Characterization of Grapevine Fanleaf Virus Isolates in 'Chardonnay' Vines Exhibiting Severe and Mild Symptoms in Two Vineyards.

Fanleaf degeneration is a complex viral disease of Vitis spp. that detrimentally impacts fruit yield and reduces the productive lifespan of most vineyards worldwide. In France, its main causal agent is grapevine fanleaf virus (GFLV). In the past, field experiments were conducted to explore cross-protection as a management strategy of fanleaf degeneration, but results were unsatisfactory because the mild virus strain negatively impacted fruit yield. In order to select new mild GFLV isolates, we examined two old 'Chardonnay' parcels harbouring vines with distinct phenotypes. Symptoms and agronomic performances were monitored over the four-year study on 21 individual vines that were classified into three categories: asymptomatic GFLV-free vines, GFLV-infected vines severely diseased and GFLV-infected vines displaying mild symptoms. The complete coding genomic sequences of GFLV isolates in infected vines was determined by high-throughput sequencing. Most grapevines were infected with multiple genetically divergent variants. While no specific molecular features were apparent for GFLV isolates from vines displaying mild symptoms, a genetic differentiation of GFLV populations depending on the vineyard parcel was observed. The mild symptomatic grapevines identified during this study were established in a greenhouse to recover GFLV variants of potential interest for cross-protection studies.

Severe Stunting Symptoms upon Nepovirus Infection Are Reminiscent of a Chronic Hypersensitive-like Response in a Perennial Woody Fruit Crop.

Virus infection of plants can result in various degrees of detrimental impacts and disparate symptom types and severities. Although great strides have been made in our understanding of the virus-host interactions in herbaceous model plants, the mechanisms underlying symptom development are poorly understood in perennial fruit crops. Grapevine fanleaf virus (GFLV) causes variable symptoms in most vineyards worldwide. To better understand GFLV-grapevine interactions in relation to symptom development, field and greenhouse trials were conducted with a grapevine genotype that exhibits distinct symptoms in response to a severe and a mild strain of GFLV. After validation of the infection status of the experimental vines by high-throughput sequencing, the transcriptomic and metabolomic profiles in plants infected with the two viral strains were tested and compared by RNA-Seq and LC-MS, respectively, in the differentiating grapevine genotype. In vines infected with the severe GFLV strain, 1023 genes, among which some are implicated in the regulation of the hypersensitive-type response, were specifically deregulated, and a higher accumulation of resveratrol and phytohormones was observed. Interestingly, some experimental vines restricted the virus to the rootstock and remained symptomless. Our results suggest that GFLV induces a strain- and cultivar-specific defense reaction similar to a hypersensitive reaction. This type of defense leads to a severe stunting phenotype in some grapevines, whereas others are resistant. This work is the first evidence of a hypersensitive-like reaction in grapevine during virus infection.

Evidence of differential spreading events of grapevine pinot Gris virus in Italy using datamining as a tool.

Since its identification in 2003, grapevine Pinot gris virus (GPGV, Trichovirus) has now been detected in most grape-growing countries. So far, little is known about the epidemiology of this newly emerging virus. In this work, we used datamining as a tool to monitor in-silico the sanitary status of three vineyards in Italy. All data used in the study were recovered from a work that was already published and for which data were publicly available as SRA (Sequence Read Archive, NCBI) files. While incomplete, knowledge gathered from this work was still important, with evidence of differential accumulation of the virus in grapevine according to year, location, and variety-rootstock association. Additional data regarding GPGV genetic diversity were collected. Some advantages and pitfalls of datamining are discussed.

First report of Grapevine enamovirus 1 in Vitis vinifera cultivar 'Meunier' in France.

Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.

Structural basis of nanobody recognition of grapevine fanleaf virus and of virus resistance loss.

Grapevine fanleaf virus (GFLV) is a picorna-like plant virus transmitted by nematodes that affects vineyards worldwide. Nanobody (Nb)-mediated resistance against GFLV has been created recently, and shown to be highly effective in plants, including grapevine, but the underlying mechanism is unknown. Here we present the high-resolution cryo electron microscopy structure of the GFLV-Nb23 complex, which provides the basis for molecular recognition by the Nb. The structure reveals a composite binding site bridging over three domains of one capsid protein (CP) monomer. The structure provides a precise mapping of the Nb23 epitope on the GFLV capsid in which the antigen loop is accommodated through an induced-fit mechanism. Moreover, we uncover and characterize several resistance-breaking GFLV isolates with amino acids mapping within this epitope, including C-terminal extensions of the CP, which would sterically interfere with Nb binding. Escape variants with such extended CP fail to be transmitted by nematodes linking Nb-mediated resistance to vector transmission. Together, these data provide insights into the molecular mechanism of Nb23-mediated recognition of GFLV and of virus resistance loss.

Detection of Multiple Variants of Grapevine Fanleaf Virus in Single Xiphinema index Nematodes.

Grapevine fanleaf virus (GFLV) is responsible for a widespread disease in vineyards worldwide. Its genome is composed of two single-stranded positive-sense RNAs, which both show a high genetic diversity. The virus is transmitted from grapevine to grapevine by the ectoparasitic nematode Xiphinema index. Grapevines in diseased vineyards are often infected by multiple genetic variants of GFLV but no information is available on the molecular composition of virus variants retained in X. index following nematodes feeding on roots. In this work, aviruliferous X. index were fed on three naturally GFLV-infected grapevines for which the virome was characterized by RNAseq. Six RNA-1 and four RNA-2 molecules were assembled segregating into four and three distinct phylogenetic clades of RNA-1 and RNA-2, respectively. After 19 months of rearing, single and pools of 30 X. index tested positive for GFLV. Additionally, either pooled or single X. index carried multiple variants of the two GFLV genomic RNAs. However, the full viral genetic diversity found in the leaves of infected grapevines was not detected in viruliferous nematodes, indicating a genetic bottleneck. Our results provide new insights into the complexity of GFLV populations and the putative role of X. index as reservoirs of virus diversity.

From a Movement-Deficient Grapevine Fanleaf Virus to the Identification of a New Viral Determinant of Nematode Transmission.

Grapevine fanleaf virus (GFLV) and arabis mosaic virus (ArMV) are nepoviruses responsible for grapevine degeneration. They are specifically transmitted from grapevine to grapevine by two distinct ectoparasitic dagger nematodes of the genus Xiphinema. GFLV and ArMV move from cell to cell as virions through tubules formed into plasmodesmata by the self-assembly of the viral movement protein. Five surface-exposed regions in the coat protein called R1 to R5, which differ between the two viruses, were previously defined and exchanged to test their involvement in virus transmission, leading to the identification of region R2 as a transmission determinant. Region R4 (amino acids 258 to 264) could not be tested in transmission due to its requirement for plant systemic infection. Here, we present a fine-tuning mutagenesis of the GFLV coat protein in and around region R4 that restored the virus movement and allowed its evaluation in transmission. We show that residues T258, M260, D261, and R301 play a crucial role in virus transmission, thus representing a new viral determinant of nematode transmission.

Comparison of Serological and Molecular Methods With High-Throughput Sequencing for the Detection and Quantification of Grapevine Fanleaf Virus in Vineyard Samples.

Grapevine fanleaf virus (GFLV) is the main causal agent of fanleaf degeneration, the most damaging viral disease of grapevine. GFLV is included in most grapevine certification programs that rely on robust diagnostic tools such as biological indexing, serological methods, and molecular techniques, for the identification of clean stocks. The emergence of high throughput sequencing (HTS) offers new opportunities for detecting GFLV and other viruses in grapevine accessions of interest. Here, two HTS-based methods, i.e., RNAseq and smallRNAseq (focusing on the 21 to 27 nt) were explored for their potential to characterize the virome of grapevine samples from two 30-year-old GFLV-infected vineyards in the Champagne region of France. smallrnaseq was optimal for the detection of a wide range of viral species within a sample and RNAseq was the method of choice for full-length viral genome assembly. The implementation of a protocol to discriminate between low GFLV titer and in silico contamination (intra-lane contamination due to index misassignment) during data processing was critical for data analyses. Furthermore, we compared the performance of semi-quantitative DAS-ELISA (double antibody enzyme-linked immunosorbent assay), RT-qPCR (Reverse transcription-quantitative polymerase chain reaction), Immuno capture (IC)-RT-PCR, northern blot for viral small interfering RNA (vsiRNA) detection and RNAseq for the detection and quantification of GFLV. While detection limits were variable among methods, as expected, GFLV diagnosis was consistently achieved with all of these diagnostic methods. Together, this work highlights the robustness of DAS-ELISA, the current method routinely used in the French grapevine certification program, for the detection of GFLV and offers perspectives on the potential of HTS as an approach of high interest for certification.

High-Throughput Sequencing and the Viromic Study of Grapevine Leaves: From the Detection of Grapevine-Infecting Viruses to the Description of a New Environmental Tymovirales Member.

In the past decade, high-throughput sequencing (HTS) has had a major impact on virus diversity studies as well as on diagnosis, providing an unbiased and more comprehensive view of the virome of a wide range of organisms. Rather than the serological and molecular-based methods, with their more "reductionist" view focusing on one or a few known agents, HTS-based approaches are able to give a "holistic snapshot" of the complex phytobiome of a sample of interest. In grapevine for example, HTS is powerful enough to allow for the assembly of complete genomes of the various viral species or variants infecting a sample of known or novel virus species. In the present study, a total RNAseq-based approach was used to determine the full genome sequences of various grapevine fanleaf virus (GFLV) isolates and to analyze the eventual presence of other viral agents. From four RNAseq datasets, a few complete grapevine-infecting virus and viroid genomes were de-novo assembled: (a) three GFLV genomes, 11 grapevine rupestris stem-pitting associated virus (GRSPaV) and six viroids. In addition, a novel viral genome was detected in all four datasets, consisting of a single-stranded, positive-sense RNA molecule of 6033 nucleotides. This genome displays an organization similar to Tymoviridae family members in the Tymovirales order. Nonetheless, the new virus shows enough differences to be considered as a new species defining a new genus. Detection of this new agent in the original grapevines proved very erratic and was only consistent at the end of the growing season. This virus was never detected in the spring period, raising the possibility that it might not be a grapevine-infecting virus, but rather a virus infecting a grapevine-associated organism that may be transiently present on grapevine samples at some periods of the year. Indeed, the Tymoviridae family comprises isometric viruses infecting a wide range of hosts in different kingdoms (Plantae, Fungi, and Animalia). The present work highlights the fact that even though HTS technologies produce invaluable data for the description of the sanitary status of a plant, in-depth biological studies are necessary before assigning a new virus to a particular host in such metagenomic approaches.

Nanobody-mediated resistance to Grapevine fanleaf virus in plants.

Since their discovery, single-domain antigen-binding fragments of camelid-derived heavy-chain-only antibodies, also known as nanobodies (Nbs), have proven to be of outstanding interest as therapeutics against human diseases and pathogens including viruses, but their use against phytopathogens remains limited. Many plant viruses including Grapevine fanleaf virus (GFLV), a nematode-transmitted icosahedral virus and causal agent of fanleaf degenerative disease, have worldwide distribution and huge burden on crop yields representing billions of US dollars of losses annually, yet solutions to combat these viruses are often limited or inefficient. Here, we identified a Nb specific to GFLV that confers strong resistance to GFLV upon stable expression in the model plant Nicotiana benthamiana and also in grapevine rootstock, the natural host of the virus. We showed that resistance was effective against a broad range of GFLV isolates independently of the inoculation method including upon nematode transmission but not against its close relative, Arabis mosaic virus. We also demonstrated that virus neutralization occurs at an early step of the virus life cycle, prior to cell-to-cell movement. Our findings will not only be instrumental to confer resistance to GFLV in grapevine, but more generally they pave the way for the generation of novel antiviral strategies in plants based on Nbs.

Metagenomic-based impact study of transgenic grapevine rootstock on its associated virome and soil bacteriome.

For some crops, the only possible approach to gain a specific trait requires genome modification. The development of virus-resistant transgenic plants based on the pathogen-derived resistance strategy has been a success story for over three decades. However, potential risks associated with the technology, such as horizontal gene transfer (HGT) of any part of the transgene to an existing gene pool, have been raised. Here, we report no evidence of any undesirable impacts of genetically modified (GM) grapevine rootstock on its biotic environment. Using state of the art metagenomics, we analysed two compartments in depth, the targeted Grapevine fanleaf virus (GFLV) populations and nontargeted root-associated microbiota. Our results reveal no statistically significant differences in the genetic diversity of bacteria that can be linked to the GM trait. In addition, no novel virus or bacteria recombinants of biosafety concern can be associated with transgenic grapevine rootstocks cultivated in commercial vineyard soil under greenhouse conditions for over 6 years.

The 50 distal amino acids of the 2AHP homing protein of Grapevine fanleaf virus elicit a hypersensitive reaction on Nicotiana occidentalis.

Avirulence factors are critical for the arm's race between a virus and its host in determining incompatible reactions. The response of plants to viruses from the genus Nepovirus in the family Secoviridae, including Grapevine fanleaf virus (GFLV), is well characterized, although the nature and characteristics of the viral avirulence factor remain elusive. By using infectious clones of GFLV strains F13 and GHu in a reverse genetics approach with wild-type, assortant and chimeric viruses, the determinant of necrotic lesions caused by GFLV-F13 on inoculated leaves of Nicotiana occidentalis was mapped to the RNA2-encoded protein 2AHP , particularly to its 50 C-terminal amino acids. The necrotic response showed hallmark characteristics of a genuine hypersensitive reaction, such as the accumulation of phytoalexins, reactive oxygen species, pathogenesis-related protein 1c and hypersensitivity-related (hsr) 203J transcripts. Transient expression of the GFLV-F13 protein 2AHP fused to an enhanced green fluorescent protein (EGFP) tag in N. occidentalis by agroinfiltration was sufficient to elicit a hypersensitive reaction. In addition, the GFLV-F13 avirulence factor, when introduced in GFLV-GHu, which causes a compatible reaction on N. occidentalis, elicited necrosis and partially restricted the virus. This is the first identification of a nepovirus avirulence factor that is responsible for a hypersensitive reaction in both the context of virus infection and transient expression.

A strain-specific segment of the RNA-dependent RNA polymerase of grapevine fanleaf virus determines symptoms in Nicotiana species.

Factors involved in symptom expression of viruses from the genus Nepovirus in the family Secoviridae such as grapevine fanleaf virus (GFLV) are poorly characterized. To identify symptom determinants encoded by GFLV, infectious cDNA clones of RNA1 and RNA2 of strain GHu were developed and used alongside existing infectious cDNA clones of strain F13 in a reverse genetics approach. In vitro transcripts of homologous combinations of RNA1 and RNA2 induced systemic infection in Nicotiana benthamiana and Nicotiana clevelandii with identical phenotypes to WT virus strains, i.e. vein clearing and chlorotic spots on N. benthamiana and N. clevelandii for GHu, respectively, and lack of symptoms on both hosts for F13. The use of assorted transcripts mapped symptom determinants on RNA1 of GFLV strain GHu, in particular within the distal 408 nt of the RNA-dependent RNA polymerase (1E(Pol)), as shown by RNA1 transcripts for which coding regions or fragments derived thereof were swapped. Semi-quantitative analyses indicated no significant differences in virus titre between symptomatic and asymptomatic plants infected with various recombinants. Also, unlike the nepovirus tomato ringspot virus, no apparent proteolytic cleavage of GFLV protein 1E(Pol) was detected upon virus infection or transient expression in N. benthamiana. In addition, GFLV protein 1E(Pol) failed to suppress silencing of EGFP in transgenic N. benthamiana expressing EGFP or to enhance GFP expression in patch assays in WT N. benthamiana. Together, our results suggest the existence of strain-specific functional domains, including a symptom determinant module, on the RNA-dependent RNA polymerase of GFLV.

The backbone model of the Arabis mosaic virus reveals new insights into functional domains of Nepovirus capsid.

Arabis mosaic virus (ArMV) and Grapevine fanleaf virus (GFLV) are two picorna-like viruses from the genus Nepovirus, consisting in a bipartite RNA genome encapsidated into a 30 nm icosahedral viral particle formed by 60 copies of a single capsid protein (CP). They are responsible for a severe degeneration of grapevines that occurs in most vineyards worldwide. Although sharing a high level of sequence identity between their CP, ArMV is transmitted exclusively by the ectoparasitic nematode Xiphinema diversicaudatum whereas GFLV is specifically transmitted by the nematode X. index. The structural determinants involved in the transmission specificity of both viruses map solely to their respective CP. Recently, reverse genetic and crystallographic studies on GFLV revealed that a positively charged pocket in the CP B domain located at the virus surface may be responsible for vector specificity. To go further into delineating the coat protein determinants involved in transmission specificity, we determined the 6.5 Å resolution cryo-electron microscopy structure of ArMV and used homology modeling and flexible fitting approaches to build its pseudo-atomic structure. This study allowed us to resolve ArMV CP architecture and delineate connections between ArMV capsid shell and its RNA. Comparison of ArMV and GFLV CPs reveals structural differences in the B domain pocket, thus strengthening the hypothesis of a key role of this region in the viral transmission specificity and identifies new potential functional domains of Nepovirus capsid.

Transmission competency of single-female Xiphinema index lines for Grapevine fanleaf virus.

Grapevine fanleaf virus (GFLV) is vectored specifically from grapevine to grapevine by the ectoparasitic nematode Xiphinema index. Limited information is available on the vector competency of X. index populations from diverse geographical origins. We determined the transmissibility of two GFLV strains showing 4.6% amino acid divergence within their coat protein (e.g., strains F13 and GHu) by seven clonal lines of X. index developed from seven distinct populations from the Mediterranean basin (Cyprus, southern France, Israel, Italy, and Spain), northern France, and California. X. index lines derived from single adult females were produced on fig (Ficus carica) plants to obtain genetically homogenous aviruliferous clones. A comparative reproductive rate analysis on Vitis rupestris du Lot and V. vinifera cv. Cabernet Sauvignon showed significant differences among clones, with the single-female Cyprus line showing the highest rate (30-fold the initial population) and the Spain and California lines showing the lowest rate (10-fold increase), regardless of the grapevine genotype. However, there was no differential vector competency among the seven X. index lines for GFLV strains F13 and GHu. The implications of our findings for the dynamic of GFLV transmission in vineyards and screening of Vitis spp. for resistance to GFLV are discussed.

Genetic structure and variability of virus populations in cross-protected grapevines superinfected by Grapevine fanleaf virus.

Recombination was assessed in a vineyard site in which grapevines cross-protected with mild strains GHu of Grapevine fanleaf virus (GFLV) or Ta of Arabis mosaic virus (ArMV) were superinfected with GFLV field isolates following transmission by the nematode vector Xiphinema index. The genetic structure and variability within RNA2 of isolates from grapevines co-infected with GFLV field isolates and either GFLV-GHu or ArMV-Ta were characterized to identify intra- and interspecies recombinants. Sequence analysis and phylogenetic relationships inferred intraspecies recombination among GFLV field isolates but not between field isolates and GFLV-GHu. SISCAN analysis confirmed a mosaic structure for two GFLV field isolates for which recombination sites were located in the movement protein and coat protein genes. One of the recombinants was found in eight grapevines that were in close spatial proximity within the vineyard site, suggesting its transmission by X. index. No interspecies recombination was detected between GFLV field isolates and ArMV-Ta. Altogether, our findings suggest that mild protective strains GFLV-GHu and ArMV-Ta did not assist the emergence of viable recombinants to detectable level during a 12-year cross-protection trial. To our knowledge, this is the first extensive characterization of the genetic structure and variability of virus isolates in cross-protected plants.

Cross-Protection as Control Strategy Against Grapevine fanleaf virus in Naturally Infected Vineyards.

The efficacy of cross-protection at mitigating the impact of Grapevine fanleaf virus (GFLV) on grapevines (Vitis vinifera) was assessed in two naturally infected vineyard sites. Test vines consisted of scions grafted onto rootstocks that were healthy or infected by mild protective strains GFLV-GHu or Arabis mosaic virus (ArMV)-Ta. Challenge GFLV infection via the nematode Xiphinema index was monitored over nine consecutive years in control and ArMV-Ta cross-protected vines by double-antibody sandwich-enzyme-linked immunosorbent assay using GFLV-specific antibodies, and in GFLV-GHu cross-protected vines by characterizing the coat protein gene of superinfecting isolates by immunocapture-reverse transcription-polymerase chain reaction-restriction fragment length polymorphism. Results were consistent with a significantly reduced challenge infection rate in cross-protected vines compared with control vines, more so in those protected with GFLV-GHu (19 versus 90%) than with ArMV-Ta (40 versus 65% in field A and 63 versus 90% in field B). However, the two mild strains significantly reduced fruit yield by 9% (ArMV-Ta) and 17% (GFLV-GHu) over 8 years and had a limited effect on fruit quality. Therefore, in spite of a great potential at reducing the incidence of challenge field isolates, cross-protection with natural mild protective strains GFLV-GHu and ArMV-Ta is not attractive to control GFLV because the negative impact on yield is a limiting factor for its deployment.

Sensitive and reliable detection of grapevine fanleaf virus in a single Xiphinema index nematode vector.

Grapevine fanleaf virus (GFLV) is specifically transmitted from plant to plant by the ectoparasitic nematode Xiphinema index. A sensitive and reliable procedure was developed to readily detect GFLV in a single viruliferous X. index, regardless of the nematode origin, i.e. greenhouse rearings or vineyard soils. The assay is based on bead milling to disrupt nematodes extracted from soil samples, solid-phase extraction of total nematode RNAs, and amplification of a 555bp fragment of the coat protein (CP) gene by reverse transcription-polymerase chain reaction with two primers designed from conserved sequences. This procedure is sensitive since the CP gene fragment is amplified from an artificial sample consisting of one viruliferous nematode mixed with 3000 aviruliferous individuals. In addition, StyI RFLP analysis of the CP amplicon enables the GFLV isolate carried by a single viruliferous X. index to be characterized. This GFLV detection assay opens new avenues for epidemiological studies and for molecular investigations on the mechanism of X. index-mediated GFLV transmission.

Field safety assessment of recombination in transgenic grapevines expressing the coat protein gene of Grapevine fanleaf virus.

One of the major environmental safety issues over transgenic crops containing virus-derived genes relates to the outcome of recombination events between viral transgene transcripts and RNAs from indigenous virus populations. We addressed this issue by assessing the emergence of viable Grapevine fanleaf virus (GFLV) recombinants in transgenic grapevines expressing the GFLV coat protein (CP) gene. Test plants consisted of nontransgenic scions grafted onto transgenic and nontransgenic rootstocks that were exposed over 3 years to nematode-mediated GFLV infection in two distinct vineyard sites. The CP gene of challenging GFLV isolates was amplified from scions by IC-RT-PCR, and characterized by RFLP and nucleotide sequencing using strain F13 as reference since it provided the CP transgene. Analysis of EcoRI and StyI RFLP banding patterns from 347 challenging GFLV isolates and sequence data from 85 variants revealed no characteristics similar to strain F13 and no difference in the molecular variability among isolates from 190 transgenic and 157 nontransgenic plants, or from plants within (253 individuals) or outside (94 individuals) of the two sites. Interestingly, five GFLV recombinants were identified in three nontransgenic plants located outside of the two field settings. This survey indicates that transgenic grapevines did not assist the emergence of viable GFLV recombinants to detectable levels nor did they affect the molecular diversity of indigenous GFLV populations during the trial period. This is the first report on safety assessment of recombination with a transgenic crop expressing a CP gene under field conditions of heavy disease pressure but low, if any, selection pressure against recombinant viruses.

The specific transmission of Grapevine fanleaf virus by its nematode vector Xiphinema index is solely determined by the viral coat protein.

The viral determinants involved in the specific transmission of Grapevine fanleaf virus (GFLV) by its nematode vector Xiphinema index are located within the 513 C-terminal residues of the RNA2-encoded polyprotein, that is, the 9 C-terminal amino acids of the movement protein (2BMP) and contiguous 504 amino acids of the coat protein (2CCP) [Virology 291 (2001) 161]. To further delineate the viral determinants responsible for the specific spread, the four amino acids that are different within the 9 C-terminal 2BMP residues between GFLV and Arabis mosaic virus (ArMV), another nepovirus which is transmitted by Xiphinema diversicaudatum but not by X. index, were subjected to mutational analysis. Of the recombinant viruses derived from transcripts of GFLV RNA1 and RNA2 mutants that systemically infected herbaceous host plants, all with the 2CCP of GFLV were transmitted by X. index unlike none with the 2CCP of ArMV, regardless of the mutations within the 2BMP C-terminus. These results demonstrate that the coat protein is the sole viral determinant for the specific spread of GFLV by X. index.