Rapid detection of Impatiens necrotic spot virus from thrips vectors using reverse transcription-recombinase polymerase amplification.

The plant virus, Impatiens necrotic spot virus (INSV), is an economically important pathogen of vegetables, fruits, and ornamental crops. INSV is vectored by the western flower thrips, Frankliniella occidentalis, a small insect pest that is globally distributed. In recent years, INSV outbreaks have reached epidemic levels in the Salinas Valley of California-an agriculturally rich region where most of the lettuce (Lactuca sativa) is produced in the United States. Due to the obligate nature in which virus transmission occurs, new tools that could rapidly detect INSV from thrips vectors would enhance our ability to predict where virus outbreaks may occur. Here, we report on the development of a reverse transcription-recombinase polymerase amplification (RT-RPA) assay that can detect INSV from individual thrips. The assay uses crude extraction methods, is performed at a single temperature of 42 °C, can be completed in 25 min, and provides sensitivity levels that are comparable to other available detection methods. When the assay was used on field populations of thrips, INSV was successfully identified and quantified from individual larvae and adults. The work provides a new cost-effective surveillance tool that can rapidly detect INSV from its insect vector and from plants.

First Report of Impatiens Necrotic Spot Virus (INSV) Infecting Lettuce in Mexico.

Impatiens necrotic spot virus (INSV; Order Bunyavirales, Family Tospoviridae) is transmitted by several thrips species and has emerged as an important pathogen of lettuce (Lactuca sativa) in several countries (Beris et al., 2020 and Hasegawa & Del Pozo-Valdivia, 2023). In 2023, a total of 22,092 hectares of lettuce were planted in Mexico, with a total production of 523,739 tons (Agri-Food and Fisheries Information Service, 2024). In the last several years, increased outbreaks of a disease showing virus-like symptoms have emerged in lettuce in central Mexico. In all cases, plants exhibited symptoms of yellowing, brown necrotic spots and ringspots on the leaves and midribs, and reduced growth. In fall 2023, symptoms were observed in 12 iceberg lettuce fields, with incidences between 5-70% in the municipality of Tenango del Valle, in the state of Mexico. 18 plants collected from 6 fields were initially tested for the presence of two thrips-transmitted viruses, INSV and tomato spotted wilt virus (TSWV) using ImmunoStrips (Agdia Inc., Elkhart, Indiana), which indicated positive results for INSV in 16 plants and TSWV in 2 plants. None of the plants tested positive for both viruses. Follow up sampling was conducted, which included a total of 17 symptomatic lettuce plants from three fields in October 2023, while an additional 11 lettuce plants were collected from Tepeaca, in the neighboring state of Puebla in March 2024. DAS-ELISA confirmed the presence of INSV in 13/17 plants and TSWV in 2/17 plants from Tenango del Valle, while only INSV was detected in the 11 plants from Tepeaca. Based on ELISA, none of the lettuce samples were co-infected by INSV and TSWV, which was similarly observed in California and Greece (Koike et al., 2008 and Beris et al., 2020). Initially, RNA was purified from 3 plants (two from Tenango del Valle, one from Tepeaca) reverse-transcribed, and PCR amplified with primers to the N gene of the INSV S RNA, as previously described (Hasegawa et al., 2022). All three reactions produced a single expected amplicon of 524 bp and were confirmed by bi-directional Sanger sequencing (MCLab, South San Francisco, CA). To obtain the full-length sequences for the N and NSm genes, RNA from a fourth sample (Tenango del Valle) was amplified with primers (Kuo et al., 2014), and Sanger sequenced. The 789 bp N gene (PP726902) shared >99% nucleotide and amino acid identity to the corresponding region of the INSV isolate from orchid in California (KF926828), while the 912 bp NSm gene (PP726901) shared >98% nucleotide and amino acid identity to the INSV isolate from basil in Washington (KX790322). Additionally, all four samples showed >99.5% similarity to one another. INSV was previously reported to affect other crops in Mexico, including tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) (González-Pacheco and Silva-Rosales, 2013), while TSWV has been reported to infect lettuce (Moreno et al., 2016). To our knowledge, this is the first report of INSV infecting lettuce in Mexico and was the dominant orthotospovirus in lettuce samples that were tested. INSV should be closely monitored throughout central Mexico, where majority of lettuce production occurs. Additional studies are warranted to identify the thrips vector species that are present, and to understand the role of crop and non-crop hosts in the epidemiology of INSV throughout the region.

Genetic and physiological determinants of lettuce partial resistance to Impatiens necrotic spot virus.

Introduction: Impatiens necrotic spot virus (INSV) is a major pathogen currently threatening lettuce (Lactuca sativa L.) production in the coastal areas of California. The virus is transmitted by the western flower thrips (Frankliniella occidentalis Pergande). Methods: We have tested a diversity panel of almost 500 lettuce accessions for disease incidence (DI) in 12 field experiments performed over 7 years. This set of accessions was also assessed for thrips feeding damage (TFD), the rate of plant development (PD), and the content of chlorophyll (SPAD) and anthocyanins (ACI) to determine their effect on resistance to INSV. In addition, recombinant inbred lines from two biparental mapping populations were also evaluated for DI in field experiments. Results: The mean DI in 14 field experiments ranged from 2.1% to 70.4%. A highly significant difference in DI was observed among the tested accessions, with the overall lowest DI detected in the red color cultivars, Outredgeous Selection, Red Splash Cos, Infantry, Sweet Valentine, Annapolis, and Velvet. Multiple linear regression models revealed a small but significant effect (p < 0.005) of the four analyzed determinants on DI. Accessions with lower DI values had slower plant development (PD, r = 0.352), higher ACI content (r = -0.284), lower TFD (r = 0.198), and lower SPAD content (r = 0.125). A genome-wide association study revealed 13 QTLs for DI located on eight out of the nine lettuce chromosomes (the exception was chr. 8). The most frequently detected QTL (qINSV2.1) was located on chr. 2. Several of the QTLs for DI were in the same genomic areas as QTLs for PD, ACI, and SPAD. Additional three QTLs for DI on chr. 5 and 8 were identified using linkage mapping performed on two biparental mapping populations. Conclusions: The work highlights the genetic basis of partial resistance to INSV and reveals the relationship between resistance, the host physiology, and the thrips vector. Results of this study are an important steppingstone toward developing cultivars with increased resistance against INSV.

Identification and characterisation of PRXamide peptides in the western flower thrips, Frankliniella occidentalis.

Insect CAPA-PVK (periviscerokinin) and pyrokinin (PK) neuropeptides belong to the PRX family peptides and are produced from capa and pyrokinin genes. We identified and characterised the two genes from the western flower thrips, Frankliniella occidentalis. The capa gene transcribes three splice variants, capa-a, -b, and -c, encoding two CAPA-PVKs (EVQGLFPFPRVamide; QGLIPFPRVamide) and two PKs (ASWMPSSSPRLamide; DSASFTPRLamide). The pyrokinin mRNA encodes three PKs: DLVTQVLQPGQTGMWFGPRLamide, SEGNLVNFTPRLamide, and ESGEQPEDLEGSMGGAATSRQLRTDSEPTWGFSPRLamide, the most extended pheromone biosynthesis activating neuropeptide (PBAN) ortholog in insects. Multiple potential endoproteolytic cleavage sites were presented in the prepropeptides from the pyrokinin gene, creating ambiguity to predict mature peptides. To solve this difficulty, we used three G protein-coupled receptors (GPCRs) for CAPA-PVK, tryptophan PK (trpPK), and PK peptides, and evaluated the binding affinities of the peptides. The binding activities revealed each subfamily of peptides exclusively bind to their corresponding receptors, and were significant for determining the CAPA-PVK and PK peptides. Our biological method using specific GPCRs would be a valuable tool for determining mature peptides, particularly with multiple and ambiguous cleavage sites in those prepropeptides. Both capa and pyrokinin mRNAs were strongly expressed in the head/thorax, but minimally expressed in the abdomen. The two genes also were clearly expressed during most of the life stages. Whole-mounting immunocytochemistry revealed that neurons contained PRXamide peptides throughout the whole-body: four to six neurosecretory cells in the head, and three and seven pairs of immunostained cells in the thorax and abdomen, respectively. Notably, the unusual PRXamide profiles of Thysanoptera are different from the other insect groups.

Epidemiology and Economic Impact of Impatiens Necrotic Spot Virus: A Resurging Pathogen Affecting Lettuce in the Salinas Valley of California.

The Orthotospovirus impatiens necrotic spot virus (INSV) is a thrips-transmitted pathogen of lettuce that has rapidly emerged as a serious threat to production in the Salinas Valley of Monterey County, California. As a first step toward understanding the severity of the virus, we utilized Spatial Analysis by Distance IndicEs (SADIE) to characterize the distribution and progression of INSV outbreaks and thrips infestations in two commercial lettuce fields. In both fields, INSV incidence rapidly increased from 15.86% ± 1.77 to 80.24% ± 2.60 over the course of 7 weeks and aggregated at specific edges in both fields as early as 3 weeks after planting (Ia = 1.63, Pa = 0.0100, and Ia = 1.53, Pa = 0.0300). In one of the fields, thrips populations aggregated in areas that also experienced the most INSV (Ia = 1.2435, Pa = 0.0400, week 3; Ia = 1.4815, Pa < 0.0001, week 6; Ia = 1.5608, Pa < 0.0001, week 9), while in the second field, thrips were distributed randomly despite the aggregated effects that were observed for INSV incidence. Economic analysis estimated that the virus accounted for over $475,000 in losses for the two fields, while stakeholder surveys documented over 750 fields that experienced INSV infection during the 2021 season in Monterey County alone. These studies enhance our knowledge on the epidemiology of thrips and INSV under current lettuce production practices in the Salinas Valley, while elucidating the economic consequences and broader challenges that are associated with managing thrips-transmitted viruses.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Deep Sequencing of Small RNAs in the Whitefly Bemisia tabaci Reveals Novel MicroRNAs Potentially Associated with Begomovirus Acquisition and Transmission.

The whitefly Bemisia tabaci (Gennadius) is a notorious insect vector that transmits hundreds of plant viruses, affecting food and fiber crops worldwide, and results in the equivalent of billions of U.S. dollars in crop loss annually. To gain a better understanding of the mechanism in virus transmission, we conducted deep sequencing of small RNAs on the whitefly B. tabaci MEAM1 (Middle East-Asia Minor 1) that fed on tomato plants infected with tomato yellow leaf curl virus (TYLCV). Overall, 160 miRNAs were identified, 66 of which were conserved and 94 were B. tabaci-specific. Among the B. tabaci-specific miRNAs, 67 were newly described in the present study. Two miRNAs, with predicted targets encoding a nuclear receptor (Bta05482) and a very-long-chain (3R)-3-hydroxyacyl-CoA dehydratase 2 (Bta10702), respectively, were differentially expressed in whiteflies that fed on TYLCV-infected versus uninfected plants. To better understand the regulatory effects of identified miRNAs and their target genes, we correlated expression profiles of miRNAs and their target transcripts and found that, interestingly, miRNA expression was inversely correlated with the expression of ~50% of the predicted target genes. These analyses could serve as a model to study gene regulation in other systems involving arthropod transmission of viruses to plants and animals.

Genome of the African cassava whitefly Bemisia tabaci and distribution and genetic diversity of cassava-colonizing whiteflies in Africa.

The whitefy Bemisia tabaci, a species complex consisting of many morphologically indistinguishable species divided into distinct clades, is one of the most globally important agricultural pests and plant virus vectors. Cassava-colonizing B. tabaci transmits viruses that cause cassava mosaic disease (CMD) and cassava brown streak disease (CBSD). Half of all cassava plants in Africa are affected by these viral diseases, resulting in annual production losses of more than US$ 1 billion. Here we report the draft genome of the cassava whitefly B. tabaci Sub-Saharan Africa - East and Central Africa (SSA-ECA), the super-abundant population that has been associated with the rapid spread of viruses causing the pandemics of CMD and CBSD. The SSA-ECA genome assembled from Illumina short reads has a total size of 513.7 Mb and a scaffold N50 length of 497 kb, and contains 15,084 predicted protein-coding genes. Phylogenetic analysis suggests that SSA-ECA diverged from MEAM1 around 5.26 million years ago. A comprehensive genetic analysis of cassava-colonizing B. tabaci in Africa was also conducted, in which a total of 243 whitefly specimens were collected from 18 countries representing all major cassava-growing regions in the continent and genotyped using NextRAD sequencing. Population genomic analyses confirmed the existence of six major populations linked by gene flow and inferred the distribution patterns of these populations across the African continent. The genome of SSA-ECA and the genetic findings provide valuable resources and guidance to facilitate whitefly research and the development of strategies to control cassava viral diseases spread by whiteflies.

Genome-wide profiling of piRNAs in the whitefly Bemisia tabaci reveals cluster distribution and association with begomovirus transmission.

The whitefly Bemisia tabaci MEAM1 is a notorious vector capable of transmitting many plant viruses, resulting in serious crop loss and food shortage around the world. To investigate potential sRNA-mediated regulatory mechanisms in whiteflies that are affected by virus acquisition and transmission, we conducted small RNA (sRNA) deep sequencing and performed genome-wide profiling of piwi-interacting RNAs (piRNAs) in whiteflies that were fed on tomato yellow leaf curl virus (TYLCV)-infected or non-infected tomato plants for 24, 48, and 72 h. In the present study, piRNA reads ranging from 564,395 to 1,715,652 per library were identified and shown to distribute unevenly in clusters (57 to 96 per library) on the whitefly (B. tabaci MEAM1) genome. Among them, 53 piRNA clusters were common for all treatments. Comparative analysis between libraries generated from viruliferous and non-viruliferous whiteflies identified five TYLCV-induced and 24 TYLCV-suppressed piRNA clusters. Approximately 62% of piRNAs were derived from non-coding sequences including intergenic regions, introns, and untranslated regions (UTRs). The remaining 38% were derived from coding sequences (CDS) or repeat elements. Interestingly, six protein coding genes were targeted by the TYLCV-induced piRNAs. We identified a large number of piRNAs that were distributed in clusters across the whitefly genome, with 60% being derived from non-coding regions. Comparative analysis revealed that feeding on a virus-infected host caused induction and suppression of only a small number of piRNA clusters in whiteflies. Although piRNAs primarily regulate the activity of transposable elements, our results suggest that they may have additional functions in regulating protein coding genes and in insect-virus interactions.

Comparative transcriptome analysis reveals networks of genes activated in the whitefly, Bemisia tabaci when fed on tomato plants infected with Tomato yellow leaf curl virus.

The whitefly Bemisia tabaci can transmit hundreds of viruses to numerous agricultural crops in the world. Five genera of viruses, including Begomovirus and Crinivirus, are transmitted by B. tabaci. There is little knowledge about the genes involved in virus acquisition and transmission by whiteflies. Using a comparative transcriptomics approach, we evaluated the gene expression profiles of whiteflies (B. tabaci MEAM1) after feeding on tomato infected by a begomovirus, Tomato yellow leaf curl virus (TYLCV), in comparison to a recent study, in which whiteflies were fed on tomato infected by the crinivirus, Tomato chlorosis virus (ToCV). The data revealed similar temporal trends in gene expression, but large differences in the number of whitefly genes when fed on TYLCV or ToCV-infected tomato. Transcription factors, cathepsins, receptors, and a hemocyanin gene, which is implicated in mediating antiviral immune responses in other insects and possibly virus transmission, were some of the genes identified.

Transcriptome analysis of the whitefly, Bemisia tabaci MEAM1 during feeding on tomato infected with the crinivirus, Tomato chlorosis virus, identifies a temporal shift in gene expression and differential regulation of novel orphan genes.

BACKGROUND: Whiteflies threaten agricultural crop production worldwide, are polyphagous in nature, and transmit hundreds of plant viruses. Little is known how whitefly gene expression is altered due to feeding on plants infected with a semipersistently transmitted virus. Tomato chlorosis virus (ToCV; genus Crinivirus, family Closteroviridae) is transmitted by the whitefly (Bemisia tabaci) in a semipersistent manner and infects several globally important agricultural and ornamental crops, including tomato. RESULTS: To determine changes in global gene regulation in whiteflies after feeding on tomato plants infected with a crinivirus (ToCV), comparative transcriptomic analysis was performed using RNA-Seq on whitefly (Bemisia tabaci MEAM1) populations after 24, 48, and 72 h acquisition access periods on either ToCV-infected or uninfected tomatoes. Significant differences in gene expression were detected between whiteflies fed on ToCV-infected tomato and those fed on uninfected tomato among the three feeding time periods: 447 up-regulated and 542 down-regulated at 24 h, 4 up-regulated and 7 down-regulated at 48 h, and 50 up-regulated and 160 down-regulated at 72 h. Analysis revealed differential regulation of genes associated with metabolic pathways, signal transduction, transport and catabolism, receptors, glucose transporters, α-glucosidases, and the uric acid pathway in whiteflies fed on ToCV-infected tomatoes, as well as an abundance of differentially regulated novel orphan genes. Results demonstrate for the first time, a specific and temporally regulated response by the whitefly to feeding on a host plant infected with a semipersistently transmitted virus, and advance the understanding of the whitefly vector-virus interactions that facilitate virus transmission. CONCLUSION: Whitefly transmission of semipersistent viruses is believed to require specific interactions between the virus and its vector that allow binding of virus particles to factors within whitefly mouthparts. Results provide a broader understanding of the potential mechanism of crinivirus transmission by whitefly, aid in discerning genes or loci in whitefly that influence virus interactions or transmission, and subsequently facilitate development of novel, genetics-based control methods against whitefly and whitefly-transmitted viruses.

Virus Innexins induce alterations in insect cell and tissue function.

Polydnaviruses are dsDNA viruses that induce immune and developmental alterations in their caterpillar hosts. Characterization of polydnavirus gene families and family members is necessary to understand mechanisms of pathology and evolution of these viruses, and may aid to elucidate the role of host homologues if present. For example, the polydnavirus vinnexin gene family encodes homologues of insect gap junction genes (innexins) that are expressed in host immune cells (hemocytes). While the roles of Innexin proteins and gap junctions in insect immunity are largely unclear, we previously demonstrated that Vinnexins form functional gap junctions and alter the junctional characteristics of a host Innexin when co-expressed in paired Xenopus oocytes. Here, we test the effect of ectopic vinnexin expression on host cell physiology using both a lepidopteran cell culture model and a dipteran whole organism model. Vinnexin expression in the cell culture system resulted in gene-specific alterations in cell morphology and a slight, but non-statistically significant, reduction in gap junction activity as measured by dye transfer, while ectopic expression of a lepidopteran innexin2 gene led to morphological alterations and increase in gap junction activity. Global ectopic expression in the model dipteran, Drosophila melanogaster, of one vinnexin (vinnexinG) or D. melanogaster innexin2 (Dm-inx2) resulted in embryonic lethality, while expression of the other vinnexin genes had no effect. Furthermore, ectopic expression of vinnexinG, but not other vinnexin genes or Dm-inx2, in D. melanogaster larval gut resulted in developmental arrest in the pupal stage. These data indicate the vinnexins likely have gene-specific roles in host manipulation. They also support the use of Drosophila in further analysis of the role of Vinnexins and other polydnavirus genes in modifying host physiological processes. Finally, our findings suggest the vinnexin genes may be useful to perturb and characterize the physiological functions of insect Innexins.

The draft genome of whitefly Bemisia tabaci MEAM1, a global crop pest, provides novel insights into virus transmission, host adaptation, and insecticide resistance.

BACKGROUND: The whitefly Bemisia tabaci (Hemiptera: Aleyrodidae) is among the 100 worst invasive species in the world. As one of the most important crop pests and virus vectors, B. tabaci causes substantial crop losses and poses a serious threat to global food security. RESULTS: We report the 615-Mb high-quality genome sequence of B. tabaci Middle East-Asia Minor 1 (MEAM1), the first genome sequence in the Aleyrodidae family, which contains 15,664 protein-coding genes. The B. tabaci genome is highly divergent from other sequenced hemipteran genomes, sharing no detectable synteny. A number of known detoxification gene families, including cytochrome P450s and UDP-glucuronosyltransferases, are significantly expanded in B. tabaci. Other expanded gene families, including cathepsins, large clusters of tandemly duplicated B. tabaci-specific genes, and phosphatidylethanolamine-binding proteins (PEBPs), were found to be associated with virus acquisition and transmission and/or insecticide resistance, likely contributing to the global invasiveness and efficient virus transmission capacity of B. tabaci. The presence of 142 horizontally transferred genes from bacteria or fungi in the B. tabaci genome, including genes encoding hopanoid/sterol synthesis and xenobiotic detoxification enzymes that are not present in other insects, offers novel insights into the unique biological adaptations of this insect such as polyphagy and insecticide resistance. Interestingly, two adjacent bacterial pantothenate biosynthesis genes, panB and panC, have been co-transferred into B. tabaci and fused into a single gene that has acquired introns during its evolution. CONCLUSIONS: The B. tabaci genome contains numerous genetic novelties, including expansions in gene families associated with insecticide resistance, detoxification and virus transmission, as well as numerous horizontally transferred genes from bacteria and fungi. We believe these novelties likely have shaped B. tabaci as a highly invasive polyphagous crop pest and efficient vector of plant viruses. The genome serves as a reference for resolving the B. tabaci cryptic species complex, understanding fundamental biological novelties, and providing valuable genetic information to assist the development of novel strategies for controlling whiteflies and the viruses they transmit.

Application of Genomics for Understanding Plant Virus-Insect Vector Interactions and Insect Vector Control.

The relationships between plant viruses and their vectors have evolved over the millennia, and yet, studies on viruses began <150 years ago and investigations into the virus and vector interactions even more recently. The advent of next generation sequencing, including rapid genome and transcriptome analysis, methods for evaluation of small RNAs, and the related disciplines of proteomics and metabolomics offer a significant shift in the ability to elucidate molecular mechanisms involved in virus infection and transmission by insect vectors. Genomic technologies offer an unprecedented opportunity to examine the response of insect vectors to the presence of ingested viruses through gene expression changes and altered biochemical pathways. This review focuses on the interactions between viruses and their whitefly or thrips vectors and on potential applications of genomics-driven control of the insect vectors. Recent studies have evaluated gene expression in vectors during feeding on plants infected with begomoviruses, criniviruses, and tospoviruses, which exhibit very different types of virus-vector interactions. These studies demonstrate the advantages of genomics and the potential complementary studies that rapidly advance our understanding of the biology of virus transmission by insect vectors and offer additional opportunities to design novel genetic strategies to manage insect vectors and the viruses they transmit.

Estimation of the Whitefly Bemisia tabaci Genome Size Based on k-mer and Flow Cytometric Analyses.

Whiteflies of the Bemisia tabaci (Hemiptera: Aleyrodidae) cryptic species complex are among the most important agricultural insect pests in the world. These phloem-feeding insects can colonize over 1000 species of plants worldwide and inflict severe economic losses to crops, mainly through the transmission of pathogenic viruses. Surprisingly, there is very little genomic information about whiteflies. As a starting point to genome sequencing, we report a new estimation of the genome size of the B. tabaci B biotype or Middle East-Asia Minor 1 (MEAM1) population. Using an isogenic whitefly colony with over 6500 haploid male individuals for genomic DNA, three paired-end genomic libraries with insert sizes of ~300 bp, 500 bp and 1 Kb were constructed and sequenced on an Illumina HiSeq 2500 system. A total of ~50 billion base pairs of sequences were obtained from each library. K-mer analysis using these sequences revealed that the genome size of the whitefly was ~682.3 Mb. In addition, the flow cytometric analysis estimated the haploid genome size of the whitefly to be ~690 Mb. Considering the congruency between both estimation methods, we predict the haploid genome size of B. tabaci MEAM1 to be ~680-690 Mb. Our data provide a baseline for ongoing efforts to assemble and annotate the B. tabaci genome.

Metabolic Coevolution in the Bacterial Symbiosis of Whiteflies and Related Plant Sap-Feeding Insects.

Genomic decay is a common feature of intracellular bacteria that have entered into symbiosis with plant sap-feeding insects. This study of the whitefly Bemisia tabaci and two bacteria (Portiera aleyrodidarum and Hamiltonella defensa) cohoused in each host cell investigated whether the decay of Portiera metabolism genes is complemented by host and Hamiltonella genes, and compared the metabolic traits of the whitefly symbiosis with other sap-feeding insects (aphids, psyllids, and mealybugs). Parallel genomic and transcriptomic analysis revealed that the host genome contributes multiple metabolic reactions that complement or duplicate Portiera function, and that Hamiltonella may contribute multiple cofactors and one essential amino acid, lysine. Homologs of the Bemisia metabolism genes of insect origin have also been implicated in essential amino acid synthesis in other sap-feeding insect hosts, indicative of parallel coevolution of shared metabolic pathways across multiple symbioses. Further metabolism genes coded in the Bemisia genome are of bacterial origin, but phylogenetically distinct from Portiera, Hamiltonella and horizontally transferred genes identified in other sap-feeding insects. Overall, 75% of the metabolism genes of bacterial origin are functionally unique to one symbiosis, indicating that the evolutionary history of metabolic integration in these symbioses is strongly contingent on the pattern of horizontally acquired genes. Our analysis, further, shows that bacteria with genomic decay enable host acquisition of complex metabolic pathways by multiple independent horizontal gene transfers from exogenous bacteria. Specifically, each horizontally acquired gene can function with other genes in the pathway coded by the symbiont, while facilitating the decay of the symbiont gene coding the same reaction.

Recent findings in evolution and function of insect innexins.

The past decade has seen significant advances in the field of innexin biology, particularly in the model invertebrate organisms, the nematode Caenorhabditis elegans and the fly Drosophila melanogaster. However, advances in genomics and functional techniques during this same period are ushering in a period of comparative innexin biology. Insects are the most diverse metazoan taxa in terms of species number, as well as in developmental, physiological, and morphological processes. Combined with genomics data, the study of innexins should rapidly advance. In this review, we consider the current state of knowledge regarding innexins in insects, focusing on innexin diversity, both evolutionary and functional. We also consider an unusual set of innexins, known as vinnexins, that have been isolated from mutualistic viruses of some parasitoid wasps. We conclude with a call to study insect innexins from a broader, evolutionary perspective. Knowledge derived from such comparative studies will offer significant insight into developmental and evolutionary physiology, as well as specific functional processes in a taxon that has huge biomedical and ecological impact on humans.