Electrochemical Sensor for the Detection and Accurate Early Diagnosis of Ovarian Cancer.

Ovarian cancer (OC) has the highest mortality rate among malignant tumors, primarily because it is difficult to diagnose early. Exosomes, a type of extracellular vesicle rich in parental information, have garnered significant attention in the field of cancer diagnosis and treatment. They play an important regulatory role in the occurrence, development, and metastasis of OC. Consequently, exosomes have emerged as noninvasive biomarkers for early cancer detection. Therefore, identifying cancer-derived exosomes may offer a novel biomarker for the early detection of OC. In this study, we developed a metal-organic frameworks assembled "double hook"-type aptamer electrochemical sensor, which enables accurate early diagnosis of OC. Under optimal experimental conditions, electrochemical impedance spectroscopy technology demonstrated a good linear relationship within the concentration range of 31-3.1 × 106 particles per microliter, with a detection limit as low as 12 particles per microliter. The universal exosome detection platform is constructed, and this platform can not only differentiate between high-grade serous ovarian cancer (HGSOC) patients and healthy individuals but also distinguish between HGSOC patients and nonhigh-grade serous OC (non-HGSOC). Consequently, it provides a novel strategy for the early diagnosis of OC and holds great significance in clinical differential diagnosis.

Transcriptomic sex differences in postmortem brain samples from patients with psychiatric disorders.

Many psychiatric disorders exhibit sex differences, but the underlying mechanisms remain poorly understood. We analyzed transcriptomics data from 2,160 postmortem adult prefrontal cortex brain samples from the PsychENCODE consortium in a sex-stratified study design. We compared transcriptomics data of postmortem brain samples from patients with schizophrenia (SCZ), bipolar disorder (BD), and autism spectrum disorder (ASD) to transcriptomics data of postmortem control brains from individuals without a known history of psychiatric disease. We found that brain samples from females with SCZ, BD and ASD showed a higher burden of transcriptomic dysfunction than did brain samples from males with these disorders. This observation was supported by the larger number of differentially expressed genes (DEGs) and a greater magnitude of gene expression changes observed in female versus male brain specimens. Additionally, female patient brain samples showed greater overall connectivity dysfunction, defined by a higher proportion of gene co-expression modules with connectivity changes and higher connectivity burden, indicating a greater degree of gene co-expression variability. We identified several gene co-expression modules enriched in sex-biased DEGs and identified genes from a genome-wide association study that were involved in immune and synaptic functions across different brain cell types. We found a number of genes as hubs within these modules including those encoding SCN2A, FGF14, and C3. Our results suggest that in the context of psychiatric diseases, males and females exhibit different degrees of transcriptomic dysfunction, and implicate immune and synaptic-related pathways in these sex differences.

Clinical characteristics and molecular mechanisms underlying bladder cancer in individuals with spinal cord injury: a systematic review.

BACKGROUND: Patients with spinal cord injury have a relatively high risk for bladder cancer and often complicated with bladder cancer in advanced stages, and the degree of aggressiveness of malignancy is high. Most of the literature is based on disease clinical features while, our study reviews the clinical characteristics and molecular mechanisms of spinal cord injury patients with bladder cancer, so that it might help clinicians better recognize and manage these patients. METHOD: We searched PubMed, Web of Science and Embase, using retrieval type like ("Neurogenic Lower Urinary Tract Dysfunction" OR "Spinal cord injury" OR "Spinal Cord Trauma") AND ("bladder cancer" OR "bladder neoplasm" OR "bladder carcinoma" OR "Urinary Bladder Neoplasms" OR "Bladder Tumor"). In Web of Science, the retrieval type was searched as "Topic", and in PubMed and Embase, as "All Field". The methodological quality of eligible studies and their risk of bias were assessed using the Newcastle-Ottawa scale. This article is registered in PROSPERO with the CBD number: CRD42024508514. RESULT: In WOS, we searched 219 related papers, in PubMed, 122 and in Embase, 363. Thus, a total of 254 articles were included after passing the screening, within a time range between 1960 and 2023. A comprehensive analysis of the data showed that the mortality and incidence rates of bladder cancer in spinal cord injury patients were higher than that of the general population, and the most frequent pathological type was squamous cell carcinoma. In parallel to long-term urinary tract infection and indwelling catheterization, the role of molecules such as NO, MiR 1949 and Rb 1. was found to be crucial pathogenetically. CONCLUSION: This review highlights the risk of bladder cancer in SCI patients, comprehensively addressing the clinical characteristics and related molecular mechanisms. However, given that there are few studies on the molecular mechanisms of bladder cancer in spinal cord injury, further research is needed to expand the understanding of the disease.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

UBE2L3 expression in human gastric cancer and its clinical significance.

PURPOSE: Gastric cancer (GC) is prevalent as one of the most common malignant tumors globally, with a particularly high incidence in China. The role of UBE2L3 in the initiation and progression of various cancers has been well documented, but its specific significance in GC is not yet fully elucidated. The objective of this study is to examine the expression and importance of UBE2L3 in human gastric cancer tissues. METHODS: Immunohistochemical staining and survival analysis were conducted on 125 cases of GC. Western blot and quantitative real-time polymerase chain reaction (qRT-PCR) were employed to assess the expression of UBE2L3 in GC cell lines. Cell lines with UBE2L3 knockdown and overexpression were cultured through lentivirus transfection and subsequently assessed using Western blot analysis. The involvement of UBE2L3 in the proliferation, invasion, and apoptosis of GC cells was confirmed through in vitro experiments, and its capacity to facilitate tumor growth was also validated in in vivo studies. RESULTS: The up-regulation of UBE2L3 expression was observed in GC, and its high expression was found to be significantly associated with the degree of differentiation (χ2 = 6.153, P = 0.0131), TNM stage (χ2 = 6.216, P = 0.0447), and poor overall survival. In vitro, UBE2L3 has been shown to enhance functions in GC cell lines, such as promoting proliferation and invasion, and inhibiting apoptosis. In vivo experiments have validated the role of UBE2L3 in promoting tumor growth. CONCLUSIONS: The findings of our study demonstrate the significant involvement of UBE2L3 in the pathogenesis and advancement of gastric cancer, suggesting its potential as a therapeutic target.

Development of a CRISPR/Cas12a-mediated aptasensor for Mpox virus antigen detection.

The emergence and rapid spread of Mpox (formerly monkeypox) have caused significant societal challenges. Adequate and appropriate diagnostics procedures are an urgent necessity. Herein, we discover a pair of aptamers through the systematic evolution of ligands by exponential enrichment (SELEX) that exhibit high affinity and bind to different sites towards the A29 protein of the Mpox virus. Subsequently, we propose a facile, sensitive, convenient CRISPR/Cas12a-mediated aptasensor for detecting the A29 antigen. The procedure employs the bivalent aptamers recognition, which induces the formation of a proximity switch probe and initiates subsequent cascade strand displacement reactions, then triggers CRISPR/Cas12a DNA trans-cleavage to achieve the sensitive detection of Mpox. Our method enables selective and ultrasensitive evaluation of the A29 protein within the range of 1 ng mL-1 to 1 µg mL-1, with a limit of detection (LOD) at 0.28 ng mL-1. Moreover, spiked A29 protein recovery exceeds 96.9%, while the detection activity remains above 91.9% after six months of storage at 4 °C. This aptasensor provides a novel avenue for exploring clinical diagnosis in cases involving Mpox as facilitating development in various analyte sensors.

Laboratory-developed Droplet Digital PCR Assay for Quantification of the JAK2 V617F Mutation.

Precise quantification of the JAK2 V617F mutation using highly sensitive assays is crucial for diagnosis, treatment process monitoring, and prognostic prediction in myeloproliferative neoplasms' (MPNs) patients. Digital droplet polymerase chain reaction (ddPCR) enables precise quantification of low-level mutations amidst a high percentage of wild type alleles without the need for external calibrators or endogenous controls. The objective of this study was to optimize a ddPCR assay for detecting the JAK2 V617F mutation and establish it as a laboratory-developed ddPCR assay in our center. The optimization process involved fine-tuning five key parameters: primer/probe sequences and concentrations, annealing temperature, template amount, and PCR cycles. Our ddPCR assay demonstrated exceptional sensitivity, and the limit of quantification (LoQ) was 0.01% variant allele frequency with a coefficient of variation of approximately 76%. A comparative analysis with quantitative PCR on 39 samples showed excellent consistency (r = 0.988). In summary, through rigorous optimization process and comprehensive analytic performance validation, we have established a highly sensitive and discriminative laboratory-developed ddPCR platform for JAK2 V617F detection. This optimized assay holds promise for early detection of minimal residual disease, personalized risk stratification, and potentially more effective treatment strategies in MPN patients and non-MPN populations.

High Level of Serum Complement C3 Expression is Associated with Postoperative Vasculopathy Progression in Moyamoya Disease.

Background: The immune system plays an important role in the onset and development of moyamoya disease (MMD), but the specific mechanisms remain unclear. This study aimed to explore the relationship between the expression of complements and immunoglobulin in serum and progression of MMD. Methods: A total of 84 patients with MMD and 70 healthy individuals were enrolled. Serum immunoglobulin and complement C3 and C4 expression were compared between healthy individuals and MMD patients. Follow-up was performed at least 6 months post-operation. Univariate and multivariate analysis after adjusting different covariates were performed to explore predictive factors associated with vasculopathy progression. A nomogram basing on the results of multivariate analysis was established to predict vasculopathy progression. Results: Compared to healthy individuals, MMD patients had significantly lower expression of serum complements C3 (P = 0.003*). Among MMD patients, C3 was significantly lower in those with late-stage disease (P = 0.001*). Of 84 patients, 27/84 (32.1%) patients presented with vasculopathy progression within a median follow-up time of 13.0 months. Age (P=0.006*), diastolic blood pressure (P=0.004*) and serum complement C3 expression (P=0.015*) were associated with vasculopathy progression after adjusting different covariables. Conclusion: Complement C3 is downregulated in moyamoya disease and decreases even further in late-Suzuki stage disease. Age, diastolic blood pressure and serum complement C3 expression are associated with vasculopathy progression, suggesting that the complement might be involved in the development of moyamoya disease.

Isolated anterior cerebral artery occlusion: an atypical form of moyamoya disease.

BACKGROUND: The relationship between anterior cerebral artery (ACA) occlusion and moyamoya disease (MMD) has rarely been studied. In this study, we focused on a special type of MMD: isolated ACA-occlusive MMD. We investigated clinical attributes, genotypes and progression risk factors in patients with ACA-occlusive MMD, providing initial insights into the relationship between ACA occlusion and MMD. METHODS: We retrospectively analysed digital subtraction angiography (DSA) from 2486 patients and diagnosed 139 patients with ACA-occlusive MMD. RNF213 p.R4810K (rs112735431) mutation analysis was performed. Patients were categorised into progression and non-progression groups based on whether they progressed to typical MMD. Differences in clinical characteristics, neuropsychological assessment, radiological findings and genotypes were evaluated. Logistic regression analyses identified risk factors for ACA-occlusive MMD progression. RESULTS: The median age of patients with ACA-occlusive MMD was 36 years, and the primary symptom was transient ischaemic attack (TIA). 72.3% of ACA-occlusive MMD patients had cognitive decline. Of 116 patients who underwent RNF213 gene mutation analysis, 90 patients (77.6%) carried the RNF213 p.R4810K GG allele and 26 (22.4%) carried the GA allele. Of 102 patients with follow-up DSA data, 40 patients (39.2%) progressed. Kaplan-Meier curve estimates indicated a higher incidence of ischaemic stroke in the progression group during follow-up (p=0.035). Younger age (p=0.041), RNF213 p.R4810K GA genotype (p=0.037) and poor collateral compensation from the middle cerebral artery (MCA) to ACA (p<0.001) were risk factors of ACA-occlusive MMD progression to typical MMD. CONCLUSIONS: Cognitive decline and TIA might be the main manifestations of ACA-occlusive MMD. Isolated ACA occlusion may be an early signal of MMD. The initial lesion site of MMD is not strictly confined to the terminal portion of the internal carotid artery. Younger patients, patients with RNF213 p.R4810K GA genotype or those with inadequate MCA-to-ACA compensation are more likely to develop typical MMD.

Research Advances in Stem Cell Therapy for Erectile Dysfunction.

Erectile dysfunction (ED) is a common clinical condition that mainly affects men aged over 40 years. Various causes contribute to the progression of ED, including pelvic nerve injury, diabetes, metabolic syndrome, age, Peyronie's disease, smoking, and psychological disorders. Current treatments for ED are limited to symptom relief and do not address the root cause. Stem cells, with their powerful ability to proliferate and differentiate, are a promising approach for the treatment of male ED and are gradually gaining widespread attention. Current uses for treating ED have been studied primarily in experimental animals, with most studies observing improvements in erectile quality as well as improvements in erectile tissue. However, research on stem cell therapy for human ED is still limited. This article summarizes the recent literature on basic stem cell research on ED, including cavernous nerve injury, aging, diabetes, and sclerosing penile disease, and describes mechanisms of action and therapeutic effects of various stem cell therapies in experimental animals. Stem cells are also believed to interact with host tissue in a paracrine manner, and improved function can be supported through both implantation and paracrine factors. To date, stem cells have shown some preliminary promising results in animal and human models of ED.

Risk Factors for Massive Cerebral Infarction in Pediatric Patients With Moyamoya Disease.

BACKGROUND: To explore the risk factors for preoperative massive cerebral infarction (MCI) in pediatric patients with moyamoya disease (MMD). METHODS: Pediatric patients with MMD treated between 2017 and 2022 were enrolled. Logistic regression analysis was performed to identify risk factors for MCI among the patients, and a nomogram was constructed to identify potential predictors of MCI. Receiver operating characteristic (ROC) curves and areas under the curves were calculated to determine the effects of different risk factors. RESULTS: This study included 308 pediatric patients with MMD, including 36 with MCI. The MCI group exhibited an earlier age of onset than the non-MCI group. Significant intergroup differences were observed in familial MMD history, postcirculation involvement, duration from diagnosis to initiation of treatment, Suzuki stage, magnetic resonance angiography (MRA) score, collateral circulation score, and RNF213 p.R4810K variations. Family history, higher MRA score, lower collateral circulation score, and RNF213 p.R4810K variations were substantial risk factors for MCI in pediatric patients with MMD. The nomogram demonstrated excellent discrimination and calibration capabilities. The integrated ROC model, which included all the abovementioned four variables, showed superior diagnostic precision with a sensitivity of 67.86%, specificity of 87.01%, and accuracy of 85.11%. CONCLUSIONS: This study showed that family history, elevated MRA score, reduced collateral circulation score, and RNF213 p.R4810K variations are risk factors for MCI in pediatric patients with MMD. The synthesized model including these variables demonstrated superior predictive efficacy; thus, it can facilitate early identification of at-risk patients and timely initiation of appropriate interventions.

Porcine circovirus type 2 infection promotes the SUMOylation of nucleophosmin-1 to facilitate the viral circular single-stranded DNA replication.

The mechanism of genome DNA replication in circular single-stranded DNA viruses is currently a mystery, except for the fact that it undergoes rolling-circle replication. Herein, we identified SUMOylated porcine nucleophosmin-1 (pNPM1), which is previously reported to be an interacting protein of the viral capsid protein, as a key regulator that promotes the genome DNA replication of porcine single-stranded DNA circovirus. Upon porcine circovirus type 2 (PCV2) infection, SUMO2/3 were recruited and conjugated with the K263 site of pNPM1's C-terminal domain to SUMOylate pNPM1, subsequently, the SUMOylated pNPM1 were translocated in nucleoli to promote the replication of PCV2 genome DNA. The mutation of the K263 site reduced the SUMOylation levels of pNPM1 and the nucleolar localization of pNPM1, resulting in a decrease in the level of PCV2 DNA replication. Meanwhile, the mutation of the K263 site prevented the interaction of pNPM1 with PCV2 DNA, but not the interaction of pNPM1 with PCV2 Cap. Mechanistically, PCV2 infection increased the expression levels of Ubc9, the only E2 enzyme involved in SUMOylation, through the Cap-mediated activation of ERK signaling. The upregulation of Ubc9 promoted the interaction between pNPM1 and TRIM24, a potential E3 ligase for SUMOylation, thereby facilitating the SUMOylation of pNPM1. The inhibition of ERK activation could significantly reduce the SUMOylation levels and the nucleolar localization of pNPM1, as well as the PCV2 DNA replication levels. These results provide new insights into the mechanism of circular single-stranded DNA virus replication and highlight NPM1 as a potential target for inhibiting PCV2 replication.

Brain eQTLs of European, African American, and Asian ancestry improve interpretation of schizophrenia GWAS.

Research on brain expression quantitative trait loci (eQTLs) has illuminated the genetic underpinnings of schizophrenia (SCZ). Yet, the majority of these studies have been centered on European populations, leading to a constrained understanding of population diversities and disease risks. To address this gap, we examined genotype and RNA-seq data from African Americans (AA, n=158), Europeans (EUR, n=408), and East Asians (EAS, n=217). When comparing eQTLs between EUR and non-EUR populations, we observed concordant patterns of genetic regulatory effect, particularly in terms of the effect sizes of the eQTLs. However, 343,737 cis-eQTLs (representing ∼17% of all eQTLs pairs) linked to 1,276 genes (about 10% of all eGenes) and 198,769 SNPs (approximately 16% of all eSNPs) were identified only in the non-EUR populations. Over 90% of observed population differences in eQTLs could be traced back to differences in allele frequency. Furthermore, 35% of these eQTLs were notably rare (MAF < 0.05) in the EUR population. Integrating brain eQTLs with SCZ signals from diverse populations, we observed a higher disease heritability enrichment of brain eQTLs in matched populations compared to mismatched ones. Prioritization analysis identified seven new risk genes ( SFXN2 , RP11-282018.3 , CYP17A1 , VPS37B , DENR , FTCDNL1 , and NT5DC2 ), and three potential novel regulatory variants in known risk genes ( CNNM2 , C12orf65 , and MPHOSPH9 ) that were missed in the EUR dataset. Our findings underscore that increasing genetic ancestral diversity is more efficient for power improvement than merely increasing the sample size within single-ancestry eQTLs datasets. Such a strategy will not only improve our understanding of the biological underpinnings of population structures but also pave the way for the identification of novel risk genes in SCZ.

High altitude retinopathy: An overview and new insights.

High altitude retinopathy (HAR) is a common ocular disorder that occurs on ascent to high altitude. There are many clinical symptoms, retinal vascular dilatation, retinal edema and hemorrhage are common. These usually do not or slightly affect vision; rarely, severe cases develop serious or permanent vision loss. At present, the research progress of HAR mainly focuses on hemodynamic changes, blood-retinal barrier damage, oxidative stress and inflammatory response. Although the related studies on HAR are limited, it shows that HAR still belongs to hypoxia, and hypobaric hypoxia plays an aggravating role in promoting the development of the disease. Various studies have demonstrated the correlation of HAR with acute mountain sickness (AMS) and high-altitude cerebral edema (HACE), so a deeper understanding of HAR is important. The slow ascent rates and ascent altitude are the key to preventing any altitude sickness. Research on traditional chinese medicine (TCM) and western medicine has been gradually carried out. Further exploration of the pathogenesis and prevention strategies of HAR will provide better guidance for doctors and high-altitude travelers.

High-resolution MRI vessel wall enhancement in moyamoya disease: risk factors and clinical outcomes.

OBJECTIVES: Intracranial vessel wall enhancement (VWE) on high-resolution magnetic resonance imaging (HRMRI) is associated with the progression and poor prognosis of moyamoya disease (MMD). This study assessed potential risk factors for VWE in MMD. METHODS: We evaluated MMD patients using HRMRI and traditional angiography examinations. The participants were divided into VWE and non-VWE groups based on HRMRI. Logistic regression was performed to compare the risk factors for VWE in MMD. The incidence of cerebrovascular events of the different subgroups according to risk factors was compared using Kaplan-Meier survival and Cox regression. RESULTS: We included 283 MMD patients, 84 of whom had VWE on HRMRI. The VWE group had higher modified Rankin Scale scores at admission (p = 0.014) and a higher incidence of ischaemia and haemorrhage (p = 0.002) than did the non-VWE group. Risk factors for VWE included the ring finger protein 213 (RNF213) p.R4810K variant (odds ratio [OR] 2.01, 95% confidence interval [CI] 1.08-3.76, p = 0.028), hyperhomocysteinaemia (HHcy) (OR 5.08, 95% CI 2.34-11.05, p < 0.001), and smoking history (OR 3.49, 95% CI 1.08-11.31, p = 0.037). During the follow-up of 63.9 ± 13.2 months (median 65 months), 18 recurrent stroke events occurred. Cox regression showed that VWE and the RNF213 p.R4810K variant were risk factors for stroke. CONCLUSION: The RNF213 p.R4810K variant is strongly associated with VWE and poor prognosis in MMD. HHcy and smoking are independent risk factors for VWE. CLINICAL RELEVANCE STATEMENT: Vessel wall enhancement in moyamoya disease is closely associated with poor prognosis, especially related to the ring finger protein 213 p.R4810K variant, hyperhomocysteinaemia, and smoking, providing crucial risk assessment information for the clinic. KEY POINTS: • The baseline presence of vessel wall enhancement is significantly associated with poor prognosis in moyamoya disease. • The ring finger protein 213 p.R4810K variant is strongly associated with vessel wall enhancement and poor prognosis in moyamoya disease. • Hyperhomocysteinaemia and smoking are independent risk factors for vessel wall enhancement in moyamoya disease.

Dry-season length affects the annual ecosystem carbon balance of a temperate semi-arid shrubland.

Semi-arid ecosystems have been shown to dominate over tropical forests in determining the trend and interannual variability of land carbon (C) sink. However, the magnitude and variability of ecosystem C balance remain largely uncertain for temperate semi-arid shrublands at the decadal scale. Using eddy-covariance and micro-meteorological measurements, we quantified the interannual variation in net ecosystem production (NEP) and its components, gross primary production (GPP) and ecosystem respiration (Reco, i.e., the sum of autotrophic and heterotrophic respiration), in a semi-arid shrubland of the Mu Us Desert, northern China during 2012-2022. This shrubland was an overall weak C sink over the 11 years (NEP = 12 ± 46 g C m-2 yr-1, mean ± SD). Annual NEP ranged from -66 to 77 g C m-2 yr-1, with the ecosystem frequently switching between being an annual C sink and a C source. GPP was twice as sensitive as Reco to prolonged dry seasons, leading to a close negative relationship between annual NEP and dry-season length (R2 = 0.80, P < 0.01). Annual GPP (R2 = 0.51, P = 0.01) and NEP (R2 = 0.58, P < 0.01) were positively correlated with annual rainfall. Negative annual NEP (the ecosystem being a C source) tended to occur when the dry season exceeded 50 d yr-1 or rainfall dropped below 280 mm yr-1. Increases in dry-season length strengthened the effects of low soil moisture relative to high vapor pressure deficit in constraining NEP. Both GPP and NEP were more closely correlated with C uptake amplitude (annual maximum daily values) than with C uptake period. These findings indicate that dry-season extension under climate change may reduce the long-term C sequestration in semi-arid shrublands. Plant species adapted to prolonged dry seasons should be used in ecosystem restoration in the studied area to enhance ecosystem functions.

Predictors of Stroke Outcomes in Conservatively Treated Patients With Moyamoya Disease: A Follow-up MRI Study.

BACKGROUND: Little is known about the association between stroke and imaging and clinical features in conservatively treated patients with moyamoya disease (MMD). PURPOSE: To investigate independent risk factors for stroke in conservatively treated patients with MMD during a long-term follow-up. STUDY TYPE: Prospective study. SUBJECTS: One hundred sixty conservatively managed patients with MMD (median age 46 years, 89 male). FIELD STRENGTH/SEQUENCE: Time of flight, turbo inversion recovery magnitude T1WI, turbo spin echo (TSE) T2WI, echo-planar imaging DWI, T2-fluid attenuated inversion recovery, dynamic susceptibility contrast-magnetic resonance imaging, and pre- and post-contrast 3D TSE T1WI sequences at 3.0 Tesla. ASSESSMENT: Patients were assessed at baseline and followed yearly. Ischemic and hemorrhagic stroke incidence rates were determined. Multiple demographic, clinical (modified Rankin score [mRS]), and cerebral imaging (cerebral blood volume [CBV] and concentric enhancement of arterial wall) factors at baseline were considered as potential predictors of stroke during the follow-up period. STATISTICAL TESTS: Univariable and multivariable Cox proportional hazards models to calculate the hazard ratios (HRs) and corresponding 95% confidence interval (CI) for stroke. Cumulative risk of stroke was estimated by the Kaplan-Meier product-limit method. A P value <0.05 was considered statistically significant. RESULTS: The median follow-up duration was 47 months. During the follow-up period, 18 (11.25%) patients experienced stroke events (13 [8.13%] ischemic, 5 [3.12%] hemorrhagic). Univariable analysis showed that 11 factors were significantly associated with stroke. After adjustment for clinical characteristics, multivariable analysis showed that mRS score ≥3 (HR, 1.99; 95% CI, 1.26-3.14), decreased CBV (HR, 5.31; 95% CI, 2.32-12.13), and concentric enhancement of the arterial wall (HR, 4.16; 95% CI, 1.55-11.15) were significantly associated with stroke. DATA CONCLUSION: Decreased CBV, mRS score ≥ 3, and concentric enhancement of the arterial wall were significantly associated with increased incidence of stroke in conservatively treated MMD. EVIDENCE LEVEL: 2 TECHNICAL EFFICACY: Stage 4.

Dual action of macrophage miR-204 confines cyclosporine A-induced atherosclerosis.

BACKGROUND AND PURPOSE: Atherosclerosis induced by cyclosporine A (CsA), an inhibitor of the calcineurin/nuclear factor of activated T cells (NFAT) pathway, is a major concern after organ transplantation. However, the atherosclerotic mechanisms of CsA remain obscure. We previously demonstrated that calcineurin/NFAT signalling inhibition contributes to atherogenesis via suppressing microRNA-204 (miR-204) transcription. We therefore hypothesised that miR-204 is involved in the development of CsA-induced atherosclerosis. EXPERIMENTAL APPROACH: ApoE-/- mice with macrophage-miR-204 overexpression were generated to determine the effects of miR-204 on CsA-induced atherosclerosis. Luciferase reporter assays and chromatin immunoprecipitation sequencing were performed to explore the targets mediating miR-204 effects. KEY RESULTS: CsA alone did not significantly affect atherosclerotic lesions or serum lipid levels. However, it exacerbated high-fat diet-induced atherosclerosis and hyperlipidemia in C57BL/6J and ApoE-/- mice, respectively. miR-204 levels decreased in circulating monocytes and plaque lesions during CsA-induced atherosclerosis. The upregulation of miR-204 in macrophages inhibited CsA-induced atherosclerotic plaque formation but did not affect serum lipid levels. miR-204 limited the CsA-induced foam cell formation by reducing the expression of the scavenger receptors SR-BII and CD36. SR-BII was post-transcriptionally regulated by mature miR-204-5p via 3'-UTR targeting. Additionally, nuclear-localised miR-204-3p prevented the CsA-induced binding of Ago2 to the CD36 promoter, suppressing CD36 transcription. SR-BII or CD36 expression restoration dampened the beneficial effects of miR-204 on CsA-induced atherosclerosis. CONCLUSION AND IMPLICATIONS: Macrophage miR-204 ameliorates CsA-induced atherosclerosis, suggesting that miR-204 may be a potential target for the prevention and treatment of CsA-related atherosclerotic side effects.

METTL3 regulates the proliferation, metastasis and EMT progression of bladder cancer through P3H4.

Bladder cancer, the most common malignant tumor in the urinary system, exhibits significantly up-regulated expression of P3H4, which is associated with pathological factors. The objective of this study was to elucidate the underlying mechanism of P3H4 in bladder cancer. Initially, we analyzed P3H4 gene expression using the TCGA database and evaluated P3H4 levels in clinical samples and various bladder cell lines. P3H4 was found to be markedly overexpressed in bladder cancer samples. Subsequently, bladder cancer cells were transfected with shRNA targeting P3H4 (sh-P3H4), sh-METTL3, and P3H4 overexpression vectors (P3H4 OE). Viability, migration, and invasion of bladder cancer cells were assessed using CCK-8, wound healing, and transwell assays. Western blot analysis was performed to determine the levels of EMT-associated proteins, while RNA stability assays determined the half-life of P3H4. Knockdown of P3H4 resulted in inhibition of bladder cancer cell proliferation, migration, invasion, and EMT progression. Mechanistically, METTL3 was found to regulate the mRNA stability of P3H4 in bladder cancer. Moreover, overexpression of P3H4 reversed the inhibitory effects of METTL3 knockdown on bladder cancer cell behaviors. Stable cell lines were established by infecting EJ cells with lentiviral vectors containing sh-METTL3 or P3H4 OE. These cells were then implanted into the skin of BALB/c nude mice, and IHC analysis was used to analyze the expression levels of EMT-associated proteins. In vivo studies demonstrated that inhibition of METTL3 suppressed bladder cancer growth and EMT through P3H4. In conclusion, our findings suggest that METTL3 regulates the proliferation, metastasis, and EMT progression of bladder cancer through P3H4, highlighting its potential as a therapeutic target.