RESUMEN
The pyruvate dehydrogenase complex (PDC) is a multienzyme complex central to aerobic respiration, connecting glycolysis to mitochondrial oxidation of pyruvate. Similar to the E3-binding protein (E3BP) of mammalian PDC, PX selectively recruits E3 to the fungal PDC, but its divergent sequence suggests a distinct structural mechanism. Here, we report reconstructions of PDC from the filamentous fungus Neurospora crassa by cryo-electron microscopy, where we find protein X (PX) interior to the PDC core as opposed to substituting E2 core subunits as in mammals. Steric occlusion limits PX binding, resulting in predominantly tetrahedral symmetry, explaining previous observations in Saccharomyces cerevisiae. The PX-binding site is conserved in (and specific to) fungi, and complements possible C-terminal binding motifs in PX that are absent in mammalian E3BP. Consideration of multiple symmetries thus reveals a differential structural basis for E3BP-like function in fungal PDC.
Asunto(s)
Proteínas Fúngicas/química , Neurospora crassa/química , Complejo Piruvato Deshidrogenasa/química , Sitios de Unión , Microscopía por Crioelectrón , Proteínas Fúngicas/metabolismo , Modelos Moleculares , Conformación Proteica , Dominios Proteicos , Complejo Piruvato Deshidrogenasa/genética , Complejo Piruvato Deshidrogenasa/metabolismoRESUMEN
Clubroot caused by Plasmodiophora brassicae is an important disease of brassica crops. The use of vital stains to determine the viability of P. brassicae resting spores can provide useful information regarding spore longevity, inoculum potential, or the efficacy of antimicrobial treatments. Evans blue is one example of a vital stain that has been reported to differentially stain viable and nonviable resting spores. Some previously published protocols using Evans blue to stain P. brassicae resting spores have not provided accurate or consistent results. In this study, we modified the Evans blue method by increasing the staining time to 8 h or more and evaluated P. brassicae resting spores after heat treatment at various combinations of temperature and time. Extending staining times significantly increased the numbers of stained resting spores up to 7 h, after which the numbers of stained spores did not change significantly (R2 = 96.88; P ≤ 0.001). The accuracy of the modified method to discriminate viable and nonviable spores was evaluated in repeated experiments and by comparing the staining data with those derived from inoculation assays and propidium monoazide quantitative PCR (qPCR). The results demonstrated that the modified Evans blue staining method improved the accuracy and consistency of measurement of P. brassicae resting spore viability. Additionally, it was equivalent to the qPCR method for differentiating viable and nonviable spores (R2 = 99.84; P ≤ 0.001) and confirmed in canola infection bioassays.
Asunto(s)
Azul de Evans , Plasmodiophorida , Esporas Protozoarias , Coloración y Etiquetado , Azul de Evans/metabolismo , Enfermedades de las Plantas , Plasmodiophorida/fisiología , Esporas Protozoarias/fisiología , Coloración y Etiquetado/métodos , Coloración y Etiquetado/normasRESUMEN
BACKGROUND AND OBJECTIVE: Current treatments for Alzheimer's Disease (AD) do not affect the course of the illness and brain stimulation techniques are increasingly promoted as potential therapeutic interventions for AD. This study reviews the effects of electromagnetic field (EMF) exposure versus sham exposure on working memory (WM) performance of healthy human participants. METHOD: Online literature databases and previous systematic reviews were searched for studies of EMF and WM in participants without reported memory problems. Two thousand eight hundred and fifty seven studies were identified, and 10 studies met the inclusion criteria. An assessment of study quality was completed, and separate, random effects meta-analyses were conducted for each of the three WM tasks included: n-back, substitution and digit span forward. RESULTS: No differences were found between participants exposed to active EMF versus sham conditions in any of the three working memory tasks examined. CONCLUSION: Results indicate that EMF does not affect WM during the n-back, substitution and digit-span tasks. Future studies should focus on the possible effects of chronic exposure to EMF in older adults with AD using a battery of comparable WM and attention tasks, before EMF can be seriously considered as a potential modulator of WM in AD. Copyright © 2016 John Wiley & Sons, Ltd.
Asunto(s)
Campos Electromagnéticos , Memoria a Corto Plazo/fisiología , Enfermedad de Alzheimer/terapia , Atención/fisiología , HumanosRESUMEN
BACKGROUND: Interventions that improve cognitive function in Alzheimer's disease are urgently required. AIMS: To assess whether a novel cognitive training paradigm based on 'chunking' improves working memory and general cognitive function, and is associated with reorganisation of functional activity in prefrontal and parietal cortices (trial registration: ISRCTN43007027). METHOD: Thirty patients with mild Alzheimer's disease were randomly allocated to receive 18 sessions of 30 min of either adaptive chunking training or an active control intervention over approximately 8 weeks. Pre- and post-intervention functional magnetic resonance imaging (fMRI) scans were also conducted. RESULTS: Adaptive chunking training led to significant improvements in verbal working memory and untrained clinical measures of general cognitive function. Further, fMRI revealed a bilateral reduction in task-related lateral prefrontal and parietal cortex activation in the training group compared with controls. CONCLUSIONS: Chunking-based cognitive training is a simple and potentially scalable intervention to improve cognitive function in early Alzheimer's disease.
Asunto(s)
Enfermedad de Alzheimer/fisiopatología , Enfermedad de Alzheimer/rehabilitación , Remediación Cognitiva/métodos , Función Ejecutiva/fisiología , Memoria a Corto Plazo/fisiología , Lóbulo Parietal/fisiopatología , Corteza Prefrontal/fisiopatología , Transferencia de Experiencia en Psicología/fisiología , Anciano , Femenino , Humanos , Imagen por Resonancia Magnética , MasculinoRESUMEN
We have refined methods for biological specimen preparation and low-voltage backscattered electron imaging in the scanning electron microscope that allow for observation at continuous magnifications of ca. 130-70â 000 X, and documentation of tissue and subcellular ultrastructure detail. The technique, based upon early work by Ogura & Hasegawa (1980), affords use of significantly larger sections from fixed and resin-embedded specimens than is possible with transmission electron microscopy while providing similar data. After microtomy, the sections, typically ca. 750 nm thick, were dried onto the surface of glass or silicon wafer and stained with heavy metals-the use of grids avoided. The glass/wafer support was then mounted onto standard scanning electron microscopy sample stubs, carbon-coated and imaged directly at an accelerating voltage of 5 kV, using either a yttrium aluminum garnet or ExB backscattered electron detector. Alternatively, the sections could be viewed first by light microscopy, for example to document signal from a fluorescent protein, and then by scanning electron microscopy to provide correlative light/electron microscope (CLEM) data. These methods provide unobstructed access to ultrastructure in the spatial context of a section ca. 7 × 10 mm in size, significantly larger than the typical 0.2 × 0.3 mm section used for conventional transmission electron microscopy imaging. Application of this approach was especially useful when the biology of interest was rare or difficult to find, e.g. a particular cell type, developmental stage, large organ, the interface between cells of interacting organisms, when contextual information within a large tissue was obligatory, or combinations of these factors. In addition, the methods were easily adapted for immunolocalizations.
Asunto(s)
Electrones , Microscopía Electrónica de Rastreo , Células Vegetales/ultraestructura , Resinas Sintéticas , Espacio Intracelular , Luz , Microscopía Electrónica de Transmisión , MicrotomíaRESUMEN
The adoption of electronic health records (EHRs) has adversely affected the ability of organ procurement organizations (OPOs) to perform their federally mandated function of honoring the donation decisions of families and donors who have signed the registry. The difficulties gaining access to potential donor medical record has meant that assessment, evaluation, and management of brain dead organ donors has become much more difficult. Delays can occur that can lead to potential recipients not receiving life-saving organs. For over 40 years, OPO personnel have had ready access to paper medical records. But the widespread adoption of EHRs has greatly limited the ability of OPO coordinators to readily gain access to patient medical records and to manage brain dead donors. Proposed solutions include the following: (1) hospitals could provide limited access to OPO personnel so that they could see only the potential donor's medical record; (2) OPOs could join with other transplant organizations to inform regulators of the problem; and (3) hospital organizations could be approached to work with Center for Medicare and Medicaid Services (CMS) to revise the Hospital Conditions of Participation to require OPOs be given access to donor medical records.
Asunto(s)
Registros Electrónicos de Salud/organización & administración , Accesibilidad a los Servicios de Salud/organización & administración , Obtención de Tejidos y Órganos/organización & administración , Humanos , Medicaid/organización & administración , Medicare/organización & administración , Estados UnidosRESUMEN
OBJECTIVES: To review the efficacy of cognitive interventions on improving general cognition in dementia. METHOD: Online literature databases and trial registers, previous systematic reviews and leading journals were searched for relevant randomised controlled trials. A systematic review, random-effects meta-analyses and meta-regression were conducted. Cognitive interventions were categorised as: cognitive stimulation (CS), involving a range of social and cognitive activities to stimulate multiple cognitive domains; cognitive training (CT), involving repeated practice of standardised tasks targeting a specific cognitive function; cognitive rehabilitation (CR), which takes a person-centred approach to target impaired function; or mixed CT and stimulation (MCTS). Separate analyses were conducted for general cognitive outcome measures and for studies using 'active' (designed to control for non-specific therapeutic effects) and non-active (minimal or no intervention) control groups. RESULTS: 33 studies were included. Significant positive effect sizes (Hedges' g) were found for CS with the mini-mental state examination (MMSE) (g=0.51, 95% CI 0.35 to 0.66; p<0.001) compared to non-active controls and (g=0.35, 95% CI 0.06 to 0.64; p=0.019) compared to active controls. Significant benefit was also seen with the Alzheimer's disease Assessment Scale-Cognition (ADAS-Cog) (g=-0.26, 95% CI -0.445 to -0.08; p=0.005). There was no evidence that CT or MCTS produced significant improvements on general cognition outcomes and not enough CR studies for meta-analysis. The lowest accepted minimum clinically important difference was reached in 11/17 CS studies for the MMSE, but only 2/9 studies for the ADAS-Cog. Additionally, 95% prediction intervals suggested that although statistically significant, CS may not lead to benefits on the ADAS-Cog in all clinical settings. CONCLUSIONS: CS improves scores on MMSE and ADAS-Cog in dementia, but benefits on the ADAS-Cog are generally not clinically significant and difficulties with blinding of patients and use of adequate placebo controls make comparison with the results of dementia drug treatments problematic.
Asunto(s)
Trastornos del Conocimiento/rehabilitación , Terapia Cognitivo-Conductual/normas , Demencia/terapia , Ensayos Clínicos como Asunto/normas , Humanos , Análisis de RegresiónRESUMEN
BACKGROUND: Hippocampal abnormalities have been demonstrated in schizophrenia. It is unclear whether these abnormalities worsen with age, and whether they affect cognition and function. AIMS: To determine whether hippocampal abnormalities in chronic schizophrenia are associated with age, cognition and socio-occupational function. METHOD: Using 3 T magnetic resonance imaging we scanned 100 persons aged 19-82 years: 51 were out-patients with stable schizophrenia at least 2 years after diagnosis and 49 were healthy volunteers matched for age and gender. Automated analysis was used to determine hippocampal volume and shape. RESULTS: There were differential effects of age in the schizophrenia and control samples on total hippocampal volume (group × age interaction: F(1,95) = 6.57, P = 0.012), with steeper age-related reduction in the schizophrenia group. Three-dimensional shape analysis located the age-related deformations predominantly in the mid-body of the hippocampus. In the schizophrenia group similar patterns of morphometric abnormalities were correlated with impaired cognition and poorer socio-occupational function. CONCLUSIONS: Hippocampal abnormalities are associated with age in people with chronic schizophrenia, with a steeper decline than in healthy individuals. These abnormalities are associated with cognitive and functional deficits, suggesting that hippocampal morphometry may be a biomarker for cognitive decline in older patients with schizophrenia.
Asunto(s)
Envejecimiento/patología , Cognición , Hipocampo/patología , Esquizofrenia/patología , Psicología del Esquizofrénico , Adulto , Factores de Edad , Anciano , Anciano de 80 o más Años , Femenino , Humanos , Procesamiento de Imagen Asistido por Computador , Imagen por Resonancia Magnética , Masculino , Persona de Mediana Edad , Pruebas Neuropsicológicas , Pacientes Ambulatorios , Adulto JovenRESUMEN
There are many new advances in neuroscience and mental health which should lead to a greater understanding of the neurobiological dysfunction in neuropsychiatric disorders and new developments for early, effective treatments. To do this, a biomarker approach combining genetic, neuroimaging, cognitive and other biological measures is needed. The aim of this article is to highlight novel approaches for pharmacological and non-pharmacological treatment development. This article suggests approaches that can be taken in the future including novel mechanisms with preliminary clinical validation to provide a toolbox for mechanistic studies and also examples of translation and back-translation. The review also emphasizes the need for clinician-scientists to be trained in a novel way in order to equip them with the conceptual and experimental techniques required, and emphasizes the need for private-public partnership and pre-competitive knowledge exchange. This should lead the way for important new holistic treatment developments to improve cognition, functional outcome and well-being of people with neuropsychiatric disorders.
Asunto(s)
Descubrimiento de Drogas/métodos , Trastornos Mentales/tratamiento farmacológico , Animales , Biomarcadores , Encéfalo/efectos de los fármacos , Encéfalo/crecimiento & desarrollo , Intervención Médica Temprana/métodos , Humanos , Terapia Molecular Dirigida/métodos , Apoyo a la Investigación como AsuntoRESUMEN
Organ procurement organizations (OPOs) report a nearly fourfold difference in donor availability as measured by eligible deaths per million population (PMP) based on hospital referrals. We analyzed whether mortality data help explain geographic variation in organ supply as measured by the number of eligible deaths for organ donation. Using the 2007 National Center for Health Statistics' mortality data, we analyzed deaths occurring in acute care hospitals, aged ≤ 70 years from cerebrovascular accidents and trauma. These deaths were mapped at the county level and compared to eligible deaths reported by OPOs. In 2007, there were 2 428 343 deaths reported in the United States with 42 339 in-hospital deaths ≤ 70 years from cerebrovascular accidents (CVA) or trauma that were correlated with eligible deaths PMP (r(2) = 0.79.) Analysis revealed a broad range in the death rate across OPOs: trauma deaths: 44-118 PMP; deaths from CVA: 34-118 PMP; and combined CVA and trauma: 91-229 PMP. Mortality data demonstrate that deaths by neurologic criteria of people who are likely to be suitable deceased donors are not evenly distributed across the nation. These deaths are correlated with eligible deaths for organ donation. Regional availability of organs is affected by deaths which should be accounted for in the organ allocation system.
Asunto(s)
Geografía , Donantes de Tejidos , HumanosRESUMEN
BACKGROUND: Language impairment in Alzheimer's disease occurs early, and language function deteriorates with progression of the illness to cause significant disability. This review focuses on language dysfunction in Alzheimer's disease and the contribution of semantic memory impairment. METHODS: Electronic publication databases were searched for literature relevant to the review. Additionally, individual references were examined to elicit further studies not found by online search. RESULTS: Language impairment in Alzheimer's disease initially affects verbal fluency and naming before breakdown in other facets. Naming and fluency require integrity of semantic concepts, and dysfunction may be a marker of primary semantic memory impairment rather than overall cognitive decline. Research suggests the presence of semantic loss several years prior to diagnosis. Imaging studies indicate an altered connectivity state with respect to language networks, and this is associated with potential semantic failure. This state may also be present in individuals with established risk factors for Alzheimer's disease. Compensatory recruitment of alternative cortical areas to supplement language function appears to occur and may be a target for future intervention. CONCLUSIONS: Identifying and classifying the nature and degree of language impairment more closely could aid in developing targeted therapies. Treatments already established in other aphasic states, such as post-stroke, may be especially relevant. The nature of these and the protective nature of cognitive reserve are potential therapeutic avenues.
Asunto(s)
Enfermedad de Alzheimer/fisiopatología , Trastornos del Lenguaje/fisiopatología , Trastornos de la Memoria/fisiopatología , Enfermedad de Alzheimer/diagnóstico , Enfermedad de Alzheimer/psicología , Enfermedad de Alzheimer/terapia , Antiparkinsonianos/uso terapéutico , Inhibidores de la Colinesterasa/uso terapéutico , Terapia por Estimulación Eléctrica/métodos , Neuroimagen Funcional/métodos , Humanos , Trastornos del Lenguaje/diagnóstico , Trastornos del Lenguaje/psicología , Trastornos del Lenguaje/terapia , Imagen por Resonancia Magnética , Trastornos de la Memoria/diagnóstico , Trastornos de la Memoria/psicología , Trastornos de la Memoria/terapiaRESUMEN
Internal fruit rot, caused by Fusarium lactis, is an important disease of sweet pepper (Capsicum annuum) in Canadian greenhouses. Production of the mycotoxins fumonisin B1 (FB1), moniliformin (MON) and beauvericin (BEA) by F. lactis (17 isolates) and the related species F. proliferatum (three isolates) and F. verticillioides (one isolate), which are also associated with internal fruit rot, was evaluated on rice medium. All 21 isolates examined were found to produce BEA, at concentrations ranging from 13.28 to 1674.60 ppm, while 13 of 17 F. lactis isolates and two of three F. proliferatum isolates produced MON (0.23 to 181.85 ppm). Only one isolate of F. lactis produced detectable levels of FB1 in culture, whereas all three F. proliferatum isolates and the F. verticilloides isolate produced this mycotoxin (0.28 to 314 ppm). Production of FB1, MON and BEA was also evaluated in inoculated pepper fruits showing mild or severe symptoms of infection. FB1 could be detected in both lightly and heavily diseased fruit tissue after inoculation with F. lactis, F. proliferatum or F. verticilloides, at concentrations ranging from 0.61 to 8.04 ppm. BEA was also detected in lightly and heavily diseased fruit tissue inoculated with F. lactis, as well as in heavily diseased tissue inoculated with F. proliferatum (3.00 to 19.43 ppm), but not in tissue inoculated with F. verticilloides. MON was detected in all tissues inoculated with F. proliferatum or F. verticilloides, and in heavily diseased tissue inoculated with F. lactis (0.03 to 0.27 ppm). The three mycotoxins were also found in naturally infected sweet pepper fruits exhibiting symptoms of internal fruit rot and collected from a commercial greenhouse. The production of MON, BEA and FB1 alone or in combination by isolates of F. lactis suggests that development of internal fruit rot of sweet pepper is an important food safety concern, and that every effort should be made to cull infected fruit before it makes it to market.
Asunto(s)
Capsicum/microbiología , Fusarium/metabolismo , Micotoxinas/biosíntesis , Enfermedades de las Plantas/microbiología , Canadá , Ciclobutanos/metabolismo , Depsipéptidos/biosíntesis , Contaminación de Alimentos , Frutas/microbiología , Fumonisinas/metabolismo , Fusarium/crecimiento & desarrollo , Oryza/microbiologíaRESUMEN
Late blight is caused by the oomycete Phytophthora infestans (Mont.) de Bary and is one of the most devastating diseases of potato and tomato. Late blight occurs in all major potato- and tomato-growing regions of Canada. Its incidence in North America increased during 2009 and 2010 (2). Foliar disease symptoms appeared earlier than usual (June rather than July) and coincided with the identification of several new P. infestans genotypes in the United States, each with unique characteristics. Prior to 2007, isolates collected from potato and tomato crops were mainly US8 or US11 genotypes (1). However, P. infestans populations in the United States have recently experienced a major genetic evolution, producing isolates with unique genotypes and epidemiological characteristics in Florida and throughout the northeastern states (2). Recent discoveries of tomato transplants with late blight for sale at Canadian retail outlets prompted an examination of the genotypes inadvertently being distributed and causing disease in commercial production areas in Canada. Analysis of isolates of P. infestans from across Canada in 2010 identified the US23 genotype for the first time from each of the four western provinces (Manitoba, Saskatchewan, Alberta, and British Columbia) but not from eastern Canada. Allozyme banding patterns at the glucose phosphate isomerase (Gpi) locus indicated a 100/100 profile consistent with US6 and US23 genotypes (4). Mating type assays confirmed the isolates to be A1 and in vivo metalaxyl sensitivity was observed. Restriction fragment length polymorphic analysis of 50 isolates from western Canada with the multilocus RG57 sequence and EcoRI produced the DNA pattern 1, 2, 5, 6, 10, 13, 14, 17, 20, 21, 24, 24a, 25 that was indicative of US23 (3). The recently described P. infestans genotype US23 appears to be more aggressive on tomato, and although isolates were recovered from both tomato and potato, disease symptoms were often more severe on tomato. Results indicate that movement and evolution of new P. infestans genotypes have contributed to the increased incidence of late blight and that movement of the pathogen on retail plantlets nationally and internationally may provide an additional early season source of inoculum. A major concern is that the introduced new A1 populations in western Canada have established a dichotomy with the endogenous A2 populations in eastern Canada, increasing the potential for sexual recombination producing oospores and additional genotypes should these populations merge. References: (1) Q. Chen et al. Am. J. Potato Res. 80:9, 2003. (2) K. Deahl. (Abstr.) Phytopathology 100(suppl.):S161, 2010. (3) S. B. Goodwin et al. Curr. Genet. 22:107, 1992. (4) S. B. Goodwin et al. Phytopathology 88:939, 2004.
RESUMEN
Poplar (Populus spp.) is an important ornamental, windbreak, and pulp and wood product tree in Alberta and across western Canada because of its rapid growth, architecture, and hardiness. It is also a major component of native tree stands in the parkland area of the Canadian Prairies. Until recently in North America, infections of Apioplagiostoma populi (Cash & A.M. Waterman) Barr have only been documented in central Canada and the eastern and midwestern United States. Symptoms resembling bronze leaf disease (3) were observed in Alberta as early as 2003 and have been seen each subsequent year on an increasing number of Populus × canescens Smith, P. tremula L., and P. tremuloides Michx. trees from urban areas, shelterbelts, and nurseries. Foliar symptoms were observed in 10 to 50% of the tree canopy, and diseased leaves were bronze-colored with green and yellow petioles and veins. Disease symptoms became pronounced in mid-to-late summer with bronze to dark reddish brown leaves, while the petiole and the midrib remained green. Some symptomatic leaves remained attached to diseased trees throughout the fall and winter and continued the infectious disease cycle in the spring. As the disease advanced, A. populi colonized stem and branch tissues causing the leaves to wilt, discolor, and die shortly afterward. Diseased branches often died within the current season. Continued branch dieback resulted in significantly reduced aesthetic and commercial value. Survival of poplar arising from diseased clones was often less than 5 years. Bronze leaf disease symptoms have been reported on several Populus spp., and premature tree mortality represents a serious impediment to the continued use of this tree species (1). Attempts to isolate the causal agent of bronze leaf disease on artificial media have been unsuccessful (4). In the fall of 2008, leaves from symptomatic trees were collected and suspended outdoors in mesh bags to overwinter. Dark brown perithecia (150 to 200 × 100 to 150 µm) emerged the following spring from the lower and upper leaf surfaces. Asci were fusoid clavate, 30 to 40 × 10 to 14 µm with a conspicuous apical ring and contained hyaline two-celled ascospores 10 to 14 × 3 to 6 µm that were ellipsoid clavate with a relatively short basal cell. Nucleic acid was extracted from isolated perithecia and amplified by the polymerase chain reaction and oligonucleotides 5'GCATCGATGAAGAACGCAGC3' and 5'TCCTCCGCTTATTGATATGC3' specific for rDNA internal transcribed spacer (ITS) sequence (2). The cloned amplified sequence of the A. populi rDNA ITS region (GenBank Accession No. GU205341) showed considerable homology (>90% identity) to other Apioplagiostoma spp. In total, 33 independent leaf samples from nine trees exhibiting disease symptoms were positive for A. populi, producing an approximately 300-bp sequence not observed in any of the symptomless samples. Poplar and aspen have been extensively planted in rural and urban landscapes in western Canada over the past 100 years and continued spread of the bronze leaf disease pathogen threatens the viability of the shelterbelt, nursery, and processed wood industries. References: (1) E. K. Cash and A. M. Waterman. Mycologia 49:756, 1957. (2) A. H. Khadhair et al. Can. J. Plant Pathol. 20:55, 1998. (3) P. R. Northover and M. Desjardins. Plant Dis. 87:1538, 2003. (4) J. A. Smith et al. Plant Dis. 86:462, 2002.
RESUMEN
BACKGROUND: Reports of the extent of working memory (WM) impairment in early Alzheimer's disease (AD) have been inconsistent. Using the model of WM proposed by Baddeley, neuropsychological evidence for the impairment of WM in early AD is evaluated. METHOD: Literature searches were performed using Medline, PsycINFO and Embase databases. Individual papers were then examined for additional references not revealed by computerised searches. RESULTS: Phonological loop function is intact at the preclinical and early stages of AD, becoming more impaired as the disease progresses. In mild AD, there is impairment on tasks assessing visuospatial sketchpad (VSS) function; however, these tasks also require executive processing by the central executive system (CES). There is evidence that the CES is impaired in mild AD and may be affected in the earlier preclinical stage of the disease. Episodic buffer function may be impaired but further research is required. CONCLUSIONS: Future research into central executive functioning at the earliest stages of the disease, combined with further longitudinal studies, needs to be carried out. Tasks to assess the proposed functions of the episodic buffer and specific tests of the VSS suitable for AD subjects need to be developed and validated. Learning more about these processes and how they are affected in AD is important in understanding and managing the cognitive deficits seen in the early stages of AD.
Asunto(s)
Enfermedad de Alzheimer/psicología , Memoria a Corto Plazo/fisiología , Anciano , Cognición/fisiología , Progresión de la Enfermedad , Función Ejecutiva/fisiología , Femenino , Humanos , Masculino , Persona de Mediana Edad , Modelos Teóricos , Pruebas Neuropsicológicas , Desempeño PsicomotorRESUMEN
We examined the instability of organ donation decisions made by next-of-kin and factors that predict whether nondonors wish they had consented to donation. Next-of-kin of donor-eligible individuals from one organ procurement organization participated in a semistructured telephone interview. Participants were asked if they would make the same decision if they had to make it again today. Of the 147 next-of-kin donors, 138 (94%) would make the same decision again, 6 (4%) would not consent to donation and 3 (2%) were unsure. Of the 138 next-of-kin nondonors, 89 (64%) would make the same decision again, 37 (27%) would consent to donation and 12 (9%) were unsure. Regret among nondonors was more likely when the next-of-kin had more favorable transplant attitudes (OR = 1.76, CI = 1.15, 2.69), had the first donation discussion with a non-OPO professional (OR = 0.21, CI = 0.13, 0.65), were not told of their loved one's death before this discussion (OR = 0.23, CI = 0.10, 0.50), did not feel they were given enough time to make the decision (OR = 0.25, CI = 0.11, 0.55), had not discussed donation with family members (OR = 0.30, CI = 0.13, 0.72) and had not heard a public service announcement about organ donation (OR = 0.29, CI = 0.13, 0.67). Organ procurement organizations (OPOs) should consider targeting these variables in educational campaigns and donation request approaches.
Asunto(s)
Toma de Decisiones , Familia/psicología , Obtención de Tejidos y Órganos/tendencias , Emociones , Humanos , Entrevistas como Asunto , Modelos Logísticos , Valor Predictivo de las Pruebas , Consentimiento por Terceros , Donantes de Tejidos/psicología , Obtención de Tejidos y Órganos/métodosRESUMEN
With the advances in the complexity of medical care there is a need to change the way we are organized in order to deliver that care in the most patient-friendly, efficient manner. This need is perhaps most compellingly manifest in the field of whole organ transplantation. Yet we are trying to deliver medical care with an organizational structure that was developed over 100 years ago when medical practice was considerably different. We argue for the development of a vertically integrated organizational structure in academic health centers for certain disciplines like transplantation. While this new arrangement for medical practice could be applied to many areas of medicine, transplantation is one of the best fields to begin making these changes. True transplant centers would bring avoid fragmentation of care and resources, thus bringing together the medical school and hospital into an integrated organization that would be responsible for all aspects of transplantation such as patient care, research, education and fiscal issues.
Asunto(s)
Trasplante/métodos , Centros Médicos Académicos/organización & administración , Prestación Integrada de Atención de Salud/organización & administración , Hospitales , Humanos , Relaciones Interinstitucionales , Modelos Organizacionales , Objetivos Organizacionales , Desarrollo de Programa , Investigación , Facultades de MedicinaRESUMEN
Clubroot of crucifers, caused by Plasmodiophora brassicae, is emerging as an important disease of canola (Brassica napus) in Alberta, Canada. Populations of the pathogen often consist of a mixture of different pathotypes. Therefore, a simple and efficient method to isolate single resting spores of P. brassicae was developed, based on serial dilution of spore suspensions. The virulence of 24 single-spore isolates, representing five populations of the pathogen from Alberta, Ontario, and British Columbia, was characterized on the differentials of Williams and Somé et al. Symptoms were rated 6 weeks after inoculation and Fisher's least significant difference (P < 0.05) was used to differentiate resistant from susceptible host reactions. The pathotype composition of P. brassicae in Canada appeared more diverse when single-spore isolates were examined rather than populations of the pathogen. In Alberta, at least three and possibly four pathotypes were identified among the 14 isolates tested, whereas a maximum of only two pathotypes had been reported previously when populations of the pathogen were examined. Pathotype 3 or P2, as classified on the differentials of Williams and Somé et al., respectively, was found to be predominant in the province. The occurrence of other pathotypes at lower frequencies suggests that caution should be used in any breeding strategy, because rare pathotypes of P. brassicae may quickly become predominant if susceptible host genotypes are continuously grown.
RESUMEN
Potato (Solanum tuberosum L.) diseases incited by Fusarium spp. include postharvest dry rot and seed-piece decay. Fusarium seed-piece decay is commonly controlled by preplant applications of chemical seed treatments. However, isolates of Fusarium spp. resistant to benzimidazole fungicides have been reported (2,4). In the spring of 2007, samples of cut seed tubers (cvs. Shepody and Russet Burbank) showing extensive symptoms of decay were received from three seedlots in Prince Edward Island (PE) and one seedlot in Saskatchewan (SK), Canada. All seed tubers had been treated with fludioxonil (Maxim Potato Seed Protectant [PSP], 0.5% fludioxonil) following cutting and then stored for 10 to 14 days prior to planting. Using standard isolation protocols (4), the 19 potato tuber pieces examined from PE and 2 from SK yielded 21 Fusarium isolates for further study. Five isolates (including both isolates from SK) were identified as Fusarium sambucinum Fuckel and the remaining 16 isolates were identified as F. coeruleum (Libert) Sacc. (3). To confirm identifications, isolates were compared with two known standards of each of F. sambucinum and F. coeruleum identified by K. Seifert (Agriculture and Agri-Food Canada, Ottawa, ON) by DNA sequencing of the partial ß-tubulin gene or the translation elongation factor 1-α ( http://fusarium.cbio.psu.edu ; [1]). These standard isolates were also used as fludioxonil-sensitive controls in amended agar assays for chemical sensitivity. Agar plugs (5 mm in diameter) taken from the margins of 7-day-old cultures of the Fusarium isolates were transferred to petri dishes containing ½-strength potato dextrose agar amended with 0, 0.1, 1.0, 10.0, or 100.0 mg/liter of fludioxonil. Fludioxonil (Maxim PSP, 0.5% a.i.) was prepared as a stock solution in sterile distilled water and added to the molten agar after autoclaving. Culture incubation and mycelial growth measurements were performed as described previously (4). Measurements from four replicate petri dishes per concentration of fludioxonil were taken. Calculated EC50 values (fludioxonil concentration inhibiting pathogen growth by 50%) were obtained. The trial was repeated three times. The two standard isolates of F. sambucinum were sensitive to fludioxonil, with mean EC50 values of 0.002 (±0.002 standard error [SE]) and 0.005 (±0.002 SE) mg/liter. The two standard isolates of F. coeruleum were also sensitive to fludioxonil, with mean EC50 values of 0.17 (±0.005 SE) and 0.19 (± 0.005 SE) mg/liter. All other tested isolates of F. sambucinum and F. coeruleum were resistant to fludioxonil and showed no growth inhibition even at 100 mg of fludioxonil per liter. To our knowledge, this is the first report of resistance to fludioxonil in isolates of Fusarium spp. causing potato seed-piece decay. Since the isolates of F. sambucinum were also resistant to thiophanate-methyl and thiabendazole (data not shown), multiclass (benzimidazole and pyrrole) resistance was also documented. References: (1) D. M. Geiser et al. Eur. J. Plant Pathol. 110:473, 2004. (2) L. M. Kawchuk et al. Am. Potato J. 71:185, 1994. (3) P. E. Nelson et al. Fusarium Species: An Illustrated Manual for Identification. Pennsylvania State University Press, 1983. (4) R. D. Peters et al. Plant Dis. 85:1030, 2001.