The power of human cytomegalovirus (HCMV) hijacked UL/b' functions lost in vitro.

Viruses have evolved sophisticated strategies to subvert immunity to benefit overall viral fitness. Human cytomegalovirus (HCMV, ß-herpesvirus) represents a paradigm of very effective hijacking of gene functions that imitate host encoded immunomodulatory proteins. This co-evolution with the host immune system allowed for establishment of lifelong persistence. The HCMV infection is largely asymptomatic in healthy persons; however, it can induce serious disease in immunocompromised individuals. For this reason, great attention is paid to the development of therapeutics based on HCMV immunomodulatory 'tricks' as well as to the search for active vaccine against HCMV. While comparing the HCMV clinical isolates with extensively passaged laboratory strains, the unique long (UL) b' locus was commonly found to be deleted in HCMV genome while adapted to replication in human fibroblasts in vitro. This missing region, called UL/b' region, encodes up to 22 canonical genes with different functions, as of targeting cellular tropism (e.g. UL133-UL138); viral entry and assembly (e.g. UL128, UL130, UL131A); regulation of immunological synapses (e.g. UL135); inhibition of NK and T cell function (e.g. UL141, UL142, UL148, UL144), ablating activity (e.g. UL146, UL147), but mainly aimed at manipulating the host immune response. Moreover, the presence of UL/b' genomic region dramatically correlates with adverse effects in vaccinated persons, indicating that viral genes in this region play a significant role in controlling virulence. Here, we review how HCMV shapes our immunity by hijacked genes originated from UL/b' locus, discuss their impact in immunomodulation mechanism and how this knowledge may translate to clinical applications. Keywords: immunomodulation; HCMV genes; UL/b' locus; NK cell function; HCMV vaccine; immunity; immunotherapeutics.

T cells and their function in the immune response to viruses.

The development of CD4+ T helper cells is determined by the set of transcription factors and the genes these transcription factors transcribe. In this review, we describe the basic nature of Th1, Th2, Th9, Th17, T-follicular helper (Tfh), gamma delta (γδ) T cells, and T-regulatory (Treg) cells subsets, their master regulator transcription factors and their corresponding signature cytokine production profiles. Cellular immunity plays important role during virus infection. Optimal immune response to viral infections require a gentle balance of effector responses to clear the infected cells and regulatory mechanism to prevent  immunopathology. The behavior of the helper cells differs with each virus - while in some cases, the response is beneficial; in other cases, it is harmful. We discuss the protective and pathological role of T cell immunity against influenza A virus (IAV), respiratory syncytial virus (RSV), immunodeficiency virus type 1 (HIV-1), and hepatitis B virus (HBV) infection. Keywords: T cell; cytokine; influenza virus; respiratory syncytial virus; hepatitis B virus; human immunodeficiency virus type 1.

Chemokine-binding proteins encoded by herpesviruses.

To establish infection, a wide variety of pathogens, including viruses, have evolved a number of strategies to avoid immune elimination. Viruses have acquired and optimized molecules that interact with the host chemokine network in order to disrupt immune surveillance and defense of vertebrates, helping to promote cell entry, facilitating dissemination of infected cells, and evasion the immune response. Viral immunomodulators include ligands, chemokine receptors and chemokine-binding proteins (vCKBPs) functioning as either cell surface receptor mimics, ligand mimics, or secreted chemokine-binding proteins. vCKBPs specifically modulate chemokine gradient formation and ligand-receptor recognition when they have a potential to even completely block chemokine-mediated responses to viral infection. Members of only two virus families (Herpesviridae and Poxviridae) encode vCKBPs capable of sequestering host chemokines through either the chemokine receptor, GAG-binding pocket, or both, which may result in the inhibition of chemotaxis in vivo. Here, we focused on vCKBPs encoded by α-, ß-, and γ-herpesviruses, of which several have been experimentally used as anti-inflammatory or anti-immune reagents in animal models. Current results suggest that vCKBPs could be used to regulate the activity of both chemokines and chemokine receptors for the treatment of infections such as AIDS, diseases such as arthritis, neurotrauma, inflammatory CNS disorders, atherosclerosis, transplant rejection, and metastatic spread and angiogenesis. Better understanding of vCKBPs biology will help evaluate, which human diseases related to chemokine network dysregulation might be effectively treated with these novel promising immunomodulatory drugs to enable the manipulation of chemokine functions and leukocyte trafficking. Keywords: herpesviruses; chemokine-binding proteins; chemokines; immunomodulation viral infection, chemokines and viral immunomodulators.

A survey on murine gammaherpesvirus 68 in ticks collected in Slovakia.

Murine gammaherpesvirus 68 (MHV-68) is a natural pathogen that infects murid rodents which serve as hosts for Dermacentor reticulatus and Ixodes ricinus ticks. For the first time, MHV-68 was detected in immature I. ricinus ticks feeding on lizards trapped in Slovakia. Later on, MHV-68 infection was detected in D. reticulatus and Haemaphysalis concinna ticks collected on vegetation, which supported the idea that ticks can acquire the virus from feeding on infected hosts. Here, we report MHV-68 infection, which was detected by nested PCR, in D. reticulatus and I. ricinus adult ticks and I. ricinus nymphs collected in five geographically isolated localities, in west, southwest, south and central Slovakia. Viral incidence in ticks was 46.7% (121/259) without considering the season, site of collection and tick species and their life stage. MHV-68 infection was detected in all five localities investigated and in both tick species. Here, for the first time, we report MHV-68 infection in I. ricinus nymphs collected from the vegetation. The finding of virus in ticks from five separated localities suggested that ticks became infected with MHV-68 via feeding on infected rodents; thus, this virus might be a newfound natural pathogen in ticks.

Herpes simplex viruses type 1 and 2 photoinactivated in the presence of methylene blue transform human and mouse cells in vitro.

Three strains of herpes simplex virus, K17syn- and HSZPsyn+ of type 1 (HSV-1) and USsyn- of type 2 (HSV-2), were photoinactivated in the presence of methylene blue and used to infect 3 cell lines, normal human lung tissue cells (MRC-5), mouse epithelial cells (NIH3T3), and human lung carcinoma cells (A549). The virus titer and phenotype of cells were evaluated to compare the characteristics of normal and carcinoma cells infected with non-syncytial (non-syn) and syncytial (syn) strains of herpes simplex viruses. We found that the cells of both normal cell lines infected with photoinactivated K17syn- and USsyn- but not HSZPsyn+ acquired transformed phenotype accompanied by the presence of virus. Surprisingly, the infection with photoinactivated viruses K17syn- and USsyn- but not HSZPsyn+ resulted in the suppression of the transformed phenotype of A549 cells. Using nested PCR, herpesviral DNA was identified in newly transformed cells and cells that lost the transformed phenotype. The effect of putative herpesvirus-related growth factors (HRGF) produced by cells infected with photoinactivated viruses was quantified and compared. Since methylene blue is currently used in phototherapy of herpetic lesions, these results raise the question of whether such therapy is risky to human health.

Molecular detection of murine gammaherpesvirus 68 (MHV-68) in Haemaphysalis concinna ticks collected in Slovakia.

Murine gammaherpesvirus 68 (MHV-68) is a natural pathogen of murid rodents, which serve as hosts to Haemaphysalis concinna ticks. The occurrence of MHV-68 was investigated in a total of 47 H. concinna adult ticks collected on the vegetation in Gabcíkovo, situated in south-western Slovakia (47º54´0´´N, 17º35´0´´E), from May 2013 to May 2014. DNA from ticks was purified and screened by nested PCR targeting ORF50 of MHV-68 and the copy number of virus genome in ticks was determined by a real-time PCR assay specific for ORF65. The MHV-68 incidence in questing ticks was 38.3% (18/47) and the virus genome copy number per tick varied from 2x102 to 9.6x103. In this study, MHV-68 was documented for the first time in H. concinna ticks. Results expand previous data describing the occurrence of MHV-68 in Ixodes ricinus and Dermacentor reticulatus ticks collected in Slovakia, supporting the hypothesis that MHV-68 might be a newfound pathogen in ticks.

Soluble M3 proteins of murine gammaherpesviruses 68 and 72 expressed in Escherichia coli: analysis of chemokine-binding properties.

M3 protein of murine gammaherpesvirus 68 (MHV-68) was identified as a viral chemokine-binding protein 3 (vCKBP-3) capable to bind a broad spectrum of chemokines and their receptors. During both acute and latent infection MHV-68 M3 protein provides a selective advantage for the virus by inhibiting the antiviral and inflammatory response. A unique mutation Asp307Gly was identified in the M3 protein of murine gammaherpesvirus 72 (MHV-72), localized near chemokine-binding domain. Study on chemokine-binding properties of MHV-72 M3 protein purified from medium of infected cells implied reduced binding to some chemokines when compared to MHV-68 M3 protein. It was suggested that the mutation in the M3 protein might be involved in the attenuation of immune response to infection with MHV-72. Recently, Escherichia coli cells were used to prepare native recombinant M3 proteins of murine gammaherpesviruses 68 and 72 (Pancík et al., 2013). In this study, we assessed the chemokine-binding properties of three M3 proteins prepared in E. coli Rosetta-gami 2 (DE3) cells, the full length M3 protein of both MHV-68 and MHV-72 and MHV-68 M3 protein truncated in the signal sequence (the first 24 aa). They all displayed binding activity to human chemokines CCL5 (RANTES), CXCL8 (IL-8), and CCL3 (MIP-1α). The truncated MHV-68 M3 protein had more than twenty times reduced binding activity to CCL5, but only about five and three times reduced binding to CXCL8 and CCL3 when compared to its full length counterpart. Binding of the full length MHV-72 M3 protein to all chemokines was reduced when compared to MHV-68 M3 protein. Its binding to CCL5 and CCL3 was reduced over ten and seven times. However, its binding to CXCL8 was only slightly reduced (64.8 vs 91.8%). These data implied the significance of the signal sequence and also of a single mutation (at aa 307) for efficient M3 protein binding to some chemokines.

Epigenetic modification of Rta (ORF50) promoter is not responsible for distinct reactivation patterns of murine gammaherpesviruses.

Gammaherpesviruses-encoded replication and transcription activator (Rta) (ORF50) plays an essential role in the initiation of viral lytic gene expression and reactivation from latency. The Rta expression is influenced by many viral and cellular factors, including epigenetic modifications, mainly DNA methylation and histone modifications. Murine gammaherpesvirus 68 (MHV-68), belonging to the species Murid herpesvirus (MuHV-4), is widely used as a model to study human gammaherpesvirus infections in vitro as well as in vivo. Recent studies of the MHV-68 Rta promoter revealed the effect of DNA demethylation and histone acetylation, induced by the inhibitor of histone deacetylase trichostatin A (TSA), on the MHV-68 reactivation from latency. Two other strains of MuHV-4, MHV-72 and MHV-4556, possess several unique properties, which distinguish them from strain MHV-68. Recently discovered reduced capacity of MHV-72 and MHV-4556 to reactivate from latency may be related to different methylation/demethylation patterns of the promoter regulatory region of the Rta. Here, we investigated the epigenetic regulation of the Rta promoter of three murine gammaherpesvirus strains, MHV-68, MHV-72 and MHV-4556, during latency and reactivation in vivo. However, we did not find any differences between Rta of MHV-68, MHV-72 and MHV-4556 and its epigenetic regulation during lytic infection, latency and de novo infection after ex vivo and in vivo reactivation induced by TSA. We confirmed that the treatment with TSA successfully induced demethylation of the Rta promoter regions of all three studied strains. Moreover, we have shown that the primary sequence of Rta and its promoter is identical for all three strains.

Cells transformed by murine herpesvirus 68 (MHV-68) release compounds with transforming and transformed phenotype suppressing activity resembling growth factors.

In this study, we investigated the medium of three cell lines transformed with murine herpesvirus 68 (MHV-68) in vitro and in vivo, 68/HDF, 68/NIH3T3, and S11E, for the presence of compounds resembling growth factors of some herpesviruses which have displayed transforming and transformed phenotype suppressing activity in normal and tumor cells. When any of spent medium was added to cell culture we observed the onset of transformed phenotype in baby hamster kidney cells (BHK-21) cells and transformed phenotype suppressing activity in tumor human epithelial cells (HeLa). In media tested, we have identified the presence of putative growth factor related to MHV-68 (MHGF-68). Its bivalent properties have been blocked entirely by antisera against MHV-68 and two monoclonal antibodies against glycoprotein B (gB) of MHV-68 suggesting viral origin of MHGF-68. The results of initial efforts to separate MHGF-68 on FPLC Sephadex G15 column in the absence of salts revealed the loss of its transforming activity but transformed phenotype suppressing activity retained. On the other hand, the use of methanol-water mobile phase on RP-HPLC C18 column allowed separation of MHGF-68 to two compounds. Both separated fractions, had only the transforming activity to normal cells. Further experiments exploring the nature and the structure of hitherto unknown MHGF-68 are now in the progress to characterize its molecular and biological properties.

Interferon lambda induces antiviral response to herpes simplex virus 1 infection.

Lambda interferons (IFN-λ) are known to induce potent antiviral response in a wide variety of target cells. They activate the same intracellular signalling pathways and have similar biological activities as IFN-α/ß, including antiviral activity, but signal via distinct receptor complex, which is expressed in a cell- and species-specific manner. IFN-λ was reported to induce in vitro marked antiviral activity against various RNA viruses, but corresponding data on DNA viruses are sparse. Therefore we examined the IFN-λ1 induced antiviral activity against two strains of herpes simplex virus 1, a highly pathogenic ANGpath and moderately pathogenic KOS. The antiviral response was determined in vitro in Vero cells, known as deficient in production of type I IFNs and in Vero E6 cells, responding to viral infection with abundant IFN-λ production, although deficient in production of type I IFNs. The results showed that IFN-λ1 induced in Vero cells higher antiviral activity against ANGpath strain than against KOS strain. In Vero E6 cells endogenous IFN-λ induced higher antiviral activity against ANGpath strain than against KOS strain, but because of the virus induction of IFN-λ expression the antiviral activity was detected later. The observed differences between the IFN-λ1-induced antiviral activities against viral strains of various pathogenicity suggest that virus attributes may play role in the antiviral state of cells induced by IFN-λ.

Ovine herpesvirus 1 (OVHV-1) thymidine kinase locus sequence analysis: evidence that OVHV-1 belongs to the Macavirus genus of the Gammaherpesvirinae subfamily.

The HindIII-HincII fragment of the 5.5 kbp H11 HindIII clone of ovine herpesvirus 1 (OvHV-1) was cloned and its primary structure was determined by preparation of nested deletion subclones and their sequencing. Sequence analysis of the overlapping clones revealed that 3239 bp OvHV-1 fragment contains complete thymidine kinase (TK) gene, a partial open reading frame of ORF20 and that encoding glycoprotein H (gH). The conserved OvHV-1 TK displayed the highest similarity to homologous TK proteins encoded by members of the Macavirus genus of the Gammaherpesvirinae subfamily. These data including our previous analysis of the partial sequence of VP23 homologue might serve as further evidence that OvHV-1 should be categorized within the genus Macavirus of the Herpesviridae family.

Recombinant herpesviruses as tools for the study of herpesvirus biology.

This article is a brief summary of efforts to generate mutant herpesviruses for investigating and assigning gene functions of herpesviruses in replication and pathogenesis. While a full review of all herpesviruses is beyond the scope of this review, we focused our attention on the prototype of the herpesvirus subfamily - herpes simplex virus and murine gammaherpesvirus that serves as an excellent animal model to study human gammaherpesvirus pathogenesis. Furthermore, our present knowledge of essential, non-essential, and common genes of herpesviruses as well as of accessory genes that are currently being studied with the help of the bacterial artificial chromosome (BAC) system will also be discussed. This system facilitates the analysis of herpesviral genes with potential for use in gene therapy or as anti-cancer therapeutics.

Marek΄s disease: rapid progress in research with unclear biological implementations.

Here we would like to provide a brief overview of the modern history of Marek΄s disease (MD) research with a focus on the most recent developments in experimental work and we will try to sum up their impact on the understanding of the biological properties of Marek΄s disease type 1 (MDV-1), the only representative of the Mardivirus genus causing fatal lymphoproliferative disease in poultry. We will also compare MDV-1 with other serologically-related poultry herpesviruses, Marek΄s disease virus type 2 (MDV-2) and herpesvirus of turkeys (HVT). Although MD was first described at the beginning of the last century, proper characterization of its biological impact on poultry production and utilization of molecular biology methods for detailed characterization of causative agent MDV-1 were introduced only in recent decades. However, many characteristics of MD infection, pathogenesis and vaccine protection mechanisms remain unclarified, though novel methods bring a challenge for better understanding of these unanswered questions.

Purification of recombinant M3 proteins of murine gammaherpesviruses 68 and 72 expressed in Escherichia coli.

M3 proteins of 44 kDa of murine gammaherpesviruses 68 and 72 (MHV-68, MHV-72) were identified as herpesvirus vCKBP-3, soluble inhibitors of the host chemokine network providing a selective advantage for the virus by inhibiting the antiviral and inflammatory response during both acute and latent infection. The MHV-72 M3 protein was found to contain a single mutation (Asp307Gly) near its chemokine-binding domain and differ from that of MHV-68 in the ability to bind some human chemokines. In this study, we optimized the expression of his-tagged M3 proteins of MHV-68 and MHV-72 in Escherichia coli and their purification by Ni-NTA chromatography under both denaturing and native conditions. The integrity of the N-terminus of the MHV-72 M3 protein was verified by partial sequencing. The results showed that E. coli is useful for the preparation of native, recombinant M3 proteins of murine gammaherpesviruses in sufficient quantity and purity for further biological studies.

Partial genome analysis of murine gammaherpesvirus 4556.

UNLABELLED: Murine gammaherpesvirus 68 (MHV-68) -infected mouse is an animal model of gammaherpesvirus infection in man and domestic animals. Murine gammaherpesvirus 4556 (MHV-4556), isolated from Apodemus flavicollis ticks has been considered a close relative of MHV-68 but different in some features of infection in vitro and in vivo. Previous comparison of MHV-4556 with MHV-68 has revealed their diversity in immune evasion protein MK3. In this study, HindIII and EcoRI restriction profiles of the MHV-4556 genome disclosed absence of the deletion that has been identified previously at the left end of genomes of murine gammaherpesvirus 76 (MHV-76) and murine gammaherpesvirus Sumava (MHV-Sumava). A 22, 565 bp portion of MHV-4556 genome sequence was sequenced, analyzed and compared with that of MHV-68. Nucleotide sequences of 21 genes of MHV-4556 and deduced amino acid sequences revealed their identity to those of MHV-68 except for differences in 15 nucleotides and 8 amino acids in 5 genes and their proteins, respectively. Due to these differences, immune evasion protein M4 and structural proteins encoded by ORF8 (gB), ORF11 (p43), ORF26 and ORF52, respectively, are predicted to have a reduced hydrophilicity and surface exposure compard with their MHV-68 counterparts. These differences obviously contribute to some different pathogenetical features of these viruses and could explain the weaker immunogenicity of MHV-4556 in comparison with MHV-68. KEYWORDS: murine gammaherpesvirus 4556; restriction analysis; partial genome sequence.

Partial genome sequence of murine gammaherpesvirus 72 and its analysis.

Murine gammaherpesvirus 68 (MHV-68)-infected mouse is a well known model for studies of Epstein-Barr virus (EBV)-related lymphoproliferative diseases (LPD). Murine gammaherpesvirus 72 (MHV-72) has been considered a close relative of MHV-68 but its replication in murine mammary gland cells and kinetics of infection of mice were found to be different. Pathological studies of a long-term-infection of mice revealed a similar or higher malignancy development rate in MHV-72-infected mice as compared with that of MHV-68. Previous comparison of MHV-72 with MHV-68 revealed their diversity in M3, MK3, and M7 genes encoding the chemokine-binding protein, immune evasion protein and glycoprotein 150, respectively. In this study, a portion (22,899 bp) of MHV-72 genome sequence was determined, analyzed and compared with that of MHV-68. Nucleotide sequences of 13 structural and 6 non-structural genes of MHV-72 and deduced amino acid sequences revealed their identity to those of MHV-72 except for differences in 9 nucleotides and 8 amino acids, occurring in 5 genes and their proteins. Due to these differences, 4 structural proteins encoded by ORF20, ORF26, ORF48, and ORF52, respectively, and a non-structural protein encoded by ORF4, all of MHV-72, are predicted to have altered hydrophilicity and surface exposure in comparison with their MHV-68 counterparts. These differences obviously contribute to some different pathogenetical features of these viruses and could explain the reduced immunogenicity of MHV-72 in relation to MHV-68, allowing MHV-72 to escape the host immune surveillance.

Chemokine-binding activities of M3 protein encoded by Murine gammaherpesvirus 72.

Murine gammaherpesvirus 68 (MHV-68) contains gene-encoding M3 protein expressed during the acute and persistent phase of infection. This protein features a chemokine-binding activities (Parry et al., 2000; van Berkel et al., 2000). In this study, we demonstrated that the Murine gammaherpesvirus 72 (MHV-72) also contained M3 gene with the codon-changing mutation at the position 920 nt converting amino acid (aa) 307 Asp (GAC) to Gly (GGC). The mutation in the M3 protein was localized near chemokine-binding domain and was able to change the secondary structure of M3 protein. We examined the binding activities of M3 proteins of MHV-72 and MHV-68 to five human chemokines (CCL3, CCL5, CCL11, CCL2, and CXCL8). Binding activity of MHV-72 M3 protein to CCL5 as well as to CXCL8 reached only 11.1% (day 3 p.i.) to 20% (day 4 p.i.) of the activity detected for MHV-68 M3 protein. On the other hand, MHV-72 M3 protein bound to human cytokines CCL11 and CCL2 reached about 90% of the binding detected for MHV-68 M3 protein. The binding activity of both M3 proteins to human CCL3 was similar. These data implied that mutation identified in MHV-72 M3 protein might be involved in attenuation of immune response to infection with MHV-72.

Immune response and cytokine production following immunization with experimental herpes simplex virus 1 (HSV-1) vaccines.

Balb/c mice were immunized with the recombinant fusion protein gD1/313 (FpgD1/313 representing the ectodomain of HSV-1 gD), with the non-pathogenic ANGpath gE-del virus, with the plasmid pcDNA3.1-gD expressing full-length gD1 and with the recombinant immediate early (IE) HSV-1 protein ICP27. Specific antibodies against these antigens (as detected by ELISA) reached high titers with the exception of the DNA vaccine. High-grade protection against challenge with the virulent strain SC16 was found following immunization with the pcDNA3.1-gD plasmid and with the gE-del virus. Medium grade, but satisfactory protection developed after immunization with the FpgD1/313 and minimum grade protection was seen upon immunization with the IE/ICP27 polypeptide. A considerable response of peripheral blood cells (PBL) and splenocytes in the lymphocyte transformation test (LTT) was found in mice immunized with FpgD1/313, with the pcDNA3.1-gD plasmid and with the live ANGpathgE-del virus. For lymphocyte stimulation in vitro, the FpgD1/313 antigen was less effective than the purified gD1/313 polypeptide (cleaved off from the fusion protein); both proteins elicited higher proliferation at the 5 microg per 0.1 mL dose than at the 1 microg per 0.1 mL dose. The secretion of Th type 1 (TNF, IFN-gamma and IL-2) and Th type 2 (IL-4 and IL-6) cytokines was tested in the medium fluid of purified PBL and splenocyte cultures; their absolute values were expressed in relative indexes. The PBL from FpgD1/313 immunized mice showed increased secretion of both T(H)1 (TNF) as well as T(H)2 (IL-4) cytokines (7-10-fold, respectively). Splenocytes from FpgD1/313 immunized mice showed a significant (23-fold) increase in IL-4 production.

Occurrence of human papillomavirus 16 and 18 in smears from the two cervix regions of onco-gynecological patients in Slovakia.

We evaluated the relevance of tests for Human papillomavirus 16 and 18 (HPV-16, HPV-18) in two cervix regions (exocervical and endocervical) separately. The total of 142 cervical smears obtained from 91 women in Slovakia attending onco-gynecological outpatient care were examined for the presence of HPVs by PCR with the general primers GP5 and GP6 (GP5/6). The HPV-positive smears were examined for the presence of HPV-16 and HPV-18 and the results compared with cytological assessment. In 73 HPV-positive smears, the number of cases with detected HPV-16 was about three times higher in exocervix and about two times higher in endocervix in comparison with number of cases with detected HPV-18. In the smears considered as normal by cytology, two times higher occurrence of HPV-18 in endocervical smears was found in comparison with exocervical ones. Eight patients were double-infected with HPV-16 and HPV-18, but no patient was infected with these HPVs in both cervical regions. This finding emphasized the importance of examination of both cervical regions separately. Overlooking of the endocervical canal for the close examination by cytology and PCR might increase the failure to detect HPVs associated with adenocarcinoma.

First Report of Wheat streak mosaic virus in Slovakia.

The occurrence of Wheat streak mosaic virus (WSMV; genus Tritimovirus) was monitored by testing 91 wheat and barley samples collected from various localities of Slovakia from March to June 2007. Samples were screened by a commercial double-antibody sandwich-ELISA kit (Loewe Biochemica, Sauerlach, Germany). Positive results were obtained from two wheat (Triticum aestivum L.) samples from the same locality of western Slovakia. Molecular analysis of both samples was performed by reverse transcription-PCR with WSMV-specific primers (WS-8166F 5' GAGAGCAATACTGCGTGTACG 3' and WS-8909R 5' GCATAATGGCTCGAAGTGATG 3') designed according to available sequences. The expected 750-bp PCR fragment containing the N-terminal and core region of the coat protein gene (from 8166 to 8909 nt based on the Sidney81 isolate, GenBank Accession No AF057533) was obtained from both Slovak isolates. Direct sequencing (GenBank Accession Nos. EU723085 and EU723086) revealed that the two isolates have nucleotide and amino acid sequence identities of 98.3 and 100%, respectively. Except for the highly divergent Mexican isolate (Accession No. AF285170), pairwise comparisons of the Slovak isolates with sequences of other WSMV isolates (1) available in GenBank indicated respective nucleotide and amino acid sequence identities ranging from 87.6 to 98.7% and 95.2 to 100%. The Slovak isolates were most closely related to isolates from Czech Republic, Hungary, and Russia (GenBank Accession Nos. AF454454, AF454456, and AF454459). To our knowledge, this is the first report of the natural occurrence of WSMV in Slovakia. Reference: (1) D. C. Stenger et al. Virology 302:58. 2002.