Prise en charge de la glomérulonéphrite aiguë post-infectieuse chez l'enfant: expérience du Centre Hospitalier Universitaire Pédiatrique Charles De Gaulle de Ouagadougou (Burkina Faso)

Introduction : La Glomérulo-Néphrite Aiguë Post-infectieuse (GNAP) reste fréquente chez l'enfant dans les pays en développement. Au Burkina Faso, il existe très peu de données sur le sujet. Le but de ce travail était de contribuer à travers les données fournies par l'étude, à l'amélioration de la prise en charge de la maladie en milieu pédiatrique au Burkina Faso. Patients et méthode : Il s'est agi d'une étude rétrospective descriptive sur la période du 1er janvier 2008 au 31 décembre 2017 (10 ans). Ont été inclus dans l'étude les enfants âgés de 0 à 15 ans hospitalisés dans le service de pédiatrie médicale du Centre Hospitalier Universitaire Pédiatrique Charles De Gaulle (CHUP-CDG) de Ouagadougou pour glomérulonéphrite aiguë post-infectieuse pendant notre période d'étude. Les données collectées ont été traitées sur micro-ordinateur à l'aide du logiciel SPSS dans sa version 20. Résultats : Cinquante-huit patients ont été inclus durant la période d'étude, soit 1,6% des hospitalisations. L'âge moyen était de 5,8 ± 2,9 ans avec des extrêmes de 20 mois et 13 ans. La tranche d'âge la plus concernée était celle de 5 à 12 ans. La prédominance était masculine (65,5%). Les enfants étaient dans la majorité des cas issus de familles à niveau socioéconomique défavorable. Un syndrome œdémateux était retrouvé chez la plupart des patients à l'admission. La tension artérielle a été mesurée chez 44 patients soit 75,86% des cas. Les moyennes des pressions artérielles systolique et diastolique étaient respectivement de 113,18 ± 23 mm Hg (extrêmes = 80 et 190) et 70,82 ± 18 mm Hg (extrême = 40 et 120). Sur le plan paraclinique nous avons noté des ASLO positifs dans 40,4% des cas. Un seul patient avait une protéinurie > 50 mg/kg/24h. La créatininémie moyenne était de 125,6 ± 197,1 µmol/L avec des extrêmes de 17 et 1830 µmol/L. Le traitement était essentiellement symptomatique. La durée moyenne d'hospitalisation était 12,03 ± 8,6 avec des extrêmes de 0 et 47 jours. L'évolution était favorable dans 79,31% des cas. Conclusion : La GNAPI reste relativement fréquente au CHUP-CDG de Ouagadougou probablement à cause des conditions de vie et d'hygiène précaires. L'évolution est généralement favorable mais des complications peuvent survenir

Resistance to gastrointestinal parasite infection in Djallonké sheep.

Gastrointestinal parasitism places serious constraints on small ruminant production. The situation has been exacerbated by development of drug resistance in many parasite populations, leading to interest in identification of animals with genetically mediated resistance or tolerance to nematode infections. This study assessed the response to natural infection with gastrointestinal nematodes (GIN) in Djallonké sheep during the rainy season in the Sudan-Guinea Savannah region of Burkina Faso. Haemonchus contortus is the most prevalent GIN at this site and time. Djallonké lambs (n=434) were sampled from 40 households and evaluated at a common location in southern Burkina Faso. Lambs were dewormed with levamisole at 2 to 6 months of age and returned to infected pastures. Fecal egg counts (FEC), packed cell volumes (PCV), and FAffa Malan CHArt (FAMACHA©) scores were determined 28 and 35 days after deworming. Lamb mortality was monitored throughout the experiment. Least-squares means for BW increased from 13.8±0.2 kg at 28 days to 14.0±0.2 kg at 35 days (P<0.01). Simple means and medians for FEC were 615 and 100, respectively, at 28 days and 850 and 175, respectively, at 35 days. The FEC exhibited strong right skewness. Following logarithmic transformation and back-transformation of resulting least-squares means to the original scale, FEC were higher (P<0.01) for males (208±27) than females (122±10). Least-squares means for PCV decreased (P<0.001) from 28 (36.3±0.5%) to 35 days (33.7±0.5%), and were higher (P<0.01) for females (36.0±0.4%) than males (33.9±0.7%). Correlations (r) between repeated measurements of BW, FEC, PCV and FAMACHA scores at 28 and 35 days were all positive (P<0.001). The correlation between FAMACHA scores and PCV was negative at 28 (r=-0.14) and 35 days (r=-0.18) (P<0.001). This study revealed that BW was an easily measured predictor of the ability of the lamb to resist infection with GIN and maintain PCV, and confirmed that FAMACHA scores are useful indicators of differences in FEC. Approximately 40% of female and 30% of male lambs did not show detectable levels of infection (i.e. FEC=0) under field conditions. The great variability that was observed in FEC and PCV suggests potential to use Djallonké sheep in breeding programs to enhance resistance to GIN.

[Living conditions, nutritional status and morbidity in children in prisons and detention centers in Burkina Faso]. / Conditions de vie et morbidité des mineurs détenus dans les maisons d'arrêt et de correction du Burkina Faso.

In Burkina Faso, although children are sometimes separated from adults in prisons, they still live in the same conditions of overcrowding, which can reach 180% of the capacity. The aim of our study was to describe living conditions, nutritional status, and morbidity of children in detention centers of Burkina Faso. The objective of this cross-sectional descriptive study is to describe the social and health conditions of children held in 20 detention centers in Burkina Faso. During the study period, 109 children, with a mean age of 16.3 years, were examined in 20 correction centers. The main reason for incarceration was theft (66% cases, n = 72). Detention exceeded more than one month for 76 children (70%), and 59% (N = 46) had had fewer than one visit per month since their incarceration. Of these 20 facilities, 6 had no separate quarters for children. The main symptoms and diseases encountered in these children were fever in 19% of the cases (N = 16), macroscopic hematuria in 13% (N = 11), urinary tract infection in 12% (N = 10) and diarrhea in 12% (N = 10). These results show that there is a need to take preventive measures to protect these children's health, especially by improving the quality of living conditions in detention center.

Assessing introgression of Sahelian zebu genes into native Bos taurus breeds in Burkina Faso.

A total of 350 samples were analyzed to estimate zebu gene proportions into two different taurine cattle breeds of Burkina Faso (Lobi and N'Dama) using 38 microsatellites and various statistical methodologies. West African and East African zebu samples were sequentially used as reference parental populations. Furthermore, N'Dama cattle from Congo, the composite South African Bonsmara cattle breed and a pool of European cattle were used successively as second parental populations. Independently of the methodology applied: (a) the use of West African zebu samples gave higher admixture coefficients than the East African zebu; (b) the higher zebu proportions were estimated when the European cattle was used as parental population 2; and (c) the use of the N'Dama population from Congo as parental population 2 gave the more consistent zebu proportion estimates for both the Lobi and the N'Dama breeds. In any case, the zebu admixture proportions estimated were not negligible and were always higher in the N'Dama cattle than in the Lobi cattle of Burkina Faso. This suggested that the introgression of Sahelian zebu genes into the taurine cattle of Southern West Africa can follow a complex pattern that can depend on local agro-ecological features. The current research pointed out that the estimation of admixture coefficients is highly dependent on both the assumptions underlying the methodologies applied and the selection of parental populations. Our analyses suggest that either too high or nil genetic identity between the parental and the expectedly derived populations must be avoided.

Prevalence of Rift Valley fever in domestic ruminants in the central and northern regions of Burkina Faso.

The seroprevalence of Rift Valley fever was determined in cattle, sheep and goats in selected areas of northern and central Burkina Faso. A total of 520 serum samples were screened for anti-Rift Valley fever virus immunoglobulin G (IgG) antibodies using an inhibition enzyme-linked immunosorbent assay (ELISA). An average seroprevalence of 7.67% (range 5% to 20%) was found in ruminants in Seno and Soum provinces, and prevalences of 20% and 22.5% in cattle in Yatenga and Oubritenga provinces, respectively. The location, species and age of the animals were found to influence the seroprevalence. All the ELISA IgG-positive samples were tested for IgM in a competitive ELISA and were found negative, thus ruling out recent infections. The IgG-positive samples, including weak positives, were further tested in a serum neutralisation test for neutralising antibodies and 54.5% of these samples tested positive. The results show that the virus is in circulation in central and northern regions of Burkina Faso, suggesting the need for improved surveillance and control systems to prevent future outbreaks and the consequent economic impact of the disease in Burkina Faso livestock.

First Report of Rice yellow mottle virus on Rice in the Democratic Republic of Congo.

Rice yellow mottle virus (RYMV), genus Sobemovirus, is a widespread rice pathogen reported in nearly all rice-growing countries of Africa. Although the virus was detected in Cameroon, Chad, Tanzania, Rwanda, Burundi, and Uganda (2,3), RYMV has never been described in the Democratic Republic of Congo (DRC). In July 2012, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes 30 km south of Bukavu, in eastern DRC, and in lowland subsistence fields in the surroundings of Bukavu. Several dozen hectares affected by the disease were abandoned by the farmers. Symptomatic leaf samples were collected in different farmer fields. Back-inoculations to susceptible rice variety IR64 resulted in the same yellowing and mottling symptoms 7 to 9 days post-inoculation. Infected leaves gave positive results using double antibody sandwich (DAS)-ELISA tests with polyclonal antisera (as described in [1]), indicating for the first time the presence of RYMV in DRC. Triple antibody sandwich (TAS)-ELISA tests with discriminant monoclonal antibodies (1) revealed that they all belong to serotype 4 found in the neighboring region in Rwanda. Total RNA of three samples from South Kivu was extracted with the RNeasy Plant Mini kit (Qiagen, Germany). The 720 nucleotide coat protein (CP) gene was amplified by reverse transcription (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (1). The sequences were deposited in GenBank (Accessions KC788208, KC788209, and KC788210). A set of CP sequences of 45 isolates representative of the RYMV diversity in Africa, including the sequences of the DRC samples, were used for phylogenetic reconstruction by maximum-likelihood method. The isolates from South Kivu belonged to strain S4-lv, mainly found around Lake Victoria. Specifically, within the S4-lv strain, the South Kivu isolates clustered with isolates from eastern and southern provinces of Rwanda and Burundi, respectively (2), suggesting a recent spread from these countries. Recently, efforts have been directed to shift from the traditional upland system to lowland and irrigated systems in which water availability allows sequential planting and maintenance of higher crop intensity. This agricultural change may increase insect vectors and alternate host plant populations which may result in higher RYMV incidence in DRC (3). Similar yellowing and mottling symptoms have been observed in Bas-Congo and Equateur provinces of the country, which would justify further surveys and characterisation of RYMV in the DRC. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) I. Ndikumana et al. Plant Dis. 96:1230, 2012. (3) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

[Strokes and hemoglobinopathies in Burkina Faso]. / Accidents vasculaires cérébraux et hémoglobinopathies au Burkina Faso.

S and C hemoglobinopathies are a group of inherited blood disorders including sickle cell disease, characterized by the presence of abnormal S and C hemoglobins. They are common in tropical Africa. Stroke is a common complication of sickle cell disease. Studies of the relation between these two diseases are virtually nonexistent in sub-saharan Africa. Our work aimed to study the influence of these hemoglobinopathies on the onset of strokes in adults. This cross-sectional study took place from 1st December 2009 to 31st May 2010 at University Hospital Yalgado Ouedraogo. Out of 142 patients admitted to our neurology department during this period, 74 patients had had strokes. Their mean age was 55.9 years and their sex ratio 1.53. Ischemic strokes accounted for 57% of the total, followed by cerebral hemorrhage (39%). Forty-six patients (62%) were AA genotype, 27 (36%) patients had sickle cell trait (16 AC and 11 AS) and three patients were homozygous CC. This study showed a higher prevalence of hemoglobinopathies in patients with stroke than in the general population. Unlike heterozygous SC and homozygous SS forms, the existence of sickle cell trait in this population does not appear to increase the risk of onset of ischemic stroke but may reduce the age at onset of cerebral hemorrhage.

Mapping, monitoring, and surveillance of neglected tropical diseases: towards a policy framework.

As national programmes respond to the new opportunities presented for scaling up preventive chemotherapy programmes for the coadministration of drugs to target lymphatic filariasis, onchocerciasis, schistosomiasis, soil-transmitted helminthiasis, and trachoma, possible synergies between existing disease-specific policies and protocols need to be examined. In this report we compare present policies for mapping, monitoring, and surveillance for these diseases, drawing attention to both the challenges and opportunities for integration. Although full integration of all elements of mapping, monitoring, and surveillance strategies might not be feasible for the diseases targeted through the preventive chemotherapy approach, there are opportunities for integration, and we present examples of integrated strategies. Finally, if advantage is to be taken of scaled up interventions to address neglected tropical diseases, efforts to develop rapid, inexpensive, and easy-to-use methods, whether disease-specific or integrated, should be increased. We present a framework for development of an integrated monitoring and evaluation system that combines both integrated and disease-specific strategies.

Phylogenetic analysis of rabies viruses from Burkina Faso, 2007.

Genetic characterization of 32 canine rabies viruses circulating in Burkina Faso in 2007 identified two clades both belonging to the Africa 2 lineage. Sequence homology data suggest that transboundary spread is the most likely means of introduction, highlighting an evolving epidemiological situation.

Microsatellite analysis characterizes Burkina Faso as a genetic contact zone between Sahelian and Djallonke sheep.

A total of 123 sheep belonging to the Djallonke, Mossi, and Burkina-Sahel breeds, along with 41 Spanish Xalda sheep were genotyped for 27 microsatellites. The pair Djallonke-Mossi had the highest between breeds molecular coancestry. Admixture analysis informed on the parental role of the Burkina-Sahel and Djallonke breeds. The Mossi breed was a hybrid population nearer to the Djallonke breed. Only half of the Mossi individuals were correctly assigned to their breed. The Burkina-Sahel and Djallonke breeds can be considered ancestrally different genetic entities. Differentiation between the Djallonke and Mossi breeds may be due to introgression of Sahelian sheep.

Analysis of mitochondrial DNA diversity in Burkina Faso populations confirms the maternal genetic homogeneity of the West African goat.

To date, no comprehensive study has been performed on mitochondrial genetic diversity of the West African goat. Here, we analysed a 481-bp fragment of the HVI region of 111 goats representing four native West African populations, namely the three main Burkina Faso breeds, zoo-farm kept Dwarf goats and endangered Spanish goat breeds used as the outgroup. Analyses gave 83 different haplotypes with 102 variable sites. Most haplotypes (65) were unique. Only three haplotypes were shared between populations. Haplotypes were assigned to cluster A except for H45 (belonging to the Spanish Bermeya goat) which was assigned to cluster C. amova analysis showed that divergence between groups (Phi(CT)) was not statistically significant regardless of whether the partition in two hierarchical levels that was fitted included Spanish samples or not. The West African goat scenario shown here is consistent with that previously reported for the species: haplogroup A is predominant and has a very high haplotype diversity regardless of the geographic area or sampled breed. The large phenotypic differences observable between the West African Dwarf and Sahelian long-legged goat populations are not detectable with mitochondrial markers. Moreover, a previously suggested introgression of Sahelian goat southwards because of desertification could not be assessed using mtDNA information.

Post-translational processing of surfactant protein-C proprotein: targeting motifs in the NH(2)-terminal flanking domain are cleaved in late compartments.

Rat surfactant protein (SP)-C is a 3.7-kD hydrophobic lung-specific protein generated from proteolytic processing of a 21-kD propeptide (SP-C(21)). We have demonstrated that initial post-translational processing of SP-C(21) involves two cleavages of the COOH-terminus (Beers and colleagues, J. Biol. Chem. 1994;269:20,318--20,328). The goal of the current study was to define processing and function of the NH(2)-terminal flanking domain. Epitope-specific antisera directed against spatially distinct regions of the NH(2) terminus, NPROSP-C(2-9) (epitope = D(2)-L(9)) and NPROSP-C(11-23) (= E(11)-Q(23)) were produced. By Western blotting, both antisera identified SP-C(21) in microsomes. A 6-kD form (SP-C(6)), enriched in lamellar bodies (LBs), was detected only by NPROSP-C(11-23) and not extractable with NaCO(3) treatment. Immunogold staining of ultrathin lung sections with NPROSP-C(11-23) identified proSP-C in both multivesicular bodies (mvb) and LBs whereas NPROSP-C(2-9) labeled only mvb. (35)S-pulse chase analysis demonstrated synthesis of SP-C(21) and three intermediate forms (SP-C(16), SP-C(7), and SP-C(6)). Complete processing involved four separate cleavages with a precursor- product relationship between the low molecular weight forms SP-C(7) and SP-C(6). Fluorescence microscopy of A549 cells expressing fusion proteins of enhanced green fluorescent protein (EGFP) and proSP-C NH(2)-terminal deletion mutants showed targeting of EGFP/SP-C(1-194) and EGFP/SP-C(10-194) to early endosomal antigen-1-negative, CD-63-positive cytoplasmic vesicles whereas EGFP/SP-C(19-194), EGFP/SP-C(Delta 10-18), and EGFP/SP-C(24-194) were restricted to the endoplasmic reticulum (ER). We conclude that synthetic processing includes a previously unrecognized cleavage of the proximal NH(2) terminus (M(1)-L(9)), which occurs after removal of COOH-flanking domains (H(59)-I(194)) but before packaging in LBs, and that the region M(10)-T(18) is required for targeting of proSP-C to post-ER vesicular compartments in the biosynthetic pathway.

Biosynthesis of surfactant protein C: characterization of aggresome formation by EGFP chimeras containing propeptide mutants lacking conserved cysteine residues.

Surfactant protein C (SP-C) is a lung-specific secreted protein, which is synthesized as a 21-kDa propeptide (SP-C(21)) and then proteolytically processed as a bitopic transmembrane protein in subcellular compartments distal to the medial Golgi to produce a 3.7 kDa mature form. We have shown that initial processing of SP-C(21) involves two endoproteolytic cleavages of the C terminus and that truncation of nine amino acids from the C-flanking peptide resulted in retention of mutant protein in proximal compartments. Because these truncations involved removal of a conserved cysteine residue (Cys(186)), we hypothesized that intralumenal disulfide-mediated folding of the C terminus of SP-C(21) is required for intracellular trafficking. To test this, cDNA constructs encoding heterologous fusion proteins consisting of enhanced green fluorescent protein (EGFP) attached to the N terminus of wild-type rat proSP-C (EGFP/SP-C(1-194)), C-terminally deleted proSP-C (EGFP/SP-C(1-185); EGFP/SP-C(1-191)) or point mutations of conserved cysteine residues (EGFP/SP-C(C122G); EGFP/SP-C(C186G); or EGFP/SP-C(C122/186G)) were transfected into A549 cells. Fluorescence microscopy revealed that transfected EGFP/SP-C(1-194) and EGFP/SP-C(1-191 )were expressed in a punctate pattern within CD-63 positive, EEA-1 negative cytoplasmic vesicles. In contrast, EGFP/SP-C(1-185), EGFP/SP-C(C122G), EGFP/SP-C(C186G) and EGFP/SP-C(C122/186G) were expressed but retained in a juxtanuclear compartment that stained for ubiquitin and that contained (&ggr;)-tubulin and vimentin, consistent with expression in aggresomes. Treatment of cells transfected with mutant proSP-C with the proteasome inhibitor lactacysteine enhanced aggresome formation, which could be blocked by coincubation with nocodazole. Western blots using a GFP antibody detected a single form in lysates of cells transfected with EGFP/SP-C cysteine mutants, without evidence of smaller degradation fragments. We conclude that residues Cys(122) and Cys(186) of proSP-C are required for proper post-translational trafficking. Mutation or deletion of one or both of these residues results in misfolding with mistargeting of unprocessed mutant protein, leading to formation of stable aggregates within aggresomes.

[HIV infection at the work-place: beliefs and attitudes compliance to ethical standards]. / Infection VIH en milieu de travail: conformité des croyances et attitudes aux normes éthiques.

The aims of this study undertaken from May 2000 to August 2000, were to appreciate workers feelings about ethical questions arisen in workplaces. Three industries were randomly chosen among a total of seven which benefited from HIV preventive policy. Two hundred workers randomly chosen by a multistage sampling method, were interviewed by an occupational physician on their beliefs and attitudes about HIV infection. Mean age was 41 years, 82.5% were male and 75.5% did benefit from high school education. 76% of workers had a good level of knowledge about transmission and prevention methods about HIV. 76.5% were willing to take care of people infected. 73% believed that infected persons must continue their job in the workplace. For 63.5% infected patients should receive more care than the other sick persons no matter what disease is concerned. These positive attitudes are highly correlated with level of knowledge (p < 0.001). In contrary 73.5% did state that pathient status should be revealed. These findings are globally compliant with ethical issues except for confidentiality questions. They invite to enforce preventive measures in workplaces.

Local production of inflammatory mediators in an experimental model of acute obstructive pyelonephritis.

To investigate bacterial growth and inflammatory mediator release in the early stage of the immune response, a unilateral acute ascending pyelonephritis was induced in rats by intrabladder inoculation of Escherichia coli. The infected left kidney showed a significant bacterial proliferation, local production of interleukin (IL)-6 and IL-8 as detected by immunocytochemistry, and extensive destruction of renal parenchyma associated with impressive leukocyte recruitment. Inducible and constitutive nitric oxide synthases (NOS) were locally expressed, and a time-dependent increase in urinary secretion of nitric oxide (NO) was seen that could be blocked by NG-monomethyl-L-arginine. However, there was a discrepancy between the NO profile in the kidney and urine. The results demonstrate that in the early stage of acute pyelonephritis kidney tubules participate actively in the local host response by producing important inflammatory mediators and that urinary NO levels are not suitable for predicting renal NOS activity.

Association of nitric oxide production by kidney proximal tubular cells in response to lipopolysaccharide and cytokines with cellular damage.

Recent findings suggest that nitric oxide (NO) is an important biologic mediator which exerts a wide variety of effects on numerous physiological and pathophysiological processes. L-Arginine is oxidized to L-citrulline with concomitant NO production; as a result, nitrate and nitrite accumulates. This study was conducted to determine the potential NO production by proximal tubular cells (PTC) in response to bacterial lipopolysac-charides (LPS) and cytokines and to evaluate the cytotoxic effect associated with NO release. After a 7-day stimulation with LPS (100 micrograms/ml), interleukin-1 beta (IL-1 beta) (10 ng/ml), and tumor necrosis factor alpha (TNF-alpha) (10 ng/ml), the nitrate and nitrite levels were determined by a spectrophotometric method based on the Griess reaction. Moreover, alpha-methylglucopyranoside phosphate and lactate dehydrogenase release and the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide assay served as indicators of sodium-dependent hexose transport integrity and cell death, respectively. IL-1 beta and TNF-alpha used alone or together or combined with LPS led to a significant generation of NO by PTC. Our results also demonstrate that NO induced by LPS and cytokines could inhibit sodium-dependent transport and could induce PTC damage.