RESUMEN
Chirality is a common phenomenon in nature and plays an important role in the properties of matter. The rational synthesis of chiral compounds and exploration of their applications in various fields require an unambiguous determination of their handedness. However, in many cases, determinations of the chiral crystal structure and chiral morphology have been a challenging task due to the lack of proper characterization methods, especially for nanosized crystals. Therefore, it is crucial to develop novel and efficient characterization methods. Owing to the strong interactions between matter and electrons, electron crystallography has become a powerful tool for structural analysis of nanomaterials. In recent years, methods based on electron crystallography, such as high-resolution electron microscopy imaging and electron diffraction, have been developed to unravel the chirality of nanomaterials. This brings new opportunities to the design, synthesis, and applications of versatile chiral nanomaterials. In this perspective, we summarize the recent methodology developments and ongoing research of electron crystallography for chiral structure and morphology determination of nanocrystals, including inorganic and organic materials, as well as highlight the potential and further improvement of these methods in the future.
RESUMEN
Axis inhibitor protein 1 (AXIN1) is a protein recognized for inhibiting tumor growth and is commonly involved in cancer development. In this study, we explored the potential molecular mechanisms that connect alternative splicing of AXIN1 to the metastasis of hepatocellular carcinoma (HCC). Transcriptome sequencing, RTâPCR, qPCR and Western blotting were utilized to determine the expression levels of AXIN1 in human HCC tissues and HCC cells. The effects of the AXIN1 exon 9 alternative splice isoform and SRSF9 on the migration and invasion of HCC cells were assessed through wound healing and Transwell assays, respectively. The interaction between SRSF9 and AXIN1 was investigated using UV crosslink RNA immunoprecipitation, RNA pulldown, and RNA immunoprecipitation assays. Furthermore, the involvement of the AXIN1 isoform and SRSF9 in HCC metastasis was validated in a nude mouse model. AXIN1-L (exon 9 including) expression was downregulated, while AXIN1-S (exon 9 skipping) was upregulated in HCC. SRSF9 promotes the production of AXIN1-S by interacting with the sequence of exons 8 and 10 of AXIN1. AXIN1-S significantly promoted HCC cells migration and invasion by activating the Wnt pathway, while the opposite effects were observed for AXIN1-L. In vivo experiments demonstrated that AXIN1-L inhibited HCC metastasis, whereas SRSF9 promoted HCC metastasis in part by regulating the level of AXIN1-S. AXIN1, a tumor suppressor protein that targets the AXIN1/Wnt/ß-catenin signaling axis, may be a promising prognostic factor and a valuable therapeutic target for HCC.
RESUMEN
OBJECTIVE: Most bladder cancers are non-muscle invasive bladder cancer (NMIBC), and transurethral resection of bladder tumors (TURBT) is the standard treatment. However, postoperative recurrence remains a significant challenge, and the influence of bladder tumor location on prognosis is still unclear. This study aims to investigate how tumor location affects the prognosis of NMIBC patients undergoing TURBT and to identify the optimal surgical approach. METHODS: A multicenter study was conducted, which included Chinese NMIBC data from 15 hospitals (1996-2019) and data from 17 registries of the Surveillance, Epidemiology, and End Results database (SEER) (2000-2020). Patients initially diagnosed with NMIBC and undergoing TURBT or partial cystectomy were analyzed, with cases lost to follow-up or with missing data excluded. The study investigated the overall survival (OS), disease-specific survival (DSS), and recurrence-free survival (RFS) among patients with different tumor locations. Kaplan-Meier, Cox regression, and propensity score matching methods were employed to explore the association between tumor location and prognosis. Stratified populations were analyzed to minimize bias. RESULTS: This study included 118,477 NMIBC patients and highlighted tumor location as a crucial factor impacting post-TURBT prognosis. Both anterior wall and dome tumors independently predicted adverse outcomes in two cohorts. For anterior wall tumors, the Chinese cohort showed hazard ratios (HR) for OS of 4.35 (P < 0.0001); RFS of 2.21 (P < 0.0001); SEER cohort OS HR of 1.10 (P = 0.0001); DSS HR of 1.13 (P = 0.0183). Dome tumors displayed similar trends (Chinese NMIBC cohort OS HR of 7.91 (P < 0.0001); RFS HR of 2.12 (P < 0.0001); SEER OS HR of 1.05 (P = 0.0087); DSS HR of 1.14 (P = 0.0006)). Partial cystectomy significantly improved the survival of dome tumor patients compared to standard TURBT treatment (P < 0.01). CONCLUSION: This study reveals the significant impact of tumor location in NMIBC patients on the outcomes of TURBT treatment, with tumors in the anterior wall and bladder dome showing poor post-TURBT prognosis. Compared to TURBT treatment, partial cystectomy improves the prognosis for bladder dome tumors. This study provides guidance for personalized treatment and prognosis management for NMIBC patients.
RESUMEN
Serotonin-based nanomaterials have been positioned as promising contenders for constructing multifunctional biomedical nanoplatforms due to notable biocompatibility, advantageous charge properties, and chemical adaptability. The elaborately designed structure and morphology are significant for their applications as functional carriers. In this study, we fabricated anisotropic bowl-like mesoporous polyserotonin (PST) nanoparticles with a diameter of approximately 170 nm through nano-emulsion polymerization, employing P123/F127 as a dual-soft template and 1,3,5-trimethylbenzene (TMB) as both pore expander and emulsion template. Their formation can be attributed to the synchronized assembly of P123/F127/TMB, along with the concurrent manifestation of anisotropic nucleation and growth on the TMB emulsion droplet surface. Meanwhile, the morphology of PST nanoparticles can be regulated from sphere- to bowl-like, with a particle size distribution ranging from 432 nm to 100 nm, experiencing a transformation from a dendritic, cylindrical open mesoporous structure to an approximately non-porous structure by altering the reaction parameters. The well-defined mesopores, intrinsic asymmetry, and pH-dependent charge reversal characteristics enable the as-prepared mesoporous bowl-like PST nanoparticles' potential for constructing responsive biomedical nanomotors through incorporating some catalytic functional materials, 3.5 nm CeO2 nanoenzymes, as a demonstration. The constructed nanomotors demonstrate remarkable autonomous movement capabilities under physiological H2O2 concentrations, even at an extremely low concentration of 0.05 mM, showcasing the 51.58 body length/s velocity. Furthermore, they can also respond to physiological pH values ranging from 4.4 to 7.4, exhibiting reduced mobility with increasing pH. This charge reversal-based responsive nanomotor design utilizing PST nanoparticles holds great promise for advancing the application of nanomotors within complex biological systems.
RESUMEN
Clear cell renal cell carcinoma (ccRCC) is a complex disease with remarkable immune and metabolic heterogeneity. Here we perform genomic, transcriptomic, proteomic, metabolomic and spatial transcriptomic and metabolomic analyses on 100 patients with ccRCC from the Tongji Hospital RCC (TJ-RCC) cohort. Our analysis identifies four ccRCC subtypes including De-clear cell differentiated (DCCD)-ccRCC, a subtype with distinctive metabolic features. DCCD cancer cells are characterized by fewer lipid droplets, reduced metabolic activity, enhanced nutrient uptake capability and a high proliferation rate, leading to poor prognosis. Using single-cell and spatial trajectory analysis, we demonstrate that DCCD is a common mode of ccRCC progression. Even among stage I patients, DCCD is associated with worse outcomes and higher recurrence rate, suggesting that it cannot be cured by nephrectomy alone. Our study also suggests a treatment strategy based on subtype-specific immune cell infiltration that could guide the clinical management of ccRCC.
Asunto(s)
Carcinoma de Células Renales , Neoplasias Renales , Humanos , Carcinoma de Células Renales/genética , Carcinoma de Células Renales/patología , Neoplasias Renales/genética , Neoplasias Renales/patología , Multiómica , Proteómica , Reprogramación Metabólica , Diciclohexilcarbodiimida , Progresión de la Enfermedad , PronósticoRESUMEN
Development of specific therapies that target and accelerate diabetic wound repair is an urgent need to alleviate pain and suffering and the huge socioeconomic burden of this debilitating disease. C-X-C Motif Chemokine Ligand 12 (CXCL12) also know an stromal cell-derived factor 1α (SDF-1α) is a chemokine that binds the CXC chemokine receptor type 4 (CXCR4) and activates downstream signaling resulting in recruitment of hematopoietic cells to locations of tissue injury and promotes tissue repair. In diabetes, low expression of CXCL12 correlates with impaired wound healing. Activation of CXCR4 receptor signaling with agonists or positive allosteric modulators (PAMs) provides a potential for small molecule therapeutic discovery and development. We recently reported high throughput screening and identification of the CXCR4 partial agonist UCUF-728, characterization of in vitro activity and reduced wound closure time in diabetic mice at 100 µM as a proof-of-concept study. We report here, the discovery of a second chemical scaffold demonstrating increased agonist potency and represented by thiadiazine derivative, UCUF-965. UCUF-965 is a potent partial agonist of ß-arrestin recruitment in CXCR4 receptor overexpressing cell line. Furthermore, UCUF-965 potentiates the CXCL12 maximal response in cAMP signaling pathway, activates CXCL12 stimulated migration in lymphoblast cells and modulates the levels of specific microRNA involved in the complex wound repair process, specifically in mouse fibroblasts. Our results indicate that UCUF-965 acts as a PAM agonist of the CXCR4 receptor. Furthermore, UCUF-965 enhanced angiogenesis markers and reduced wound healing time by 36% at 10.0 µM in diabetic mice models compared to untreated control.
Asunto(s)
Diabetes Mellitus Experimental , Receptores CXCR4 , Cicatrización de Heridas , Animales , Ratones , Movimiento Celular/fisiología , Quimiocina CXCL12/metabolismo , Diabetes Mellitus Experimental/tratamiento farmacológico , Diabetes Mellitus Experimental/genética , Diabetes Mellitus Experimental/inmunología , Células Madre Hematopoyéticas , Receptores CXCR4/agonistas , Receptores CXCR4/genética , Receptores CXCR4/metabolismo , Transducción de Señal , Cicatrización de Heridas/efectos de los fármacos , Cicatrización de Heridas/genética , Cicatrización de Heridas/fisiologíaRESUMEN
Although radiotherapy (RT) has achieved great success in the treatment of non-small cell lung cancer (NSCLC), local relapses still occur and abscopal effects are rarely seen even when it is combined with immune checkpoint blockers (ICBs). Here, we characterize the dynamic changes of tumor-infiltrating immune cells after RT in a therapy-resistant murine tumor model using single-cell transcriptomes and T cell receptor sequencing. At the early stage, the innate and adaptive immune systems are activated. At the late stage, however, the tumor immune microenvironment (TIME) shifts into immunosuppressive properties. Our study reveals that inhibition of CD39 combined with RT preferentially decreases the percentage of exhausted CD8+ T cells. Moreover, we find that the combination of V-domain immunoglobulin suppressor of T cell activation (VISTA) blockade and RT synergistically reduces immunosuppressive myeloid cells. Clinically, high VISTA expression is associated with poor prognosis in patients with NSCLC. Altogether, our data provide deep insight into acquired resistance to RT from an immune perspective and present rational combination strategies.
Asunto(s)
Carcinoma de Pulmón de Células no Pequeñas , Neoplasias Pulmonares , Humanos , Animales , Ratones , Linfocitos T CD8-positivos , Carcinoma de Pulmón de Células no Pequeñas/tratamiento farmacológico , Carcinoma de Pulmón de Células no Pequeñas/radioterapia , Carcinoma de Pulmón de Células no Pequeñas/metabolismo , Neoplasias Pulmonares/tratamiento farmacológico , Neoplasias Pulmonares/radioterapia , Neoplasias Pulmonares/metabolismo , Recurrencia Local de Neoplasia/metabolismo , Células Mieloides , Microambiente TumoralRESUMEN
Germanosilicate zeolites with various structures have been extensively synthesized, but the syntheses of corresponding zeolite structures in the absence of germanium species remain a challenge. One such example is an ITR zeolite structure, which is a twin of the ITH zeolite structure. Through the modification of a classic organic template for synthesizing ITH zeolites and thus designing a new organic template with high compatibility to ITR zeolite assisted by theoretical simulation, we, for the first time, show the Ge-free synthesis of an ITR structure including pure silica, aluminosilicate, and borosilicate ITR zeolites. These materials have high crystallinity, corresponding to an ITR content of more than 95%. In the methanol-to-propylene (MTP) reaction, the obtained aluminosilicate ITR zeolite exhibits excellent propylene selectivity and a long lifetime compared with conventional aluminosilicate ZSM-5 zeolite. The strategy for the design of organic templates might offer a new opportunity for rational syntheses of novel zeolites and, thus, the development of highly efficient zeolite catalysts in the future.
RESUMEN
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Asunto(s)
Neoplasias de la Mama , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B , Humanos , Femenino , Ribonucleoproteína Nuclear Heterogénea A1/genética , Ribonucleoproteína Nuclear Heterogénea A1/metabolismo , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/genética , Ribonucleoproteína Heterogénea-Nuclear Grupo A-B/metabolismo , Neoplasias de la Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Empalme Alternativo , Exones/genética , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo , Proteínas Supresoras de Tumor/metabolismoRESUMEN
A three-axis gyroscope is a vital component of an inertial measurement unit that can measure the rotation rates in three directions simultaneously. A novel three-axis resonant fiber-optic gyroscope (RFOG) configuration with a multiplexed broadband light source is proposed and demonstrated. The output light from the two vacant ports of the main gyroscope is reused as drive sources for the other two axial gyroscopes, which effectively improve the power utilization of the source. The interference between different axial gyroscopes is effectively avoided by optimizing the lengths of three fiber-optic ring resonators (FRRs) rather than by inserting other optical elements in the multiplexed link. With the optimal lengths, the influence of the input spectrum on the multiplexed RFOG is suppressed and a theoretical temperature dependence of the bias error as low as 1.08 × 10-4 °/h/°C is obtained. Finally, a navigation-grade three-axis RFOG is demonstrated with a fiber coil length of â¼100 m for each FRR.
RESUMEN
The resonant micro-optic gyroscope (RMOG) is one of the most promising candidates for chip-scale optoelectronic gyroscopes. A broadband source-driven RMOG based on a multi-turn waveguide-type ring resonator (WRR) has been proposed and demonstrated. The theoretical sensitivity is enhanced with the multi-turn structure, while the parasitic backscattering can be resolved by the use of the broadband source, thus greatly improving the long-term bias stability of the RMOG. We also reduce the relative intensity noise (RIN)-induced error of the broadband source at the gyro output by optimizing the number of loop turns of the WRR, and improve the angle random walk (ARW) by 4.8â dB compared with the case of a single-turn WRR. Finally, a bias stability of 1°/h is obtained with a 5-turn WRR of 4.05â cm diameter, achieving the tactical-grade resolution. To the best of our knowledge this is the best result reported to date for an RMOG of similar size.
RESUMEN
Zeolite molecular sieves with at least eight-membered rings are widely applied in industrial applications, while zeolite crystals with six-membered rings are normally regarded as useless products due to the occupancy of the organic templates and/or inorganic cation in the micropores that could not be removed. Herein, we showed that a novel six-membered ring molecular sieve (ZJM-9) with fully open micropores could be achieved by a reconstruction route. The mixed gas breakthrough experiments such as CH3OH/H2O, CH4/H2O, CO2/H2O, and CO/H2O at 25 °C showed that this molecular sieve was efficient for selective dehydration. Particularly, a lower desorption temperature (95 °C) of ZJM-9 than that (250 °C) of the commercial 3A molecular sieve might offer an opportunity for saving more energy in dehydration processes.
RESUMEN
Human papillomavirus (HPV) is one of the most common sexually transmitted infections worldwide. The HPV vaccination has been widely advocated around the world since the vaccine is beneficial in avoiding diseases, including some sexually transmitted diseases, brought on by HPV infections. For most Chinese, the HPV vaccine is still a relatively new concept, having only been made available to the general public in 2016. Despite the vaccine's increased prominence, there is still a lack of investigation about how the public is influencing the conversation about HPV vaccines and the public's perception of this vaccine. With the theoretical construct of the Health Belief Model, this study conducts both quantitative and qualitative content analysis to investigate the existing media narratives around HPV vaccines in China and the changes in public opinion by looking at users' contributions on Weibo, one of China's most popular social networking sites. It was found that different groups of Weibo users had contributed to diverse narratives surrounding HPV vaccination. Though the public awareness of HPV vaccination had been improved along with increasingly active communication practices and enhanced public health services, public knowledge about HPV remains inadequate. Therefore, to facilitate the popularisation of HPV related knowledge, more effort should be invested in tailoring and disseminating messages that communicate responsive and comprehensive HPV related information.
RESUMEN
Single-cell sequencing technologies have noteworthily improved our understanding of the genetic map and molecular characteristics of bladder cancer (BC). Here we identify CD39 as a potential therapeutic target for BC via single-cell transcriptome analysis. In a subcutaneous tumor model and orthotopic bladder cancer model, inhibition of CD39 (CD39i) by sodium polyoxotungstate is able to limit the growth of BC and improve the overall survival of tumor-bearing mice. Via single cell RNA sequencing, we find that CD39i increase the intratumor NK cells, conventional type 1 dendritic cells (cDC1) and CD8 + T cells and decrease the Treg abundance. The antitumor effect and reprogramming of the tumor microenvironment are blockaded in both the NK cells depletion model and the cDC1-deficient Batf3-/- model. In addition, a significant synergistic effect is observed between CD39i and cisplatin, but the CD39i + anti-PD-L1 (or anti-PD1) strategy does not show any synergistic effects in the BC model. Our results confirm that CD39 is a potential target for the immune therapy of BC.
Asunto(s)
Microambiente Tumoral , Neoplasias de la Vejiga Urinaria , Ratones , Animales , Neoplasias de la Vejiga Urinaria/metabolismo , Linfocitos T CD8-positivos , Células Dendríticas , Células Asesinas Naturales , Línea Celular TumoralRESUMEN
A resonant fiber-optic gyroscope (RFOG) based on a broadband source can avoid the fundamental drawback of coherence detection processing while possessing the greater sensitivity afforded by the finesse of the fiber-optic ring resonator. In this paper, the basic operation principle is presented and demonstrated in detail, and various noise sources, as well as the temperature effect encountered in this broadband source-driven RFOG, are studied and analyzed. Then a combined modulation technique is proposed to suppress the residual backscattering noise. To further reduce the effect of temperature transience, an asymmetric fiber ring resonator is designed. In the experiment, a bias stability of 0.01°/h is successfully demonstrated with a 100 m-long fiber ring resonator of 8 cm diameter in a laboratory environment without temperature control.
RESUMEN
A broadband source-driven resonant fiber-optic gyroscope (RFOG) can reduce coherence-related noise, thus achieving a better sensitivity with a much simpler configuration than the traditional system with a coherent source. Its detection sensitivity, however, is still limited by the excess relative intensity noise (RIN) of the broadband source. In this paper, the RIN error mechanism in this broadband source-driven RFOG is revealed and countermeasures are presented. We demonstrate that the use of a high-finesse fiber-optic ring resonator and a high-frequency modulation-demodulation technique can reduce the RIN-induced error. It is indicated that the optimal modulation parameters can provide a RIN-induced error reduction of 6.1â dB, allowing the broadband source-driven RFOG to operate near the shot-noise-limited theoretical sensitivity. With the optimal high-frequency modulation-demodulation technique, an angle random walk of 0.0013°/âh is achieved with a 200-m-long fiber-optic ring resonator of 7.6â cm diameter. This is the best result reported to date, to the best of our knowledge, for fiber-optic gyroscopes of this size.
RESUMEN
A resonant fiber optic gyroscope (RFOG) using a reciprocal modulation and double demodulation technique based on a single laser source is proposed and demonstrated. The effect of the residual amplitude modulation of the phase modulator is well suppressed thanks to the reciprocal modulation and demodulation. On this basis, the backscattering noise is also eliminated by the double demodulation process. The long-term bias stability of the RFOG is successfully improved to 0.2°/h for a test time of 45 hours.
RESUMEN
Zeolite nanosheets with excellent mass transfer are attractive, but their successful syntheses are normally resulted from a huge number of experiments. Here, we show the design of a small organic template for the synthesis of self-pillared pentasil (SPP) zeolite nanosheets from theoretical calculations in interaction energies between organic templates and pentasil zeolite skeletons. As expected, the SPP zeolite nanosheets with the thickness at 10-20 nm have been synthesized successfully. Characterizations show that the SPP zeolite nanosheets with about 90% MFI and 10% MEL structures have good crystallinity, the house-of-card morphology, large surface area, and fully four-coordinated aluminum species. More importantly, methanol-to-propylene tests show that the SPP zeolite nanosheets exhibit much higher propylene selectivity and longer reaction lifetime than conventional ZSM-5 zeolite. These results offer a good opportunity to develop highly efficient zeolite catalysts in the future.
RESUMEN
Diabetes produces a chronic inflammatory state that contributes to the development of vascular disease and impaired wound healing. Despite the known individual and societal impacts of diabetic ulcers, there are limited therapies effective at improving healing. Stromal cell-derived factor 1α (SDF-1α) is a CXC chemokine that functions via activation of the CXC chemokine receptor type 4 (CXCR4) receptor to recruit hematopoietic cells to locations of tissue injury and promote tissue repair. The expression of SDF-1α is reduced in diabetic wounds, suggesting a potential contribution to wound healing impairment and presenting the CXCR4 receptor as a target for therapeutic investigations. We developed a high-throughput ß-arrestin recruitment assay and conducted structure-activity relationship (SAR) studies to screen compounds for utility as CXCR4 agonists. We identified CXCR4 agonist UCUF-728 from our studies and further validated its activity in vitro in diabetic fibroblasts. UCUF-728 reduced overexpression of miRNA-15b and miRNA-29a, negative regulators of angiogenesis and type I collagen production, respectively, in diabetic fibroblasts. In vivo, UCUF-728 reduced the wound closure time by 36% and increased the evidence of angiogenesis in diabetic mice. Together, this work demonstrates the clinical potential of small molecule CXCR4 agonists as novel therapies for pathologic wound healing in diabetes.
Asunto(s)
Diabetes Mellitus Experimental , Receptores CXCR4 , Cicatrización de Heridas , Animales , Quimiocina CXCL12/metabolismo , Diabetes Mellitus Experimental/tratamiento farmacológico , Ratones , MicroARNs , Neovascularización Fisiológica , Receptores CXCR4/agonistas , Receptores CXCR4/metabolismoRESUMEN
Genetic analyses indicated that the pandemic H1N1/2009 influenza virus originated from a swine influenza virus (SIV). However, SIVs bearing the same constellation of genetic features as H1N1/2009 have not been isolated. Understanding the adaptation of SIVs with such genotypes in a new host may provide clues regarding the emergence of pandemic strains such as H1N1/2009. In this study, an artificial SIV with the H1N1/2009 genotype (rH1N1) was sequentially passaged in mice through two independent series, yielding multiple mouse-adapted mutants with high genetic diversity and increased virulence. These experiments were meant to mimic genetic bottlenecks during adaptation of wild viruses with rH1N1 genotypes in a new host. Molecular substitutions in the mouse-adapted variants mainly occurred in genes encoding surface proteins (hemagglutinin [HA] and neuraminidase [NA]) and polymerase proteins (polymerase basic 2 [PB2], polymerase basic 1 [PB1], polymerase acid [PA] proteins and nucleoprotein [NP]). The PB2D309N and HAL425M substitutions were detected at high frequencies in both passage lines and enhanced the replication and pathogenicity of rH1N1 in mice. Moreover, these substitutions also enabled direct transmission of rH1N1 in other mammals such as guinea pigs. PB2D309N showed enhanced polymerase activity and HAL425M showed increased stability compared with the wild-type proteins. Our findings indicate that if SIVs with H1N1/2009 genotypes emerge in pigs, they could undergo rapid adaptive changes during infection of a new host, especially in the PB2 and HA genes. These changes may facilitate the emergence of pandemic strains such as H1N1/2009.