Protein G-quadruplex interactions and their effects on phase transitions and protein aggregation.

The SERF family of proteins were originally discovered for their ability to accelerate amyloid formation. Znf706 is an uncharacterized protein whose N-terminus is homologous to SERF proteins. We show here that human Znf706 can promote protein aggregation and amyloid formation. Unexpectedly, Znf706 specifically interacts with stable, non-canonical nucleic acid structures known as G-quadruplexes. G-quadruplexes can affect gene regulation and suppress protein aggregation; however, it is unknown if and how these two activities are linked. We find Znf706 binds preferentially to parallel G-quadruplexes with low micromolar affinity, primarily using its N-terminus, and upon interaction, its dynamics are constrained. G-quadruplex binding suppresses Znf706's ability to promote protein aggregation. Znf706 in conjunction with G-quadruplexes therefore may play a role in regulating protein folding. RNAseq analysis shows that Znf706 depletion specifically impacts the mRNA abundance of genes that are predicted to contain high G-quadruplex density. Our studies give insight into how proteins and G-quadruplexes interact, and how these interactions affect both partners and lead to the modulation of protein aggregation and cellular mRNA levels. These observations suggest that the SERF family of proteins, in conjunction with G-quadruplexes, may have a broader role in regulating protein folding and gene expression than previously appreciated.

Protein G-quadruplex interactions and their effects on phase transitions and protein aggregation.

The SERF family of proteins were originally discovered for their ability to accelerate amyloid formation. Znf706 is an uncharacterized protein whose N-terminus is homologous to SERF proteins. We show here that human Znf706 can promote protein aggregation and amyloid formation. Unexpectedly, Znf706 specifically interacts with stable, non-canonical nucleic acid structures known as G-quadruplexes. G-quadruplexes can affect gene regulation and suppress protein aggregation; however, it is unknown if and how these two activities are linked. We find Znf706 binds preferentially to parallel G-quadruplexes with low micromolar affinity, primarily using its N-terminus, and upon interaction, its dynamics are constrained. G-quadruplex binding suppresses Znf706's ability to promote protein aggregation. Znf706 in conjunction with G-quadruplexes therefore may play a role in regulating protein folding. RNAseq analysis shows that Znf706 depletion specifically impacts the mRNA abundance of genes that are predicted to contain high G-quadruplex density. Our studies give insight into how proteins and G-quadruplexes interact, and how these interactions affect both partners and lead to the modulation of protein aggregation and cellular mRNA levels. These observations suggest that the SERF family of proteins, in conjunction with G-quadruplexes, may have a broader role in regulating protein folding and gene expression than previously appreciated.

Structure of pre-miR-31 reveals an active role in Dicer-TRBP complex processing.

As an essential posttranscriptional regulator of gene expression, microRNA (miRNA) levels must be strictly maintained. The biogenesis of many miRNAs is mediated by trans-acting protein partners through a variety of mechanisms, including remodeling of the RNA structure. miR-31 functions as an oncogene in numerous cancers, and interestingly, its biogenesis is not known to be regulated by protein-binding partners. Therefore, the intrinsic structural properties of the precursor element of miR-31 (pre-miR-31) can provide a mechanism by which its biogenesis is regulated. We determined the solution structure of pre-miR-31 to investigate the role of distinct structural elements in regulating processing by the Dicer-TRBP complex. We found that the presence or absence of mismatches within the helical stem does not strongly influence Dicer-TRBP processing of the pre-miRNAs. However, both the apical loop size and structure at the Dicing site are key elements for discrimination by the Dicer-TRBP complex. Interestingly, our NMR-derived structure reveals the presence of a triplet of base pairs that link the Dicer cleavage site and the apical loop. Mutational analysis in this region suggests that the stability of the junction region strongly influences processing by the Dicer-TRBP complex. Our results enrich our understanding of the active role that RNA structure plays in regulating miRNA biogenesis, which has direct implications for the control of gene expression.

Identification and characterisation of G-quadruplex DNA-forming sequences in the Pseudomonas aeruginosa genome.

A number of Gram-negative bacteria such as Pseudomonas aeruginosa are becoming resistant to front-line antibiotics. Consequently, there is a pressing need to find alternative bio-molecular targets for the development of new drugs. Since non-canonical DNA structures such as guanine-quadruplexes (G4s) have been implicated in regulating transcription, we were interested in determining whether there are putative quadruplex-forming sequences (PQS) in the genome of Pseudomonas aeruginosa. Using bioinformatic tools, we screened 36 genes potentially relevant to drug resistance for the presence of PQS and 10 of these were selected for biophysical characterisation (i.e. circular dichroism and thermal difference UV/Vis spectroscopy). These studies showed that three of these G-rich sequences (linked to murE, ftsB and mexC genes) form stable guanine-quadruplexes which were studied by NMR spectroscopy; detailed analysis of one of the sequences (mexC) confirmed that it adopts a two-quartet antiparallel quadruplex structure in the presence of K+ ions. We also show by FRET melting assays that small molecules can stabilise these three new G4 DNA structures under physiological conditions. These initial results could be of future interest in the development of new antibiotics with alternative bio-molecular targets which in turn would help tackle antimicrobial resistance.

Structure of pre-miR-31 reveals an active role in Dicer processing.

As an essential post-transcriptional regulator of gene expression, microRNA (miR) levels must be strictly maintained. The biogenesis of many, but not all, miRs is mediated by trans-acting protein partners through a variety of mechanisms, including remodeling of the RNA structure. miR-31 functions as an oncogene in numerous cancers and interestingly, its biogenesis is not known to be regulated by protein binding partners. Therefore, the intrinsic structural properties of pre-miR-31 can provide a mechanism by which its biogenesis is regulated. We determined the solution structure of the precursor element of miR-31 (pre-miR-31) to investigate the role of distinct structural elements in regulating Dicer processing. We found that the presence or absence of mismatches within the helical stem do not strongly influence Dicer processing of the pre-miR. However, both the apical loop size and structure at the Dicing site are key elements for discrimination by Dicer. Interestingly, our NMR-derived structure reveals the presence of a triplet of base pairs that link the Dicer cleavage site and the apical loop. Mutational analysis in this region suggests that the stability of the junction region strongly influence both Dicer binding and processing. Our results enrich our understanding of the active role that RNA structure plays in regulating Dicer processing which has direct implications for control of gene expression.

pH dependence of C•A, G•A and A•A mismatches in the stem of precursor microRNA-31.

MicroRNAs (miRNAs) are important regulators of post-transcriptional gene expression. Mature miRNAs are generated from longer transcripts (primary, pri- and precursor, pre-miRNAs) through a series of highly coordinated enzymatic processing steps. The sequence and structure of these pri- and pre-miRNAs play important roles in controlling their processing. Both pri- and pre-miRNAs adopt hairpin structures with imperfect base pairing in the helical stem. Here, we investigated the role of three base pair mismatches (A∙A, G∙A, and C∙A) present in pre-miRNA-31. Using a combination of NMR spectroscopy and thermal denaturation, we found that nucleotides within the three base pair mismatches displayed unique structural properties, including varying dynamics and sensitivity to solution pH. These studies deepen our understanding of how the physical and chemical properties of base pair mismatches influence RNA structural stability.

Chemical Modulation of DNA Replication along G-Quadruplex Based on Topology-Dependent Ligand Binding.

Ligands that bind to and stabilize guanine-quadruplex (G4) structures to regulate DNA replication have therapeutic potential for cancer and neurodegenerative diseases. Because there are several G4 topologies, ligands that bind to their specific types may have the ability to preferentially regulate the replication of only certain genes. Here, we demonstrated that binding ligands stalled the replication of template DNA at G4, depending on different topologies. For example, naphthalene diimide derivatives bound to the G-quartet of G4 with an additional interaction between the ligand and the loop region of a hybrid G4 type from human telomeres, which efficiently repressed the replication of the G4. Thus, these inhibitory effects were not only stability-dependent but also topology-selective based on the manner in which G4 structures interacted with G4 ligands. Our original method, referred to as a quantitative study of topology-dependent replication (QSTR), was developed to evaluate correlations between replication rate and G4 stability. QSTR enabled the systematic categorization of ligands based on topology-dependent binding. It also demonstrated accuracy in determining quantitatively how G4 ligands control the intermediate state of replication and the kinetics of G4 unwinding. Hence, the QSTR index would facilitate the design of new drugs capable of controlling the topology-dependent regulation of gene expression.

NMR chemical shift assignments of RNA oligonucleotides to expand the RNA chemical shift database.

RNAs play myriad functional and regulatory roles in the cell. Despite their significance, three-dimensional structure elucidation of RNA molecules lags significantly behind that of proteins. NMR-based studies are often rate-limited by the assignment of chemical shifts. Automation of the chemical shift assignment process can greatly facilitate structural studies, however, accurate chemical shift predictions rely on a robust and complete chemical shift database for training. We searched the Biological Magnetic Resonance Data Bank (BMRB) to identify sequences that had no (or limited) chemical shift information. Here, we report the chemical shift assignments for 12 RNA hairpins designed specifically to help populate the BMRB.

Nep1-like proteins as a target for plant pathogen control.

The lack of efficient methods to control the major diseases of crops most important to agriculture leads to huge economic losses and seriously threatens global food security. Many of the most important microbial plant pathogens, including bacteria, fungi, and oomycetes, secrete necrosis- and ethylene-inducing peptide 1 (Nep1)-like proteins (NLPs), which critically contribute to the virulence and spread of the disease. NLPs are cytotoxic to eudicot plants, as they disturb the plant plasma membrane by binding to specific plant membrane sphingolipid receptors. Their pivotal role in plant infection and broad taxonomic distribution makes NLPs a promising target for the development of novel phytopharmaceutical compounds. To identify compounds that bind to NLPs from the oomycetes Pythium aphanidermatum and Phytophthora parasitica, a library of 587 small molecules, most of which are commercially unavailable, was screened by surface plasmon resonance. Importantly, compounds that exhibited the highest affinity to NLPs were also found to inhibit NLP-mediated necrosis in tobacco leaves and Phytophthora infestans growth on potato leaves. Saturation transfer difference-nuclear magnetic resonance and molecular modelling of the most promising compound, anthranilic acid derivative, confirmed stable binding to the NLP protein, which resulted in decreased necrotic activity and reduced ion leakage from tobacco leaves. We, therefore, confirmed that NLPs are an appealing target for the development of novel phytopharmaceutical agents and strategies, which aim to directly interfere with the function of these major microbial virulence factors. The compounds identified in this study represent lead structures for further optimization and antimicrobial product development.

Advanced approaches for elucidating structures of large RNAs using NMR spectroscopy and complementary methods.

NMR spectroscopy is a key technique that has significantly advanced our understanding of RNA structure and dynamics. However, determination of large RNA structures by NMR spectroscopy remains a significant technical challenge. In this review, we highlight advances that facilitate NMR studies of large RNAs, including methods for sample preparation, isotope labeling strategies, and data acquisition. In addition, we review hybrid approaches that have been instrumental in the structure determination of large RNAs.

Intercalation of a Heterocyclic Ligand between Quartets in a G-Rich Tetrahelical Structure.

YES G-rich oligonucleotide VK2 folds into an AGCGA-quadruplex tetrahelical structure distinct and significantly different from G-quadruplexes, even though it contains four G3 tracts. Herein, a bis-quinolinium ligand 360A with high affinity for G-quadruplex structures and selective telomerase inhibition is shown to strongly bind to VK2. Upon binding, 360A does not induce a conformational switch from VK2 to an expected G-quadruplex. In contrast, NMR structural study revealed formation of a well-defined VK2-360A complex with a 1:1 binding stoichiometry, in which 360A intercalates between GAGA- and GCGC-quartets in the central cavity of VK2. This is the first high-resolution structure of a G-quadruplex ligand intercalating into a G-rich tetrahelical fold. This unique mode of ligand binding into tetrahelical DNA architecture offers insights into the stabilization of an AGCGA-quadruplex by a heterocyclic ligand and provides guidelines for rational design of novel VK2 binding molecules with selectivity for different DNA secondary structures.

Methylation of selenocysteine catalysed by thiopurine S-methyltransferase.

BACKGROUND: Methylation driven by thiopurine S-methylatransferase (TPMT) is crucial for deactivation of cytostatic and immunosuppressant thiopurines. Despite its remarkable integration into clinical practice, the endogenous function of TPMT is unknown. METHODS: To address the role of TPMT in methylation of selenium compounds, we established the research on saturation transfer difference (STD) and 77Se NMR spectroscopy, fluorescence measurements, as well as computational molecular docking simulations. RESULTS: Using STD NMR spectroscopy and fluorescence measurements of tryptophan residues in TPMT, we determined the binding of selenocysteine (Sec) to human recombinant TPMT. By comparing binding characteristics of Sec in the absence and in the presence of methyl donor, we confirmed S-adenosylmethionine (SAM)-induced conformational changes in TPMT. Molecular docking analysis positioned Sec into the active site of TPMT with orientation relevant for methylation reaction. Se-methylselenocysteine (MeSec), produced in the enzymatic reaction, was detected by 77Se NMR spectroscopy. A direct interaction between Sec and SAM in the active site of rTPMT and the formation of both products, MeSec and S-adenosylhomocysteine, was demonstrated using NMR spectroscopy. CONCLUSIONS: The present study provides evidence on in vitro methylation of Sec by rTPMT in a SAM-dependant manner. GENERAL SIGNIFICANCE: Our results suggest novel role of TPMT and demonstrate new insights into enzymatic modifications of the 21st amino acid.

Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure.

In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression.

Coexistence of two main folded G-quadruplexes within a single G-rich domain in the EGFR promoter.

EGFR is an oncogene which codifies for a tyrosine kinase receptor that represents an important target for anticancer therapy. Indeed, several human cancers showed an upregulation of the activity of this protein. The promoter of this gene contains some G-rich domains, thus representing a yet unexplored point of intervention to potentially silence this gene. Here, we explore the conformational equilibria of a 30-nt long sequence located at position -272 (EGFR-272). By merging spectroscopic and electrophoretic analysis performed on the wild-type sequence as well as on a wide panel of related mutants, we were able to prove that in potassium ion containing solution this sequence folds into two main G-quadruplex structures, one parallel and one hybrid. They show comparable thermal stabilities and affinities for the metal ion and, indeed, they are always co-present in solution. The folding process is driven by a hairpin occurring in the domain corresponding to the terminal loop which works as an important stabilizing element for both the identified G-quadruplex arrangements.

NMR Structure of a Triangulenium-Based Long-Lived Fluorescence Probe Bound to a G-Quadruplex.

An NMR structural study of the interaction between a small-molecule optical probe (DAOTA-M2) and a G-quadruplex from the promoter region of the c-myc oncogene revealed that they interact at 1:2 binding stoichiometry. NMR-restrained structural calculations show that binding of DAOTA-M2 occurs mainly through π-π stacking between the polyaromatic core of the ligand and guanine residues of the outer G-quartets. Interestingly, the binding affinities of DAOTA-M2 differ by a factor of two for the outer G-quartets of the unimolecular parallel G-quadruplex under study. Unrestrained MD calculations indicate that DAOTA-M2 displays significant dynamic behavior when stacked on a G-quartet plane. These studies provide molecular guidelines for the design of triangulenium derivatives that can be used as optical probes for G-quadruplexes.

STD NMR and molecular modelling insights into interaction of novel mannose-based ligands with DC-SIGN.

Study of interaction of mannose-based ligands with receptor DC-SIGN using high resolution NMR in combination with molecular modelling showed that four α-d-mannoside ligands interact with the binding site predominantly through the mannose moiety. The other two aromatic groups that are bound to α-d-mannose through a glycerol linker demonstrate interaction that can be related to their substitution pattern. Ligand with naphthyl and meta-substituted phenyl ring exhibited the most favourable binding characteristics. In addition to the predicted hydrophobic interactions of aromatic moieties our results propose new contacts of substituted phenyl moiety in the more polar area of the flat binding site of DC-SIGN and thus offer new possibilities in further designing of novel, more potent DC-SIGN antagonists.

Internalization and Accumulation in Dendritic Cells of a Small pH-Activatable Glycomimetic Fluorescent Probe as Revealed by Spectral Detection.

DC-SIGN, an antigen-uptake receptor in dendritic cells (DCs), has a clear role in the immune response but, conversely, can also facilitate infection by providing entry of pathogens into DCs. The key action in both processes is internalization into acidic endosomes and lysosomes. Molecular probes that bind to DC-SIGN could thus provide a useful tool to study internalization and constitute potential antagonists against pathogens. So far, only large molecules have been used to directly observe DC-SIGN-mediated internalization into DCs by fluorescence visualization. We designed and synthesized an appropriate small glycomimetic probe. Two particular properties of the probe were exploited: activation in a low-pH environment and an aggregation-induced spectral shift. Our results indicate that small glycomimetic molecules could compete with antigen/pathogen for binding not only outside but also inside the DC, thus preventing the harmful action of pathogens that are able to intrude into DCs, for example, HIV-1.