[Risk factors associated with adherence to medical oncology treatment in pediatrics]. / Factores de riesgos asociados a la adherencia al tratamiento médico oncológico en pediatría.

In Chile, between 450 and 500 cases of cancer are diagnosed annually in children and adolescents. Treatment is financed by the state, but there are non-financial elements that could condition adherence to treatment. OBJECTIVE: to explore family, socioeconomic, housing, and support network risk factors that could affect adherence to medical treatment in children and adolescents diagnosed with cancer. PATIENTS AND METHOD: Descriptive observational study in pediatric oncology hospitals of a national cancer program. Through a "Social Care Form" applied to 104 caregivers of children and adolescents, between August 2019 and March 2020, socioeconomic data of children diagnosed with cancer were recorded in four dimensions: i) Individual/family/health; ii) Work/education/socioeconomic; iii) Housing/environment; and iv) Participation/support networks. RESULTS: 99% of the children and adolescents were registered in the public health system; 69% belonged to the lowest income brackets. Care for children and adolescents was mainly provided by the mother (91%). 79% reported living in a house; 48% owned or were paying for their home. Housing quality was described as good (70%), with low levels of overcrowding. 56% of households had access to Wi-Fi internet connection, while 27% reported no access. The main support network reported was the family (84%). CONCLUSIONS: Family, socioeconomic, housing, and support network risk factors were observed in children and adolescents diagnosed with cancer; socioeconomic and gender aspects highlight the social inequalities in these families. Descriptive baseline results were obtained, so it is suggested to re-observe its evolution and thus measure its impact on adherence to treatment.

Nasal eosinophilic angiocentric fibrosis with IgG4-positive plasma cell infiltration.

INTRODUCTION: Eosinophilic angiocentric fibrosis (EAF) is a rare lesion that predominantly affects the upper respiratory tract. Its etiology is unknown and it has been recently associated with the IgG4- related disease (IgG4-RD) spectrum. To the author's knowledge, this is the sixth case report of the relationship between EAF and IgG4-RD. CASE REPORT: We report the case of a 37-year-old woman with nasal deformity and facial pain. The lesion was surgically excised. Histological examination revealed features of EAF with an IgG4/IgG plasma cell ratio ≷73% and 31 IgG4 stained cells per high power field. No clinical or radiological recurrence was detected during follow-up. Serum IgG4 quantification one year after surgery was within normal limits. DISCUSSION: The relationship between both entities may have therapeutic impact because IgG4-RD of the head and neck has a high remission rate with corticosteroids and immunosuppressive therapy. Additional reports of this infrequent disease are necessary to elucidate appropriate treatment and prognosis.

Nasal eosinophilic angiocentric fibrosis with IgG4-positive plasma cell infiltration

@#Introduction: Eosinophilic angiocentric fibrosis (EAF) is a rare lesion that predominantly affects the upper respiratory tract. Its etiology is unknown and it has been recently associated with the IgG4related disease (IgG4-RD) spectrum. To the author’s knowledge, this is the sixth case report of the relationship between EAF and IgG4-RD. Case Report: We report the case of a 37-year-old woman with nasal deformity and facial pain. The lesion was surgically excised. Histological examination revealed features of EAF with an IgG4/IgG plasma cell ratio >73% and 31 IgG4 stained cells per high power field. No clinical or radiological recurrence was detected during follow-up. Serum IgG4 quantification one year after surgery was within normal limits. Discussion: The relationship between both entities may have therapeutic impact because IgG4-RD of the head and neck has a high remission rate with corticosteroids and immunosuppressive therapy. Additional reports of this infrequent disease are necessary to elucidate appropriate treatment and prognosis.

Estudio experimental de la aplicación de un nuevo cemento óseo cargado con antibióticos de amplio espectro para el tratamiento de la infección ósea / Experimental study of the application of a new bone cement loaded with broad spectrum antibiotics for the treatment of bone infection

Objetivos: Valorar el comportamiento histológico, en un modelo animal de conejo, de un nuevo cemento óseo modificado, el cual aumenta la liberación local de antibiótico, en la infección ósea. Material y métodos: Se han utilizado 16 conejos Nueva Zelanda divididos en 4 grupos, en función del cemento (comercial o experimental) y del antibiótico (vancomicina o linezolid) empleados para controlar una infección ósea por Staphylococcus aureus. El cemento comercial es Palacos(R) R y el cemento experimental se ha conseguido añadiendo PLGA a la fase sólida del cemento Palacos(R) R. Se ha empleado un método de estadificación histológica novedoso, basado en la histoarquitectura ósea. Esta estadificación nos permite tener una visión global de la capacidad de reparación ósea, en presencia del cemento modificado, así como correlacionar el daño generado con la funcionalidad del tejido. Resultados: El grado de desestructuración ósea encontrado depende del tipo de cemento y del antibiótico, siendo mayor en los grupos con cemento comercial respecto al experimental (p<0,01) y en los grupos con linezolid respecto a vancomicina (p=0,04). El porcentaje de macrófagos varía exclusivamente en función del antibiótico utilizado, siendo mayor en los grupos con vancomicina respecto a linezolid (p=0,04). Discusión: El desarrollo de nuevas formulaciones de cemento óseo que liberan mayor cantidad, y de forma más prolongada, de antibióticos de nueva generación como el linezolid presentan un comportamiento in vivo superior al cemento comercial, respetando más la estructura ósea. Este comportamiento tendría una implicación clínica para combatir las infecciones por gérmenes cada vez más resistentes y prevenir la colonización de los espaciadores de cemento usados habitualmente en el tratamiento de la infección protésica

Objectives: To evaluate the in vivo behaviour of a new bone cement loaded with antibiotics, in a rabbit bone infection model. Material and methods: Sixteen New Zealand rabbits divided into 4 groups were used, depending on the cement (commercial or experimental) and the antibiotic (vancomycin or linezolid) used to control a bone infection caused by Staphylococcus aureus. The commercial cement is Palacos(R) R and the experimental cement has been achieved by adding PLGA to the solid phase of Palacos(R) R cement. A novel histological staging method based on bone histoarchitecture has been used. This staging allows us a global vision of bone repair capacity, in the presence of modified cement, and also allows us to correlate the damage generated with the functionality of the tissue. Results: The degree of bone destructuration found depended on the type of cement and antibiotic, and was higher in the groups with commercial cement than in the experimental group (P<.01) and in the groups with linezolid with respect to vancomycin (P=.04) The percentage of macrophages varied exclusively depending on the antibiotic used, and was higher in the vancomycin groups (P=.04). Discussion: The development of new formulations of bone cement that release more, and more prolonged, new generation antibiotics such as linezolid, present an in vivo behaviour superior to commercial cement, respecting the bone structure. This behaviour would have a clinical implication in fighting infections by increasingly resistant germs in the treatment of prosthetic infection

Experimental study of the application of a new bone cement loaded with broad spectrum antibiotics for the treatment of bone infection. / Estudio experimental de la aplicación de un nuevo cemento óseo cargado con antibióticos de amplio espectro para el tratamiento de la infección ósea.

OBJECTIVES: To evaluate the in vivo behaviour of a new bone cement loaded with antibiotics, in a rabbit bone infection model. MATERIAL AND METHODS: Sixteen New Zealand rabbits divided into 4 groups were used, depending on the cement (commercial or experimental) and the antibiotic (vancomycin or linezolid) used to control a bone infection caused by Staphylococcus aureus. The commercial cement is Palacos® R and the experimental cement has been achieved by adding PLGA to the solid phase of Palacos® R cement. A novel histological staging method based on bone histoarchitecture has been used. This staging allows us a global vision of bone repair capacity, in the presence of modified cement, and also allows us to correlate the damage generated with the functionality of the tissue. RESULTS: The degree of bone destructuration found depended on the type of cement and antibiotic, and was higher in the groups with commercial cement than in the experimental group (P<.01) and in the groups with linezolid with respect to vancomycin (P=.04) The percentage of macrophages varied exclusively depending on the antibiotic used, and was higher in the vancomycin groups (P=.04). DISCUSSION: The development of new formulations of bone cement that release more, and more prolonged, new generation antibiotics such as linezolid, present an in vivo behaviour superior to commercial cement, respecting the bone structure. This behaviour would have a clinical implication in fighting infections by increasingly resistant germs in the treatment of prosthetic infection.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Development of advanced biantibiotic loaded bone cement spacers for arthroplasty associated infections.

The incidence increase of infections in patients with hip or knee implants with resistant pathogens (mainly some S. coagulase-negative and gram positive bacteria) demands advanced antibiotic loaded formulations. In this paper, we report the design of new biantibiotic acrylic bone cements for in situ delivery. They include a last generation antibiotic (daptomycin or linezolid) in combination with vancomycin and are performed based on a novel modification of the Palacos R® acrylic bone cement, which is based on two components, a liquid (methyl methacrylate) and a solid (polymeric phase). Hence, the solid component of the experimental formulations include 45wt% of microparticles of poly(D,L-lactic-co-glycolic) acid, 55wt% of poly(methyl methacrylate) beads and supplements (10wt-% each) of antibiotics. These formulations provide a selective and excellent control of the local release of antibiotics during a long time period (up to 2 months), avoiding systemic dissemination. The antimicrobial activity of the advanced spacers tested against S. aureus shows that single doses would be enough for the control of the infection. In vitro biocompatibility of cements on human osteoblasts is ensured. This paper is mainly focused on the preparation and characterization of cements and the studies of elution kinetics and bactericidal effects. Developed formulations are proposed as spacers for the treatment of infected arthroplasties, but also, they could be applied in other antibiotic devices to treat relevant bone-related infection diseases.

Soporte nutricional en la primera semana post operatoria en niños menores de 3 meses que requieren cirugía cardiovascular / Nutritional support in the first postoperative week in children under 3 months of age requiring cardiovascular surgery

El periodo post operatorio a la cirugía cardiaca es complejo y la nutrición juega un rol fundamental dentro de los cuidados. Luego de una cirugía que requiere bypass cardiopulmonar, los neonatos experimentan una profunda respuesta metabólica al stress. Si esta respuesta ocurre sin un soporte nutricional adecuado, la malnutrición lleva a la pérdida de masa magra y al deterioro de la función de órganos vitales. Objetivo: Describir el estado nutricional y el aporte nutricional alcanzado en niños menores de 3 meses con cirugía cardiovascular durante la implementación de un programa de soporte nutricional intensivo evaluado al ingreso, al tercer y séptimo día post operatorio. Resultados: Se estudiaron 64 pacientes. Se logró la implementación de nutrición parenteral total (NPT) en todos los pacientes que ingresaron al protocolo y que requirieron nutrición parenteral. El promedio de volumen recibido en este periodo fue de 50 ml/kg/día (rango entre 25 y 80 ml/kg/día).Las evaluaciones al ingreso, a las 72 hs. y a la semana post operatoria mostraron que el 70%, 69%y 62,7% respectivamente de los pacientes no llegaron a las 67 kcal/kg/ día propuestas para la intervención nutricional para nuestro objetivos. Por el contrario se encontró que el aporte energético enteral y parenteral administrado en los 3 tiempos estudiados logró cubrir el 100% de los requerimientos metabólicos en reposo (REE) estimados por las fórmulas de Schofield y WHO con resultados similares sin diferencias significativas entre ambas. Conclusión: a pesar de no haber logrado cumplir con el objetivo nutricional calórico propuesto por nuestra intervención nutricional, el mismo logro cubrir el 100% del REE calculado por fórmulas (AU)

The postoperative period after heart surgery is complex and nutrition has a key role in the care process. After a surgery that requires cardiopulmonary bypass, neonates have a severe metabolic response to stress. If this response occurs without adequate nutritional support, malnourishment leads to loss of lean body mass and deterioration of vital organ function. Aim: To describe the nutritional status and nutritional support achieved in infants under 3 months of age who underwent cardiovascular surgery during the implementation of an intensive nutritional support program evaluated on admission and on the third and seventh day postoperatively. Results: Overall, 64 patients were studied. The implementation of total parenteral nutrition (TPN) was achieved in all patients that were included in the protocol and required parenteral nutrition. Median volume administered in this period was 50 ml/kg/day (range, from 25 and 80 ml/kg/day). Evaluation on admission, at 72 hs. and at 1 week postoperatively showed that 70%, 69%, and 62.7% of the patients, respectively, did not achieve the 67 kcal/kg/day proposed as the aim for the nutritional intervention. Conversely, it was found that enteral and parenteral energy delivery administered in the three time points was able to cover 100% of the resting energy expenditure (REE) calculated by the Schofield and WHO formalas with similar results without significant differences. Conclusion: Although the nutritional caloric aim a proposed by our nutritional intervention could not be reached, it was able to cover 100% of the REE calculated using the formulas (AU)

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

INTRODUCTION: Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (ß-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and ß-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . METHODS: Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. ß-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δß-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. RESULTS: In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a ß-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a ß-thal mutation Cd39, IVS1:110, and Spanish δß-thal. CONCLUSION: α-thal is relatively common in Mexican patients, the combination with ß-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and ß-genes defects in patients showing microcytic hypochromic anemia.

EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population.

Epidermal growth factor receptor (EGFR) is a transmembrane glycoprotein with tyrosine-kinase activity that plays an important role in multiple cellular functions. EGFR overexpression has been observed in several types of tumors and it is significantly associated with disease stage, survival, prognosis, and progression of cancer. The polymorphisms -216G>T, -191C>A, and (CA)n first intervening sequence (IVS1) have been related to EGFR overexpression and have been studied in several types of cancer, but not in gastric cancer (GC). The aim of this study was to determine the association of these 3 polymorphisms and GC. Genomic DNA from 68 GC patients and 102 healthy blood donors were analyzed. Polymorphisms were identified by DNA-sequencing (-216G>T and -191C>A) and GeneScan (CA)n IVS1. The results showed that the distribution of the -216G>T and -191C>A genotypes differed between groups (P < 0.05). The odds ratio for the -216TT genotype was 4.59 (95% confidence interval = 1.55-13.54, P < 0.05) and 10.71 (95% confidence interval = 2.31-49.59, P < 0.05) for the -191AA genotype, both in a recessive model. The genotype and allele distributions of the (CA)n IVS1 repeat was similar in both groups. In conclusion, the -216TT and -191AA genotypes and GA haplotype of the EGFR gene were found to be associated with an increased risk of gastric cancer in a Mexican population.

5' and 3' ß-globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups.

OBJECTIVE: The purpose of this study was to determine the ß-globin cluster haplotype variability of two Mexican indigenous groups-Purepechas (PUR) and Tarahumaras (TAR)-and their relationship with other world populations. METHODS: The 5' and 3' haplotypes (Hp) of the ß globin cluster in 71 PUR and 53 TAR individuals were analyzed. Five polymorphisms in the 5'Hp (ε, (G) γ, (A) γ, 5'ψß and 3'ψß) and five in the 3'Hp (IVS2: 16, 46, 74, 81 and 3' end +339) were identified by restriction enzymes and direct DNA sequencing. 5'Hp and 3'Hp frequencies in PUR and TAR were compared with reported frequencies from 47 and 10 worldwide populations, respectively. RESULTS: Sixteen different 5'Hps were observed in the indigenous Mexican groups, 11 in each population, with the most common being 5'Hp 1. Eight 3'Hps were detected, seven in PUR and six in TAR, the most frequent being 3'Hp C. Three new 3'Hps were found, A8 (CTGCT) in both populations, C9 (GTGCA) in TAR and E1 (GTTCT) in PUR. The comparative analysis showed that 5'Hp frequencies in PUR were significantly different than those in all populations except the Brazilian-Guarani, while TAR were significantly similar to Aché and North Han Chinese. 3'Hp frequencies were similar between PUR and TAR, as well as with Nuu-Chah-Nulth, Mongolian and Sumatran populations. CONCLUSIONS: The 5'Hp analysis showed great variability in worldwide populations, including PUR and TAR, while 3'Hp frequencies were similar among indigenous Mexican and other populations with Asiatic origins. This suggests that 5'Hp exposes the microevolutionary process of each population and the 3'Hp establishes genetic relationships among populations.

Madelung's deformity and possible Léri-Weill dyschondrosteosis: Two cases from a Late Intermediate period tomb, Ancash, Peru.

Two individuals with bilateral Madelung's deformity were identified in a Late Intermediate period comingled tomb at the northern highland site of Marcajirca, Ancash, Peru (ca. AD 1250). Comparisons of the size and robusticity of the radii and ulnae suggest the individuals represent a male and a female. The difference in the severity of the changes is thought to represent variability in the expression of the deformity seen in males and females in clinical cases. Three comparatively short, thick tibiae were also recovered from this tomb, which may suggest that the individuals demonstrate Léri-Weill dyschondrosteosis, a type of dwarfism characterized by mesomelic shortening. These are the first examples of Madelung's deformity to be described from an archaeological context in South America and offer an insight into the use of tombs (chullpas) in Late Intermediate period Ancash.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.

Impact of blood pressure changes and course on hematoma growth in acute intracerebral hemorrhage.

BACKGROUND AND PURPOSE: An association between high blood pressure (BP) in acute intracerebral hemorrhage (ICH) and hematoma growth (HG) has not been clearly demonstrated. Therefore, the impact of BP changes and course on HG and clinical outcome in patients with acute ICH was determined. METHODS: In total, 117 consecutive patients with acute (<6 h) supratentorial ICH underwent baseline and 24-h CT scans, CT angiography for the detection of the spot sign and non-invasive BP monitoring at 15-min intervals over the first 24 h. Maximum and minimum BP, maximum BP increase and drop from baseline, and BP variability values from systolic BP (SBP), diastolic BP and mean arterial pressure (MAP) were calculated. SBP and MAP loads were defined as the proportion of readings >180 and >130 mmHg, respectively. HG (>33% or >6 ml), early neurological deterioration (END) and 3-month mortality were recorded. RESULTS: Baseline BP variables were unrelated to either HG or clinical outcome. Conversely, SBP 180-load independently predicted HG (odds ratio 1.05, 95% CI 1.010-1.097, P = 0.016), whilst both SBP 180-load (odds ratio 1.04, 95% CI 1.001-1.076, P = 0.042) and SBP variability (odds ratio 1.2, 95% CI 1.047-1.380, P = 0.009) independently predicted END. Although none of the BP monitoring variables was associated with HG in the spot-sign-positive group, higher maximum BP increases from baseline and higher SBP and MAP loads were significantly related to HG in the spot-sign-negative group. CONCLUSIONS: In patients with acute supratentorial ICH, SBP 180-load independently predicts HG, whilst both SBP 180-load and SBP variability predict END.

Usefulness of antimicrobial susceptibility in the eradication of Helicobacter pylori.

The rate of eradication of Helicobacter pylori with standard triple therapy using omeprazole, amoxicillin and clarithromycin (OAC) is unacceptable in populations with high rates of clarithromycin resistance (15-20%). The aim of this study was to compare the efficacy of 10-day OAC therapy as the first-line treatment in patients diagnosed by culture with antimicrobial susceptibility or diagnosed by a (13) C-labelled urea breath test (UBT) without antimicrobial susceptibility in an area where the clarithromycin resistance rate was 15-20%. This was a retrospective cohort study of 266 patients, recruited consecutively throughout 2008. A total of 247 H. pylori-infected patients received antibiotic therapy (221 received the 10-day OAC therapy and 26 received other regimens) of which 134 patients were diagnosed by culture of gastric samples followed by antimicrobial susceptibility testing and 113 were diagnosed by UBT. In all patients, the eradication of H. pylori was checked by UBT. The cost of eradication by 10-day OAC treatment was assessed in each patient. The success rate of 10-day OAC therapy in patients diagnosed by culture and by UBT was 88% (103/117) and 49% (51/104), respectively (p <0.0005). The treatment was also more cost-effective in the former of these two groups (€571 versus €666). To perform culture and antimicrobial susceptibility of the H. pylori isolates was a more successful and cost effective strategy than empirical 10-day OAC treatment in populations with high rates of resistance to clarithromycin.

Wayward effect of polymorphism (TA)8 in the promoter region of UGT1A1 gene in a Mexican family.

Gilbert syndrome (GS) is a hereditary relatively common benign unconjugated hyperbilirubinaemia. The promoter region of uridine diphosphate glycosyltransferase 1 (UGT1A1) gene contains a normal A (TA)6TAA element; variations in this motif (A(TA)7/8TAA) are generally associated with this disorder This is a report of the varied effects of GS in a Mexican Mestizo family with a non-common (TA)8 repeat in this population. The proposita and her mother showed (TA)7/(TA)8 genotype, while her father and sister were (TA)6/(TA)7, but only the proposita showed clinical manifestations. This report supports that the (TA)7 and (TA)8 are necessary, but not enough to explain the features of GS. There are probably additional genetic variations ie, the presence of "modifier" genes or one can speculate that an oligogenetic trait can contribute to the expression of the final phenotype.

Involvement of thermophilic archaea in the biocorrosion of oil pipelines.

Two thermophilic archaea, strain PK and strain MG, were isolated from a culture enriched at 80°C from the inner surface material of a hot oil pipeline. Strain PK could ferment complex organic nitrogen sources (e.g. yeast extract, peptone, tryptone) and was able to reduce elemental sulfur (S°), Fe(3+) and Mn(4+) . Phylogenetic analysis revealed that the organism belonged to the order Thermococcales. Incubations of this strain with elemental iron (Fe°) resulted in the abiotic formation of ferrous iron and the accumulation of volatile fatty acids during yeast extract fermentation. The other isolate, strain MG, was a H(2) :CO(2) -utilizing methanogen, phylogenetically affiliated with the genus Methanothermobacter family. Co-cultures of the strains grew as aggregates that produced CH(4) without exogenous H(2) amendment. The co-culture produced the same suite but greater concentrations of fatty acids from yeast extract than did strain PK alone. Thus, the physiological characteristics of organisms both alone and in combination could conceivably contribute to pipeline corrosion. The Thermococcus strain PK could reduce elemental sulfur to sulfide, produce fatty acids and reduce ferric iron. The hydrogenotrophic methanogen strain MG enhanced fatty acid production by fermentative organisms but could not couple the dissolution Fe° with the consumption of water-derived H(2) like other methanogens.

Wayward effect of polymorphism (TA)8 in the promoter region of UGT1A1 gene in a Mexican family / Efecto caprichoso del polimorfismo (TA)8 en la región del promotor del gene UGT1A1 en una familia mexicana

Gilbert syndrome (GS) is a hereditary relatively common benign unconjugated hyperbilirubinaemia. The promoter region of uridine diphosphate glycosyltransferase 1 (UGT1A1) gene contains a normal A(TA)6 TAA element; variations in this motif (A(TA)7/8 TAA) are generally associated with this disorder. This is a report of the varied effects of GS in a Mexican Mestizo family with a non-common (TA)8 repeat in this population. T he proposita and her mother showed (TA)7 /(TA)8 genotype, while her father and sister were (TA)6 /(TA)7 , but only the proposita showed clinical manifestations. This report supports that the (TA)7 and (TA)8 are necessary, but not enough to explain the features of GS. There are probably additional genetic variations ie, the presence of "modifier" genes or one can speculate that an oligogenetic trait can contribute to the expression of the final phenotype.

El síndrome de Gilberto (SG) es un hiperbilirubinemia no conjugada, benigna, relativamente común y hereditaria. La región promotora del gen (UGT1A1) de la uridina difosfato glicosiltransferasa 1, contiene un elemento normal A (TA)6 TAA. Las variaciones en este motivo (A (TA)7/8 TAA) se encuentran por lo general asociadas con este desorden. Éste es un reporte de los variados efectos del SG en una familia mestiza mexicana con una repetición (TA)8 no común en esta población. La probando y su madre mostraron el genotipo (TA)7 /(TA)7 , mientras su padre y hermana eran (TA)6 /(TA)7 , pero sólo la probando mostró manifestaciones clínicas. Este informe sostiene que el (TA)7 y (TA)8 son necesarios, pero no suficientes para explicar los rasgos del SG. Probablemente hay variaciones genéticas adicionales, es decir, la presencia de genes "modificadores", o se puede especular que un rasgo oligogenético puede contribuir a la expresión del fenotipo final.

Ultraearly hematoma growth predicts poor outcome after acute intracerebral hemorrhage.

OBJECTIVE: To investigate the impact of the adjustment of initial intracerebral hemorrhage (ICH) volume by onset-to-imaging time (ultraearly hematoma growth [uHG]) on further hematoma enlargement and outcome in patients with acute ICH. METHODS: We studied 133 patients with acute (<6 hours) supratentorial ICH. Patients underwent baseline and 24-hour CT scans for ICH volume measurement, and a CT angiography (CTA) for the detection of the spot sign. We defined uHG as the relation between baseline ICH volume/onset-to-imaging time, hematoma growth (HG) as hematoma enlargement >33% or >6 mL at 24 hours, early neurologic deterioration (END) as increase ≥4 points in the NIH Stroke Scale score or death at 24 hours, and poor long-term outcome as modified Rankin Scale score >2 at 3 months. RESULTS: The uHG was significantly faster in spot sign patients (p < 0.001), as well as in patients who experienced HG (p = 0.021), END (p < 0.001), 3-month mortality (p < 0.001), and poor long-term outcome (p < 0.001). The uHG improved the accuracy of baseline ICH volume in the prediction of END (sensitivity 93.1% vs 82.8%, specificity 85.3% vs 82.4%) and 3-month mortality (sensitivity 77.5% vs 70%, specificity 87.9% vs 84.6%). A uHG >10.2 mL/hour emerged as the most powerful predictor of HG (odds ratio [OR] 3.55, 95% confidence interval [CI] 1.39-9.07, p = 0.008), END (OR 70.22, 95% CI 14.63-337.03, p < 0.001), 3-month mortality (OR 16.96, 95% CI 5.32-54.03, p < 0.001), and poor long-term outcome (OR 6.19, 95% CI 1.32-28.98, p = 0.021). CONCLUSIONS: The uHG represents a powerful and easy-to-use tool for improving the prediction of HG and outcome in patients with acute ICH.

Single centrosome manipulation reveals its electric charge and associated dynamic structure.

The centrosome is the major microtubule-organizing center in animal cells and consists of a pair of centrioles surrounded by a pericentriolar material. We demonstrate laser manipulation of individual early Drosophila embryo centrosomes in between two microelectrodes to reveal that it is a net negatively charged organelle with a very low isoelectric region (3.1 +/- 0.1). From this single-organelle electrophoresis, we infer an effective charge smaller than or on the order of 10(3) electrons, which corresponds to a surface-charge density significantly smaller than that of microtubules. We show, however, that the charge of the centrosome has a remarkable influence over its own structure. Specifically, we investigate the hydrodynamic behavior of the centrosome by measuring its size by both Stokes law and thermal-fluctuation spectral analysis of force. We find, on the one hand, that the hydrodynamic size of the centrosome is 60% larger than its electron microscopy diameter, and on the other hand, that this physiological expansion is produced by the electric field that drains to the centrosome, a self-effect that modulates its structural behavior via environmental pH. This methodology further proves useful for studying the action of different environmental conditions, such as the presence of Ca(2+), over the thermally induced dynamic structure of the centrosome.