Apoptosis-linked gene-2 (ALG-2)/Sec31 interactions regulate endoplasmic reticulum (ER)-to-Golgi transport: a potential effector pathway for luminal calcium.

Luminal calcium released from secretory organelles has been suggested to play a regulatory role in vesicle transport at several steps in the secretory pathway; however, its functional roles and effector pathways have not been elucidated. Here we demonstrate for the first time that specific luminal calcium depletion leads to a significant decrease in endoplasmic reticulum (ER)-to-Golgi transport rates in intact cells. Ultrastructural analysis revealed that luminal calcium depletion is accompanied by increased accumulation of intermediate compartment proteins in COPII buds and clusters of unfused COPII vesicles at ER exit sites. Furthermore, we present several lines of evidence suggesting that luminal calcium affected transport at least in part through calcium-dependent interactions between apoptosis-linked gene-2 (ALG-2) and the Sec31A proline-rich region: 1) targeted disruption of ALG-2/Sec31A interactions caused severe defects in ER-to-Golgi transport in intact cells; 2) effects of luminal calcium and ALG-2/Sec31A interactions on transport mutually required each other; and 3) Sec31A function in transport required luminal calcium. Morphological phenotypes of disrupted ALG-2/Sec31A interactions were characterized. We found that ALG-2/Sec31A interactions were not required for the localization of Sec31A to ER exit sites per se but appeared to acutely regulate the stability and trafficking of the cargo receptor p24 and the distribution of the vesicle tether protein p115. These results represent the first outline of a mechanism that connects luminal calcium to specific protein interactions regulating vesicle trafficking machinery.

Sit4p/PP6 regulates ER-to-Golgi traffic by controlling the dephosphorylation of COPII coat subunits.

Traffic from the endoplasmic reticulum (ER) to the Golgi complex is initiated when the activated form of the GTPase Sar1p recruits the Sec23p-Sec24p complex to ER membranes. The Sec23p-Sec24p complex, which forms the inner shell of the COPII coat, sorts cargo into ER-derived vesicles. The coat inner shell recruits the Sec13p-Sec31p complex, leading to coat polymerization and vesicle budding. Recent studies revealed that the Sec23p subunit sequentially interacts with three different binding partners to direct a COPII vesicle to the Golgi. One of these binding partners is the serine/threonine kinase Hrr25p. Hrr25p phosphorylates the COPII coat, driving the membrane-bound pool into the cytosol. The phosphorylated coat cannot rebind to the ER to initiate a new round of vesicle budding unless it is dephosphorylated. Here we screen all known protein phosphatases in yeast to identify one whose loss of function alters the cellular distribution of COPII coat subunits. This screen identifies the PP2A-like phosphatase Sit4p as a regulator of COPII coat dephosphorylation. Hyperphosphorylated coat subunits accumulate in the sit4Δ mutant in vivo. In vitro, Sit4p dephosphorylates COPII coat subunits. Consistent with a role in coat recycling, Sit4p and its mammalian orthologue, PP6, regulate traffic from the ER to the Golgi complex.

Alpha-synuclein delays endoplasmic reticulum (ER)-to-Golgi transport in mammalian cells by antagonizing ER/Golgi SNAREs.

Toxicity of human alpha-synuclein when expressed in simple organisms can be suppressed by overexpression of endoplasmic reticulum (ER)-to-Golgi transport machinery, suggesting that inhibition of constitutive secretion represents a fundamental cause of the toxicity. Whether similar inhibition in mammals represents a cause of familial Parkinson's disease has not been established. We tested elements of this hypothesis by expressing human alpha-synuclein in mammalian kidney and neuroendocrine cells and assessing ER-to-Golgi transport. Overexpression of wild type or the familial disease-associated A53T mutant alpha-synuclein delayed transport by up to 50%; however, A53T inhibited more potently. The secretory delay occurred at low expression levels and was not accompanied by insoluble alpha-synuclein aggregates or mistargeting of transport machinery, suggesting a direct action of soluble alpha-synuclein on trafficking proteins. Co-overexpression of ER/Golgi arginine soluble N-ethylmaleimide-sensitive factor attachment protein receptors (R-SNAREs) specifically rescued transport, indicating that alpha-synuclein antagonizes SNARE function. Ykt6 reversed alpha-synuclein inhibition much more effectively than sec22b, suggesting a possible neuroprotective role for the enigmatic high expression of ykt6 in neurons. In in vitro reconstitutions, purified alpha-synuclein A53T protein specifically inhibited COPII vesicle docking and fusion at a pre-Golgi step. Finally, soluble alpha-synuclein A53T directly bound ER/Golgi SNAREs and inhibited SNARE complex assembly, providing a potential mechanism for toxic effects in the early secretory pathway.

Analysis of expressed sequence tags from the four main developmental stages of Trypanosoma congolense.

Trypanosoma congolense is one of the most economically important pathogens of livestock in Africa. Culture-derived parasites of each of the three main insect stages of the T. congolense life cycle, i.e., the procyclic, epimastigote and metacyclic stages, and bloodstream stage parasites isolated from infected mice, were used to construct stage-specific cDNA libraries and expressed sequence tags (ESTs or cDNA clones) in each library were sequenced. Thirteen EST clusters encoding different variant surface glycoproteins (VSGs) were detected in the metacyclic library and 26 VSG EST clusters were found in the bloodstream library, 6 of which are shared by the metacyclic library. Rare VSG ESTs are present in the epimastigote library, and none were detected in the procyclic library. ESTs encoding enzymes that catalyze oxidative phosphorylation and amino acid metabolism are about twice as abundant in the procyclic and epimastigote stages as in the metacyclic and bloodstream stages. In contrast, ESTs encoding enzymes involved in glycolysis, the citric acid cycle and nucleotide metabolism are about the same in all four developmental stages. Cysteine proteases, kinases and phosphatases are the most abundant enzyme groups represented by the ESTs. All four libraries contain T. congolense-specific expressed sequences not present in the Trypanosoma brucei and Trypanosoma cruzi genomes. Normalized cDNA libraries were constructed from the metacyclic and bloodstream stages, and found to be further enriched for T. congolense-specific ESTs. Given that cultured T. congolense offers an experimental advantage over other African trypanosome species, these ESTs provide a basis for further investigation of the molecular properties of these four developmental stages, especially the epimastigote and metacyclic stages for which it is difficult to obtain large quantities of organisms. The T. congolense EST databases are available at: http://www.sanger.ac.uk/Projects/T_congolense/EST_index.shtml. The sequence data have been submitted to EMBL under the following accession numbers: FN263376-FN292969.

Differential expression of a protease gene family in African trypanosomes.

During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3'-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3'-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3'-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3'-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation.

Different trans RNA splicing events in bloodstream and procyclic Trypanosoma brucei.

Most trypanosomatid genes are transcribed into polycistronic precursor RNAs that are processed into monocistronic mRNAs possessing a 39-nucleotide spliced leader (SL) at their 5'-ends and polyadenylation at their 3'-ends. We show here that precursor RNA derived from a luciferase gene integrated in reverse orientation at the rDNA locus of Trypanosoma brucei is processed into three major SL-containing RNAs in bloodstream cells and a single SL-containing RNA in procyclic RNAs. This difference in trans RNA splicing between bloodstream and procyclic cells is independent of the 5'- and 3'-UTRs flanking the luciferase coding region. Thus, bloodstream cells can recognize some sequences in precursor RNA as a SL addition site that procyclic cells do not. These alternative SL addition sites may be aberrant or they might be utilized to expand the number of gene products from individual genes. Future experiments on endogenous genes will be necessary to examine the latter possibility.