four successful cases of steroid withdrawal among adult patients who underwent living donor OLT from ABO-incompatible donors. In addition, we transplanted a liver from a living donor into an ABO-incompatible recipient on August 9, 2004. The 55-year-old man with HCC due to hepatitis B virus (HBV) a cirrhosis had a Child-Pugh score of C, and Model for End-stage Liver Disease score of 22. Two tumors greater than 5 cm, exceeded the Milan criteria. His des-gamma-carboxy prothrombin level was 6 mAu/mL, and alpha-fetoprotein, 18.78 ng/mL. Antirejection therapy included multiple perioperative plasmaphereses and splenectomy; with an immunosuppressive regimen consisting of tacrolimus, methylprednisolone, and mycophenolate mofetil. The maintenance dose of immunosuppression did not differ from that of ABO-identical cases. After transplantation, we used intrahepatic arterial infusion therapy with prostaglandin E1 (PG E1). The patient had complications of portal vein thrombosis, hepatic artery thrombosis, and acute myocardial infarction, which were treated by interventional radiology in the posttransplantation period. We controlled the HBsAb titer by administering hepatitis B immunoglobulin and lamivudine (200 IU/L doses) for 1 year after OLT and 100 IU/L doses thereafter. As a result, the patient achieved long-term, disease-free graft survival without steroids. He currently has good liver function and leads a normal lifestyle. Our results suggested the feasibility of controlling antibody-mediated humoral rejection and other complications in living donor liver transplantations into ABO-incompatible adults via intrahepatic arterial PG E1 infusion splenectomy, and plasmapheresis with regular immunosuppression. Withdrawal of steroids, HBV vaccination, and lamivudine, an nucleoside analog reverse transcriptase inhibitor, have achieved long-term (7 years) survival without recurrent HBV infection or tumor.

Safety and efficacy of conversion from twice-daily tacrolimus (prograf) to once-daily prolonged-release tacrolimus (graceptor) in stable kidney transplant recipients.

BACKGROUND: Graceptor is a new modified-release once-daily formulation of tacrolimus with an efficacy and safety profile similar to twice-daily tacrolimus (Prograf), as identified by clinical trials, offering a more convenient dosing regimen to improve adherence. The aim of this study was to analyze the safety of a 1:1 dose conversion from twice-daily Prograf to once-daily Graceptor in stable kidney transplant recipients. METHODS: We switched 33 Japanese patients who had undergone kidney transplantation ≥1 years before from twice-daily Prograf to once-daily Graceptor. The dose conversion ratio between Prograf and Graceptor was 1:1. We compared the following parameters: minimum tacrolimus concentration (C(min)); concentration dose per weight (CDW); serum creatinine (sCr); blood urea nitrogen (BUN); total cholesterol (TC); high-density lipoprotein cholesterol (HDL-C); uric acid (UA); fasting blood sugar (FBS). Time points for measurements were 1 month before study start and 1 and 2 months afterward. RESULTS: The mean age of the subjects in this study was 46.5 ± 13.1 years. Mean C(min) decreased from 4.55 ± 1.79 to 3.20 ± 1.22 ng/dL. The mean CDW also decreased, from 99.8 ± 69.5 to 75.0 ± 55.1 mg/dL/kg over the 2 months. There were no significant changes in sCR, BUN, UA, and FBS. Mean TC increased from 187.5 ± 51.4 to 194.3 ± 43.4 mg/dL, and mean HDL-C changed from 53.7 ± 12.0 to 56.1 ± 11 mg/dL. There were no episodes of rejection or infection. CONCLUSIONS: We conclude that switching from Prograf to Graceptor is safe and has the advantage of improving adherence. It could also have a beneficial effect in controlling glycemic levels and the adverse effects of tacrolimus. In many cases (25%-30%), the minimum concentration of tacrolimus decreased after changing tablets. With Graceptor, the ratio of area under trough level to area under the curve (AUC) is low compared with Prograf, resulting in low C(min) values of 1-2 ng/mL, and the AUC for Graceptor is very similar to that for Prograf.

Falsely abnormally elevated blood trough concentration of tacrolimus measured by antibody-conjugated magnetic immunoassay in a renal transplant recipient: a case report.

This report presents a falsely abnormally elevated blood trough concentration (C(t)) of tacrolimus measured by antibody-conjugated magnetic immunoassay (ACMIA) methods in a renal transplant recipient. Because the C(t) of tacrolimus was 78.5 ng/mL at day 2 after a 52-year-old man underwent renal transplantation, we stopped the tacrolimus extended-release formulation. However, because the abnormally elevated blood C(t) continued in the range of 41.1-59.1 ng/mL, we then measured the tacrolimus concentration in a stored blood sample before renal transplantation, it was 43 ng/mL. Consequently, the day-7 blood sample was measured with both ACMIA and enzyme-linked immunoassay, showing C(t) values of 42.8 ng/mL and 0.89 ng/mL, respectively. Because the abnormally elevated C(t) was falsely measured by the ACMIA method, we restarted tacrolimus However, the calcineurin inhibitor was subsequently converted to cyclosporine at day 21 after renal transplantation. Although cyclosporine was also measured by ACMIA, there was not an abnormally elevated C(t). Subsequently, the tacrolimus concentration ratio in plasma and whole blood (P/B-tacrolimus concentration ratio) was measured by ACMIA in a posttacrolimus blood sample. The P/B-tacrolimus concentration ratio was 100%. In contrast, the P/B-tacrolimus concentration ratio was <30% in 2 control patients administered tacrolimus. It has been reported recently that there were cases showing falsely slightly elevated C(t) of tacrolimus within the therapeutic range of concentrations. Therefore, we must be careful not to reduce the tacrolimus dose falsely. We consider confirmatory methods for a falsely abnormally elevated C(t) of tacrolimus measured by ACMIA to (1) measure P/B-tacrolimus concentration ratio, (2) compare ACMIA with another measurement, and (3) evaluate a blood sample stored before tacrolimus administration.

Early steroid withdrawal in adult kidney transplantation at a single center.

BACKGROUND: Beneficial effects of protocols using minimal steroid exposure have been recently reported. The purpose of this study was to evaluate the outcomes of kidney transplantation recipients who received immunosuppression protocols with early steroid withdrawal (ESW) at our center. METHODS: We retrospectively studied 84 kidney transplant recipients who had received ESW immunosuppressive protocols at our center from March 2005 to December 2010. The immunosuppressive regimen was a combination of calcineurin inhibitors (tacrolimus/cyclosporine), methylprednisolone, which was tapered and discontinued within 2 months, mycophenolate mofetil, and basiliximab (postoperative days 0 and 4). We compared the outcomes of our ESW recipients with those of a historical control group (February 2003 to January 2005; n = 18). RESULTS: Clinical acute rejection episodes were observed in 15 (17.9%) and 5 (27.8%) cases in the ESW and control groups, respectively. Cytomegalovirus infection occurred in 12 (14.3%) and 5 (27.8%) cases in the ESW and control groups, respectively. The creatinine levels at 1 year after transplantation were 1.3 ± 0.4 mg/dL and 1.3 ± 0.5 mg/dL in the ESW and control groups, respectively. In the ESW group of 84 recipients, actuarial patient survival at 1 year was 94.0%. In the historical group of 18 recipients, the actuarial patient survival at 1 year was 100% (P = .76). In the ESW group the graft survival rate at 1 year was 95.2%. In the historical group, graft survival rate at 1 year was 100% (P = .65). There were no significant differences in the parameters between the groups. CONCLUSIONS: The outcomes from this study were considered to be acceptable; however, the possibility of improving the protocols exists.

Machine perfusion preservation for kidney grafts with a high creatinine from uncontrolled donation after cardiac death.

BACKGROUND: This study evaluated the usefulness of machine perfusion preservation parameters as selection criteria for donation after cardiac arrest (DCD) with high creatinine level. The aim of this study is to evaluate to whether DCD donor >50 years old and with high creatinine are acceptable. METHODS: We examined 17 kidneys from uncontrolled DCD who showed creatinine levels >3.0 mg/dL before procurement. The study included the following two groups: group 1 (n = 9), donor age <50 years old versus group 2 (n = 8), donor age >50 years old. RESULTS: There were no significant differences in donors or preservation conditions among the 2 groups, including age, terminal creatinine, warm ischemic time, cold perfusion time, and total ischemic time. A greater resistance of 47.9 mmHg/mL per min/g was observed among group 2, compared with 42.5 mmHg/mL per min/g in group 1. A shorter ATN period (8.2 days) was noted in group 1, compared with 21.2 days for group 2. The flow rate (mL/g/min) was not significantly different between the two groups. The best-Cr level was 1.22 mg/dL in group 1 and 1.94 mg/dL in group 2. CONCLUSION: Machine perfusion flow was a reliable indicator of graft viability in uncontrolled DCD, particularly kidneys with high creatinine level. Even older donors were acceptable if the machine perfusion preservation parameters such as flow rate and pressure were acceptable; however, they may show severe delayed graft function.

ABO-incompatible adult living donor liver transplantation for hepatocellular carcinoma.

Living donor liver transplantation (LDLT) offers timely transplantation for patients with hepatocellular carcinoma (HCC). If ABO-incompatible LDLT is feasible, the need for pretransplantation treatment may be eliminated, which may reduce overall morbidity. In this article, we have described 8 adult HCC patients who successfully underwent LDLT from ABO-incompatible donors. Antirejection therapy included multiple preoperative plasmaphereses, splenectomy, and an immunosuppressive regimen with tacrolimus, methylprednisolone, and mycophenolate mofetil. The maintenance dose of immunosuppression did not differ from that of the ABO-identical cases. In addition, we also performed intrahepatic arterial infusion of prostaglandin E1. In 5 patients, we administered a single dose of rituximab, a chimeric CD20 monoclonal antibody. As a result of this treatment, 6/8 patients are still alive. Our experience has shown that it is possible to control antibody-mediated humoral rejection and other complications in adult ABO-incompatible LDLT.

Biliary complications after 52 adult living donor liver transplantations: a single-center experience.

OBJECTIVE: The incidence of biliary complications after adult living donor liver transplantation (ALDLT) are still high even though various devices have been reported to overcome them. METHOD: From October 2000 to April 2007, we performed 52 ALDLTs which included 15 ABO-incompatible grafts. Median follow-up was 565 days. In 49 procedures, we used duct-to-duct anastmosis with a stent inserted in the recipient duct and out through the common bile duct wall as an external stent, and in 3 procedures, we used duct-to-jejunostomy anastomosis. We investigated postoperative biliary complications and their management. RESULTS: Forty-four patients received right lobe grafts and 8 received left lobe grafts. Among patients in whom duct-to-duct anastomosis was used, nine (20.5%) developed biliary complications including bile leakage in five and biliary strictures in four. All bile leakage was treated with reoperation. Three biliary strictures were treated with stent placement, and one biliary stricture was treated with magnetic compression anastomosis. Among the three patients in whom duct-to-jejunostomy was used, two (66.7%) had bile leakage and stricture, respectively. Two of four ABO-incompatible patients (50%) had hepatic artery thrombosis with biliary complications, a high incidence. CONCLUSION: In our series of ABO-incompatible patients undergoing ALDLT, those who developed hepatic artery thrombosis exhibited a high incidence of biliary complications.

How can we increase living related donor renal transplantations?

BACKGROUND: In Japan, living donor renal transplantation has gained momentum due to an increased number of patients with end-stage renal disease. Living donation not only provides better outcomes, but also the recipients usually need less medications, thereby increasing the quality of life and reducing the potential side effects of immunosuppression. MATERIALS AND METHODS: For the past 25 years, our center had performed 140 open donor nephrectomy (OPNx) renal transplantations. Since July 2003, we changed our procurement operation to living hand-assisted laparoscopic donor nephrectomy (HALNx) in 49 cases. Our operative technique consisted of two 12-mm ports placed in the midaxillary line at the superior and inferior levels of the umbilicus. Next, a 5-cm incision was made in the midline periumbilicus and the hand port system fitted through a midline abdominal incision. RESULTS: In 49 cases, HALNx was completed successfully; no patient required conversion to laparotomy. The estimated blood loss was 33.0 +/- 43.4 g and no patient required blood transfusion. In comparison, in OPNx the blood loss was 426.5 +/- 247.6 g (P < .001). The mean operative times were 167.4 +/- 39.7 minutes for HALNx and 228.4 +/- 35.7 minutes for OPNx (P < .001). The postoperative hospital stays were 9.1 +/- 3.8 days for HALNx and 13.0 +/- 1.9 days for OPNx (P < .001). For 3 years prior to introduction of HALNx, we had performed only 10 living donor renal transplantations. Since the introduction of HALNx in 2003, the number of living donors has tripled during the following 3 years. CONCLUSIONS: Herein we have reported that HALNx was superior in terms of less operative time and blood loss, postoperative pain and recovery, and shorter hospital stay. Overall donor patient satisfaction was also better in the HALNx group. HALNx is a safe procedure that makes kidney donation more appealing to potential live donors and has increased the living donor pool at our center.

Evidence of different pharmacokinetics between cyclosporine and tacrolimus in renal transplant recipients: why cyclosporine is monitored by C2 level and tacrolimus by trough level.

The clinical efficacy of calcineurin inhibitors administered to renal transplant recipients is considered to be a strong function of the area under the concentration time curve (AUC). Monitoring of blood concentrations for two similar calcineurin inhibitors, cyclosporine (CyA) and tacrolimus (TAC) are different. Namely, CyA blood concentration is usually monitored at two hours after administration (C2), a surrogate for peak concentration (Cp), and TAC at trough concentration (Ct). We examined the behavior of blood concentration curves simultaneously for both CyA and TAC in renal transplant recipients with similar clinical backgrounds. Furthermore, we analyzed the correlation of Cp and Ct vs AUC implementing an area under the trough level, or area above the trough level as new pharmacokinetic parameters, so that C2 for CyA and Ct for TAC has validated using controlled clinical data. We observed differences in the pharmacokinetics between.

The role of plasmapheresis therapy for perioperative management in ABO-incompatible adult living donor liver transplantation.

BACKGROUND: Although living donor liver transplantation (LDLT) was established as a treatment for end-stage liver disease in Japan, the indication for LDLT across an ABO-incompatible barrier remains controversial. The purpose of this study was to elucidate the role of plasmapheresis in incompatible LDLT. METHODS: Eleven adult patients (seven men and four women) who underwent incompatible LDLT were enrolled in this study. Of these three patients had hepatocellular carcinoma, three chronic hepatitis C, one Wilson's disease, one autoimmune hepatitis, one chronic hepatitis B, one hemochromatosis, and one fulminant hepatic failure. The immunosuppressive regimen consisted of tacrolimus, prednisolone, mycophenolate mofetil (or cyclophosphamide), and prostaglandin E1 in all patients. Multiple plasmapheresis was performed perioperatively to reduce the recipient's antibody titers against the donor's blood type. RESULTS: Plasmapheresis was useful for the reduction of the recipient's antibody titers to x 16 or lower before and after transplantation. There was no difference in transplant outcome between the 11 patients with incompatible blood group and 30 patients with identical or compatible blood groups. DISCUSSION: Major postoperative complications such as intrahepatic biliary complications and hepatic necrosis may occur in incompatible transplantation. Several investigators suggested that anti-immunoglobulin (Ig) M and anti-IgG antibody titers sustained these complications. The antibody titers must be decreased sufficiently with plasmapheresis. An elevation of anti-ABO titers after transplantation may be a predictive risk factor for increased mortality and morbidity. In order to perform LDLT in a safer manner, plasmapheresis is an indispensable treatment to improve the outcome of ABO-incompatible cases.

Evaluation of appropriate blood level in continuous intravenous infusion from trough concentrations after oral administration based on area under trough level in tacrolimus and cyclosporine therapy.

The target blood concentrations of tacrolimus (TAC) and cyclosporine (CYA) during continuous intravenous infusion (C(ss)) have been determined based on clinical experience. However, it is desirable that C(ss) should be set so that the AUC after intravenous infusion is equal to the AUC after oral administration (AUC(po)). Accordingly, we performed 12-hour monitoring of blood concentrations to calculate C(ss) from the blood trough levels (C(TL)) on 15 kidney recipients administered TAC and 12 recipients administered CYA (Neoral). We used an area under the trough level (AUTL) as a new pharmacokinetic parameter. The C(ss) was evaluated from C(TL), AUC(po), and AUTL was calculated to be C(ss) = C(TL) x (AUC(po)/AUTL). In addition, AUTL/AUC(po) ratio and blood peak/trough level ratio (C(max)/C(min)) were examined to compare pharmacokinetics of TAC and CYA. The formula for TAC was C(ss) = C(TL) x 1.40 and that for CYA, C(ss) = C(TL) x 2.55. The calculated target C(ss) of TAC was 1.40 times that of C(TL), which was similar to the present clinical C(TL). In contrast, the calculated target C(ss) of CYA was 2.55 times the C(TL), and therefore an extremely high C(ss) was necessary to obtain a sufficient AUC that will be available after oral administration. Consequently, intravenous administration of CYA twice a day was considered to be more appropriate to obtain sufficient CYA pharmacokinetics, rather than a continuous intravenous administration. We conclude that the formula, C(ss) = C(TL) x (AUC(po)/AUTL) was useful to calculate the target blood concentration of calcineurin inhibitors when changing from continuous intravenous infusion to oral administration of these drugs.

Pharmacokinetic differences between morning and evening administration of cyclosporine and tacrolimus therapy.

We performed 24-hour monitoring of cyclosporine (NEO) and tacrolimus (TAC) blood concentrations, evaluating pharmacokinetic parameters and characterizing circadian variations. The monitoring was performed in 10 instances on nine patients administered NEO and 12 out of 11 patients administered TAC. All cases were administered equally divided doses of drugs twice daily orally. Blood samples were taken before and 1, 2, 3, 4, 6, and 12 hours after NEO or TAC administration in the morning and evening. The pharmacokinetic parameters were compared between morning and evening administrations of both drugs. AUC0-12, AUC0-4, C(max), C2, and C(max)/C(min) of NEO and TAC were significantly lower during the evening compared with morning administrations. C(min) values were significantly higher in the evening. T(max) of NEO was longer in evening, although there was not a significant difference; T(max) of TAC was significantly longer in the evening. We found that NEO and TAC administrations in the evening resulted in reduced bioavailability and delayed absorption when compared with drug administrations in the morning. It was thought that the difference in bioavailability between morning and evening administrations was smaller with TAC, because TAC shows lower peak levels and a flatter blood concentration curve than NEO. C(min) was higher after evening administration than morning because of delayed absorption, though the bioavailability of both drugs decreased in the evening. These results suggest that we have to appreciate apparently high trough levels.

Optimal dose and target trough level in cyclosporine and tacrolimus conversion in renal transplantation as evaluated by lymphocyte drug sensitivity and pharmacokinetic parameters.

We evaluated the relative clinical potency of cyclosporine (CyA) and tacrolimus (Tac) using pharmacodynamic and pharmacokinetic parameters of the drug to obtain the most suitable converting dose and target trough level. The relative pharmacodynamic potency was examined by the mean ratio of drug concentrations giving 50% inhibition of blastogenesis of lymphocytes (IC50) in 66 chronic renal failure patients. The relative potency estimated from clinical pharmacokinetic parameters was examined by the mean ratio of each pharmacokinetic parameter value of CyA versus Tac. The pharmacokinetic parameters were estimated by 12-hour monitoring of drug blood concentrations in seven CyA patients and seven Tac patients. The mean IC50 ratio of CyA and Tac (CyA/Tac of IC50) was 25.1. The mean area under the concentration-time curve (AUC) ratio (CyA/Tac of AUC) was 25.5, the mean trough level (C(min)) ratio (CyA/Tac of C(min)) was 13.2, and the mean dose per body weight ratio was 25.2. The relative potency estimated from AUC that is the most reliable pharmacokinetic parameter for the estimation of clinical efficacy of calcineurin inhibitors appeared to agree with the relative pharmacodynamic potency estimated from IC50. The data suggest that TAC 25-fold more potent than CyA, which represents a suitable converting dose ratio, and that target trough level of CyA is about 13-fold greater than Tac based on CyA/Tac of C(min). We conclude that these relative values may be useful to estimate the suitable dose and target trough levels to convert between CyA and Tac.

Radial flow bioreactor for the creation of bioartificial liver and kidney.

A radial flow bioreactor (RFB) is used for a three-dimensional perfusion culture of hepatocellular carcinoma (HCC) cells and renal cells, to create a bioartificial liver and kidney. The cylindrical reactor is filled with porous cellulose microcarrier. RFB can be characterized as a system in which the medium flows from the periphery toward the center of the reactor, thereby delivering an adequate supply of oxygen and nutrients to cells at the center as well as at the periphery. HCC cells incubated in the RFB system at high density maintained viability for long periods of time. Proximal tubular cells (LLC-PK1) as well as HCC cells, but not human immortalized mesangial cells (HMC) were cultured in the RFB for more than 14 days. The mRNA expression of some enzymes involved in the urea cycle, cytochrome P450s in HCC cells, and the 1-alpha-hydroxylase (CYP27B1) in LLC-PK1 cells was higher than that in monolayer cultures. These results suggest that the RFB system composed of HCC cells or renal cells may be useful for a bioartificial liver and kidney.

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

Radiofrequency ablation of unresectable hepatic malignancies.

Since radiation and chemotherapy have little impact on survival and no prospect for cure, surgery offers the best potentially option in patients with liver tumors. However, a lot of patients with liver tumors is not resectable due to stage combined with health problems, or poor liver function reserve. In this study, our preliminary clinical reports in patients with unresectable liver tumors treatment with RFA have demonstrated radiologic evidence of tumor necrosis and complications. Multielectrode, radiofrequency probes were supplied by RITA Medical Systems (Mountain View, California). This study involved a total of 28 liver tumors in 19 patients (including 17 patients with hepatomas and 2 patients with metastases). The mean age was 68.9 years old. The size of tumor was more than 3 cm in 15 patients. The approaches to the tumor were laparoscopic in 1 patients and open surgical in 18 patients. Hepatic vascular occlusion was combined with RFA in 5 cases. The reasons for unresectable were defined as total bilirubin, ICGR 15, cardiopulmonary function and multiplicity. The efficacy of this RFA therapy was evaluated by preoperative and follow-up CT scans or tumor makers. There tumor necrosis was shown in 15 patients (78.9%). The survival rates at the time up to 12 months were 84.2% in 16 patients. The present study has demonstrated that the RFA is able to provide a safe and effective means in controlling liver tumors.

Successful case of adult ABO-incompatible liver transplantation: beneficial effects of intrahepatic artery infusion therapy: a case report.

BACKGROUND: In Japan ABO-incompatible liver transplantation has been done on >100 occasions up to 2003. However, <30% are cases involving adults. The difficultly of ABO-incompatible liver transplantation is associated with the high frequency of humoral rejection and local disseminated intravascular coagulation (DIC), leading to many postoperative complications. We report a successful case of adult ABO-incompatible liver transplantation with the use of an intrahepatic artery infusion. METHODS: A 36-year-old man with Wilson disease, underwent living donor liver transplantation from an ABO-incompatible donor. The immunosuppressive therapy included multiple perioperative plasmaphereses, splenectomy, and treatment with tacrolimus, methylprednisolone, and cyclophosphamide. The dose and blood level of tacrolimus were the same as in ABO-compatible cases. In addition to these therapies, we administered an intrahepatic arterial infusion with prostaglandin (PG) E1 alone. RESULTS: After perioperative plasmapheresis and cyclophosphamide, antidonor blood group antibody titers remained undiluted and without vascular complications throughout the postoperative course, but there was a tendency for bleeding that continued for 10 days after transplantation. On postoperative day 10, a reexploration was performed for intraabdominal bleeding. During another operation on postoperative day 59 a biloma was found and drained. The patient has now survived for 120 days after transplantation with normal liver function. CONCLUSIONS: Beneficial effect of intrahepatic artery infusion with PGE1 seems to be useful in adult ABO-incompatible liver transplantation.