Insulin increases the intracellular concentration of total oxalyl thiolesters in BC3H-1 myocytes: potential anti-insulin mediators.

Oxalyl thiolesters (RS-CO-COOH) may represent negative intracellular messengers for insulin action. Using a reverse-phase, ion-pair high pressure liquid chromatographic technique, total intracellular oxalyl thiolesters were measured in insulin-sensitive BC3H-1 myocytes after the addition of insulin. The total oxalyl thiolester concentration increased to a maximum of 2.9 times the basal concentration by 30 min after the addition of 100 microU/ml insulin and decreased to 1.8 times by 180 min. Insulin's stimulation of pyruvate dehydrogenase as measured by lactate oxidation ([1-14C]-lactate --> 14CO2) in intact BC3H-1 myocytes reached a maximum at 15-30 min and returned to basal activity during the 60-90 min measurement interval. These results suggest that oxalyl thiolesters are increased in concentration following insulin-induced signal transduction to reverse insulin-stimulated metabolic events.

Disruption of replication protein A/single-stranded DNA complexes during apoptosis in HL-60 cells.

Replication protein A (RPA) is a single-stranded DNA-binding protein which plays a role in DNA replication, repair, and recombination. We used gel mobility shift, super gel mobility shift, and Western blot to determine the fate of RPA during Hoechst 33342-induced apoptosis in HL-60 cells. Multiple bands were detected by gel mobility shift after the incubation of single-stranded gamma-(32)P-labeled oligo(dT)(30) with the nuclear extracts of HL-60 cells. Super gel mobility shift results indicated that only the highest molecular weight protein/oligo(dT)(30) complexes bound with anti-human RPA-32 and/or anti-human RPA-70 antibodies forming RPA/oligo(dT)(30) complexes. After the treatment of HL-60 cells with 15 microg/ml Hoechst 33342 for 3 h, the bands of RPA/oligo(dT)(30) complexes were decreased and bands of the lowest molecular weight protein/oligo(dT)(30) complexes were significantly increased when compared to the control group. These low-molecular-weight bands did not bind with RPA-32 or RPA-70 antibodies. Western blotting results showed that both RPA-32 and RPA-70 were decreased significantly in a time-dependent manner after 1 h of incubation with Hoechst 33342. These results demonstrate that in HL-60 cells, Hoechst 33342-induced apoptosis is associated with a rapid loss of the binding capacity of RPA to oligo(dT)(30) as well as immunoactive RPA-70 and RPA-32.

Provider-performed microscopy.

The category of provider-performed microscopy was defined in the Federal Register to provide a unique regulatory approach for bright-field and phase-contrast microscopy performed by a physician, dentist, or midlevel practitioner examining labile specimens. A CLIA certificate for this category of testing is available, which also permits the performance of waived tests. Because these provider-performed microscopy procedures do not have quality-control materials available, special challenges are encountered in establishing and monitoring such testing within a hospital. Vigilance is required to maintain a provider-performed microscopy program within a hospital.

Hoechst 33342-induced apoptosis is associated with decreased immunoreactive topoisomerase I and topoisomerase I-DNA complex formation.

Hoechst 33342, but not Hoechst 33258, induces apoptosis and inhibits topoisomerase 1 activity in vivo. Topoisomerase I relaxes superhelical DNA through a single strand breakage/rejoining reaction in which the active site tyrosine links covalently to a 3' phosphate at the break site, forming a transient intermediate called a cleavable complex. The fate of cellular topoisomerase 1 in Hoechst 33342-induced apoptosis is unknown. We analyzed the binding capacity of topoisomerase 1 to 32P-labeled plasmid pCI DNA, the immunoreactive topoisomerase 1 concentration and topoisomerase 1 activity in BC3H-1 myocytes and HL-60 cells treated with Hoechst 33342 and Hoechst 33258 by using covalent transfer of 32P radioactivity from plasmid DNA to topoisomerase 1, Western blotting and topoisomerase 1-mediated plasmid relaxation assay, respectively. Hoechst 33342, but not Hoechst 33258, induced topoisomerase 1 dysfunction in both BC3H-1 myocytes and HL-60 cells measured by (1) a decrease in the topoisomerase 1 to DNA binding capacity or cleavable complex formation; (2) a decrease in intracellular concentration of immunoreactive topoisomerase 1; and (3) an inhibition of nuclear endogenous topoisomerase 1 activity. These results suggest that destruction of immunoreactive topoisomerase 1 and topoisomerase 1-DNA complexes or cleavable complexes results in inhibition of topoisomerase 1 activity, a key step in the Hoechst 33342-induced apoptotic process.

Nitric oxide measurements during endotoxemia.

BACKGROUND: Excessive continuous NO release from inducible NO synthase over prolonged periods under pathological conditions, such as endotoxemia, contributes significantly to circulatory failure, hypotension, and septic shock. This NO production during endotoxemia is accompanied by superoxide release, which contributes to the fast decay of NO. Therefore, the amount of NO that diffuses to target sites may be much lower than the total amount released under pathological conditions. METHODS: We performed in vivo and ex vivo measurements of NO (electrochemical) and ex vivo in situ measurements of superoxide, peroxynitrite (chemiluminescence), and nitrite and nitrate (ultraviolet-visible spectroscopy). We determined the effect of lipopolysaccharide administration (20 mg/kg) on diffusible NO, total NO (diffusible plus consumed in chemical reactions), and superoxide and peroxynitrite release in the pulmonary arteries of rats. RESULTS: An increase in diffusible NO generated by constitutive NO synthase was observed immediately after administration of lipopolysaccharide, reaching a plateau (145 +/- 18 nmol/L) after 540 +/- 25 s. The plateau was followed by a decrease in NO concentration and its subsequent gradual increase after 45 min because of NO production by inducible NO synthase. The concentration of superoxide increased from 16 +/- 2 nmol/L to 30 +/- 3 nmol/L after 1 h and reached a plateau of 41 +/- 4 nmol/L after 6 h. In contrast to the periodic changes in the concentration of diffusible NO, the total concentration of NO measured as a sum of nitrite and nitrate increased steadily during the entire period of endotoxemia, from 2.8 +/- 0.2 micromol/L to 10 +/- 1.8 micromol/L. CONCLUSIONS: The direct measurement of NO concentrations in the rat pulmonary artery demonstrates dynamic changes throughout endotoxemia, which are related to the production of superoxide and the subsequent increase in peroxynitrite. Monitoring endotoxemia with total nitrate plus nitrite is not sensitive to these fluctuations in NO concentration.

DNA technology, the clinical laboratory, and the future.

OBJECTIVE: To review the advances in clinically useful molecular biological techniques and their applications in clinical practice as presented at the Ninth Annual William Beaumont Hospital DNA Symposium. DATA SOURCES: The 10 manuscripts submitted were reviewed and their major findings were compared with literature on the same topic. STUDY SELECTION: One manuscript reviewed the development of pharmacogenetics, 3 described analytic approaches to detect aneuploidy or cancer, 1 described transcription factor E2F-1 increase during apoptosis, 2 reported on genetic and pharmacologic factors that influence platelet aggregation, 2 described molecular methods for detecting long QT syndrome or mycobacteria, and 1 reported a modification in collection of buccal DNA. DATA SYNTHESIS: Genomic and proteomic approaches to develop clinically useful assays have been successful. Aneuploidy can be easily detected by comparative genomic hybridization, which does not require cell culture like cytogenetics. Mutations have been characterized for a variety of hereditary cancer syndromes, 2 inherited long QT syndromes, and thromboembolism. PlA1 and PlA2 polymorphisms in platelets are associated with a difference in aggregation inhibition by estrogen, another example of genotypic pharmacogenetics. Protein expression differences may define colorectal cancer stage and explain apoptotic signal transduction. Mycobacterial detection by nucleic acid amplification and simplified buccal DNA collection demonstrate cost-effective strategies. CONCLUSION: The working draft of the Human Genome Project is completed and the number of clinically useful molecular pathologic techniques and assays will expand as additional disease-associated mutations are defined. Expanded use of database software for genomic and proteomic screening should increase the efficiency of clinical useful assay development.

Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein in BC3H-1 myocytes and HL-60 cells.

CONTEXT: Hoechst 33342 induces apoptosis, inhibits topoisomerase I, and disrupts TATA box-binding protein/TATA box element binding in BC3H-1 myocytes and HL-60 cells. In contrast, Hoechst 33258 does not have any of these actions. OBJECTIVE: To determine if Hoechst 33342 or Hoechst 33258 treatment of BC3H-1 myocytes or HL-60 cells is associated with the intracellular accumulation of the nuclear transcription factor E2F-1, known to induce apoptosis. METHODS: The gel mobility shift assay was used to study the effect of the 2 compounds on the binding capacity of nuclear proteins extracted from the 2 cell lines to a 30-base pair double-stranded oligonucleotide that contained an E2F-1-binding element. The DNA sequence of the protein-binding region was determined by the protection footprinting method and the Maxam-Gilbert guanosine plus adenosine chemical sequencing reaction. RESULTS: Nuclear extracts from each cell line treated with 26.7 micromol/L Hoechst 33342 or Hoechst 33258 for 3 to 24 hours were incubated with [32P]-labeled 30-base pair oligonucleotide (5'GGCGCGGAGACTTGGAGAAATTTGGCGCGG3'). Three protein and DNA bands were altered by Hoechst 33342, but not by Hoechst 33258: band I, increased, then decreased in both cell lines; band II (2 adjacent bands) markedly decreased in both cell lines; band III markedly increased only in HL-60 cells. Footprinting and sequencing demonstrated that the nuclear protein-binding sequence was TTTGGCGC, an E2F-1 binding site. Hoechst 33342 treatment increased the concentration of E2F-1 protein after a 3-hour incubation in both cell lines. CONCLUSION: Hoechst 33342-induced apoptosis is associated with intracellular accumulation of E2F-1 protein, another step in this specific apoptotic pathway.

DNA technology in the clinical laboratory.

OBJECTIVES: To review the advances in clinically useful molecular biological techniques and to identify their applications in clinical practice, as presented at the Eighth Annual William Beaumont Hospital Symposium. DATA SOURCES: The 10 manuscripts submitted were reviewed, and their major findings were compared with literature on the same topic. STUDY SELECTION: Two manuscripts addressed specimen (nucleic acid) stability, 2 described novel analytic approaches, 3 discussed detection of B- or T-cell clonality in lymphoproliferative disorders, and 3 reported the frequency of a variety of genetic polymorphisms found in cardiac disorders. DATA SYNTHESIS: DNA from dried blood spots is stable and may be purified rapidly for amplification and mutation analysis. RNA is much less stable, and a variety of methods may be used to reduce ribonuclease degradation of enteroviral RNA. False-negative reactions may be reduced by genomic amplification of ligated padlock probes by cascade rolling circle or polymerase chain reaction. A multiplex polymerase chain method using fluorescence-labeled products that separate both the wild-type and mutant hemochromatosis gene alleles by capillary gel electrophoresis represents another approach for detecting the 2 major missense mutations (C282Y and H63D) in hemochromatosis. Southern blotting and polymerase chain reaction have been used to detect B- and T-cell clonality in lymphoproliferative diseases, including mantle cell lymphoma and lymphoma of the breast. Genetic polymorphisms in a variety of coagulation factors and platelet glycoprotein IIIa are associated with ischemic heart disease. CONCLUSIONS: As the Human Genome Project continues to define disease-associated mutations, the number of clinically useful molecular pathologic techniques and assays will expand. Clinical outcome analysis is still required to document a decrease in the patient's length of stay to offset the cost of introducing molecular biological assays in the routine clinical pathology laboratory.

Hoechst 33342 induces apoptosis in HL-60 cells and inhibits topoisomerase I in vivo.

CONTEXT: Bisbenzimides (Hoechst 33342 and Hoechst 33258) are cell-permeable, adenine-thymine-specific dyes that bind to the minor groove of DNA and stain DNA. Hoechst 33342 induces apoptosis in BC3H-1 myocytes and hepatoma cells. OBJECTIVE: To determine if Hoechst 33342 or Hoechst 33258 induces apoptosis in human promyelocytic leukemia cells (HL-60) and inhibits topoisomerase I activity. DESIGN: A variety of methods were used to detect apoptosis: cell viability (trypan blue exclusion), nuclear fluorescence staining (Hoechst 33342 or Hoechst 33258 stained for 10 minutes), flow cytometric quantitation of annexin binding to phosphatidylserine, and DNA fragmentation (agarose gel electrophoresis). Topoisomerase I activity was determined by a plasmid unwinding assay. SETTING: A large teaching hospital and research laboratories. PATIENTS: None. INTERVENTION: None. MAIN OUTCOME MEASUREMENTS: Apoptosis is characterized by decreased cell viability, condensation of nuclear chromatin, increased phosphatidylserine translocation, and DNA fragmentation into oligonucleosomes composed of multiples of 180 to 200 base pairs. Inhibition of endogenous nuclear topoisomerase I is detected by the absence of plasmid unwinding from a tightly coiled to relaxed form. RESULTS: Hoechst 33342, but not Hoechst 33258, induced apoptosis in the HL-60 cells in a time- and dose-dependent manner. Endogenous nuclear topoisomerase I activity in HL-60 cells was inhibited by treatment with Hoechst 33342 but not Hoechst 33258. CONCLUSION: Hoechst 33342-induced HL-60 cell apoptosis may be related to the dye's inhibition of topoisomerase I activity.

The molecular pathology laboratory of the 21st century.

Human cells contain deoxyribonucleic acid in mitochondria and nuclei. Human diseases may be caused by mutations in mitochondrial DNA, nuclear DNA or both. The volume of work performed in the diagnostic molecular pathology laboratory will continue to grow as more disease-related mutations are discovered. Many factors will influence the diagnostic molecular pathology laboratory in the 21st century, such as future clinical laboratory organization, amplification methods, specimen integrity, ethical guidelines and opportunities to expand service. In the evaluation of a patient suspected of a mitochondrial DNA mutation, care must be exercised in the selection of a primer for amplification and of the specimen to be examined for the mutation. The uneven distribution of normal and abnormal mitochondrial DNA within the various tissues (heteroplasmy) may result in a normal mitochondrial DNA sequence if the wrong tissue is examined. The presence of mitochondrial-like sequences (pseudogenes) within nuclear DNA may result in amplification of nuclear genes if generic primers are used to duplicate a mitochondrial DNA gene. Diabetes mellitus is a heterogeneous disease with mutations occurring in a variety of proteins leading to either prereceptor, receptor or postreceptor defects. In this example, the diagnostic molecular pathology laboratory may be asked to define the specific genotype a specific patient with this common phenotype may possess.

Hoechst 33342 induces apoptosis and alters tata box binding protein/DNA complexes in nuclei from BC3H-1 myocytes.

Hoechst 33342 and Hoechst 33258 bind to adenine-thymine rich regions of the minor groove of DNA. Hoechst 33342, but not Hoechst 33258, induces BC3H-1 myocyte cell death and DNA fragmentation into an internucleosomal pattern characteristics of apoptosis. Hoechst 33342 has been shown to inhibit endogenous nuclear topoisomerase I activity. Another enzymatic activity utilizing the minor groove of DNA, the initiation of RNA polymerase II activity by formation of a TATA box binding protein/TATA box promoter complex, is shown to be altered using a gel mobility shift assay. A [32P]-labeled 24-oligonucleotide containing a TATA box element formed one molecular weight complex in control and Hoechst 33258 treated cells. The presence of Hoechst 33342 (26.7 microM) decreased the amount of the control complex and increased the presence of lower molecular weight species suggesting degradation of nuclear TBP and/or release of other transcription factors from the complex creating a smaller sized molecular complex which retains TATA box binding capacity. These results suggest that the pathway utilized to induce apoptosis in BC3H-1 myocytes may also involve the alteration of normal TBP/DNA complex formation and reduction in the initiation of new transcription.

Mechanism of Hoechst 33342-induced apoptosis in BC3H-1 myocytes.

Hoechst 33342, a bisbenzimidazole dye, binds to adenine/thymine rich regions in the minor groove of deoxyribonucleic acid (DNA). This dye induces apoptosis in BC3H-1 myocytes. The mechanism of Hoechst 33342-induced apoptosis was investigated. Inhibitors of ribonucleic acid (RNA) synthesis, protein synthesis, and serine or cysteine proteases failed to prevent BC3H-1 myocyte death induced by Hoechst 33342. Apoptosis may be dependent on increased p53 expression. Hoechst 33342 had no effect on p53 expression in BC3H-1 myocytes. Lactate oxidation, a monitor of mitochondrial function, was altered by Hoechst 33342 in dose dependent manner. Also, nuclear extracts were used to assay endogenous topoisomerase I activity which was inhibited by Hoechst 33342 treatment of BC3H-1 myocytes. Therefore, Hoechst 33342 appears to initiate apoptosis in BC3H-1 myocytes by a pathway which is independent of de novo RNA and protein synthesis. However, the dye does initiate mitochondrial dysfunction and inhibition of nuclear topoisomerase I as two important steps in the apoptotic pathway.

Multicenter study of oxygen-insensitive handheld glucose point-of-care testing in critical care/hospital/ambulatory patients in the United States and Canada.

OBJECTIVES: Existing handheld glucose meters are glucose oxidase (GO)-based. Oxygen side reactions can introduce oxygen dependency, increase potential error, and limit clinical use. Our primary objectives were to: a) introduce a new glucose dehydrogenase (GD)-based electrochemical biosensor for point-of-care testing; b) determine the oxygen-sensitivity of GO- and GD-based electrochemical biosensor test strips; and c) evaluate the clinical performance of the new GD-based glucose meter system in critical care/hospital/ambulatory patients. DESIGN: Multicenter study sites compared glucose levels determined with GD-based biosensors to glucose levels determined in whole blood with a perchloric acid deproteinization hexokinase reference method. One site also studied GO-based biosensors and venous plasma glucose measured with a chemistry analyzer. Biosensor test strips were used with a handheld glucose monitoring system. Bench and clinical oxygen sensitivity, hematocrit effect, and precision were evaluated. SETTING: The study was performed at eight U.S. medical centers and one Canadian medical center. PATIENTS: There were 1,248 patients. RESULTS: The GO-based biosensor was oxygen-sensitive. The new GD-based biosensor was oxygen-insensitive. GD-based biosensor performance was acceptable: 2,104 (96.1%) of 2,189 glucose meter measurements were within +/-15 mg/dL (+/-0.83 mmol/L) for glucose levels of < or = 100 mg/dL (< or = 5.55 mmol/L) or within +/-15% for glucose levels of > 100 mg/dL, compared with the whole-blood reference method results. With the GD-based biosensor, the percentages of glucose measurements that were not within the error tolerance were comparable for different specimen types and clinical groups. Bracket predictive values were acceptable for glucose levels used in therapeutic management. CONCLUSIONS: The performance of GD-based, oxygen-insensitive, handheld glucose testing was technically suitable for arterial specimens in critical care patients, cord blood and heelstick specimens in neonates, and capillary and venous specimens in other patients. Multicenter findings benchmark the performance of bedside glucose testing devices. With the new +/-15 mg/dL --> 100 mg/dL --> +/-15% accuracy criterion, point-of-care systems for handheld glucose testing should score 95% (or better), as compared with the recommended reference method. Physiologic changes, preanalytical factors, confounding variables, and treatment goals must be taken into consideration when interpreting glucose results, especially in critically ill patients, for whom arterial blood glucose measurements will reflect systemic glucose levels.

Hoechst 33342-induced apoptosis in BC3H-1 myocytes.

Bisbenzimidazoles (Hoechst 33342 and Hoechst 33258) are cell permeable, adenine-thymine binding fluorescent dyes used to stain deoxyribonucleic acid (DNA) during the evaluation of cell cycle, induction of apoptosis by various ligands and cell viability by flow cytometry. These dyes inhibit topoisomerase I activity in vitro, like camptothecin. In this study, Hoechst 33342 is shown to induce apoptosis at concentration of 10 micrograms/mL or greater after 3 hours incubation in Dulbecco's Modified Eagle Medium characterized by rounded cell morphology, half-moon nuclei with condensed chromatin and a DNA fragmentation ladder of 180 base pair multiples. Hoechst 33258 at the same molarity or seven times greater molarity did not induce apoptosis. If the BC3H-1 myocytes were incubated in RPMI-1640 media, two times the concentration of Hoechst 33342 (20 micrograms/mL) was required to initiate apoptosis. Staining of unfixed cells with Hoechst 33342 may induce apoptosis in the absence of ligands. Therefore, Hoechst 33342 concentration and staining interval should be tested before ligands which may induce apoptosis are evaluated.

In situ measurement of nitric oxide, superoxide and peroxynitrite during endotoxemia.

We report in vivo and ex vivo measurements of nitric oxide (electrochemical), ex vivo in situ measurements of superoxide (chemiluminescence) and peroxynitrite (chemiluminescence) and delineate the effect of endotoxemia on nitric oxide, superoxide and peroxynitrite release in aorta of rats. Nitric oxide release was measured in the aorta wall. An increase of nitric oxide concentration was observed immediately after administration of lipopolysaccharide (Escherichia coli serotype 0127: B8, 20 mg/kg), reaching a plateau ((50 nmol/L) after 180 +/- 50 seconds; the plateau was followed by decreasing nitric oxide concentration and its subsequent gradual small increase after 45 minutes. Superoxide and peroxynitrite production increased dramatically during endotoxemia. Superoxide concentration increased from 10 +/- 2 nmol/L to 28 +/- 3 nmol/L at one hour, and reached a 50 nmol/L plateau at 4 hours. The pattern of peroxynitrite release paralleled the pattern of superoxide release during the time course of endotoxemia. Diametrical alteration of nitric oxide and superoxide concentration with subsequent production of peroxynitrite may be a major cause of endothelial cell injury during endotoxemia.

Specimen stability for DNA-based diagnostic testing.

The use of molecular diagnostic testing is increasing in the clinical setting; therefore, data regarding DNA stability in clinical specimens are essential for correct test performance and interpretation. This study was designed to determine DNA stability in peripheral blood and solid tissue under different storage conditions. DNA quality and yield were assayed by spectrophotometric absorbance, gel electrophoresis, and suitability for Southern hybridization and polymerase chain reaction (PCR), the most widely employed clinical DNA analyses. A second goal of the study was to evaluate DNA stability during storage at 4 degrees C for 1 month to 3 years. The data show that freezing or refrigeration of separated leukocytes is preferable for short- to intermediate-term storage and freezing is preferable for solid tissue. DNA degradation varying from slight to severe is seen inconsistently with such specimens, probably due to sampling of unevenly frozen-tissue areas. Depending on the degree of DNA degradation, analysis may still be possible by PCR and in some cases even by Southern hybridization. Once isolated, DNA was stable at 4 degrees C for at least 3 years. These results suggest a more flexible approach to specimen requirements for molecular pathology, as some samples that would routinely be rejected gave interpretable results.

Indirect detection of nitric oxide effects: a review.

Nitric oxide is generated from L-arginine by the action of nitric oxide synthase, an enzyme encoded by three different genes. Nitric oxide is involved in an expanding number of phenomena. This involvement may be documented by direct detection using spectrophotometric or electrochemical methods or more often by indirect methods. Indirect methods for detection of nitric oxide effects include localization of nitric oxide synthase enzyme by immunochemistry or messenger ribonucleic acid (mRNA) by in situ hybridization, bioassays, inhibition of nitric oxide synthase activity, iron responsive element binding protein activity, and production of nitrate/nitrite, L-citrulline, or cyclic guanosine monophosphate (cGMP). Careful evaluation of potential pitfalls associated with these indirect methods of detecting nitric oxide effects prior to their use will prevent misinterpretation of results.

Endometriosis: identification by carbonic anhydrase autoantibodies and clinical features.

Reliably diagnosing endometriosis traditionally requires surgery. To evaluate a possible non-surgical method, a case-control series of unexplained infertility patients undergoing diagnostic laparoscopy were scored by clinical criteria and reactivity to human carbonic anhydrase II by Western blotting. The CA II autoantibodies were found in none of the fertile controls, 38 percent of infertile controls, 55 percent of stage 1, 50 percent of stage 2, 73 percent of stage 3, and 85 percent of stage 4 endometriosis patients. Advanced endometriosis was associated with more intense reactivity. Combining clinical and antibody scores for infertile groups showed a positive association with disease stage with positive predictive values of 76 to 95 percent, negative predictive values of 90 to 60 percent, and a likelihood ratio of 18.3. It is concluded by us that CA II immunoreactivity, clinical, and combined scores all identified stages 2 to 4 endometriosis patients. However, based on predictive values and likelihood ratios, the combined score is best at identifying endometriosis non-surgically.