Characterisation of the anticryptococcal effect of the FC-1 toxin produced by Filobasidium capsuligenum.

The basidiomycetous yeast Filobasidium capsuligenum produces a killer toxin (FC-1) which is highly effective against the opportunistic fungal pathogen Cryptococcus neoformans. The aim of this work was to study the effect of the toxin on C. neoformans cells. The sensitivities of strains representing eight molecular subtypes (VNI-IV and VGI-IV) of the C. neoformans species complex, and of an additional 50 clinical and environmental isolates were determined. Analysis of cellular DNA by laser scanning cytometry and fluorescein isothiocyanate (FITC) staining of the toxin-treated cells revealed that the killing mechanism of FC-1 is neither cell cycle- nor cell wall biosynthesis-dependent; rather it may act as an ionophoric protein that disrupts the cytoplasmic membrane function. The competition assay results suggest that beta-1,6-glucan in the cell wall may provide the binding site for the killer protein. This anticryptococcal toxin has the potential to be applied as a therapeutic agent for the treatment of cryptococcosis.

DNA sequence diversity of intergenic spacer I region in the non-lipid-dependent species Malassezia pachydermatis isolated from animals.

The non-lipid-dependent species Malassezia pachydermatis is frequently isolated from animals. We analyzed the DNA sequences of the intergenic spacer (IGS) 1 region, which is the most variable region in the rRNA gene, of 43 M. pachydermatis strains obtained from dogs or cats. The lengths of the IGS 1 regions ranged from 552 to 898 bp and, based on the nucleotide sequence, these IGS 1 regions were divided into three major groups with 10 subtypes. Group 1 (552-601 bp long) was characterized by the short sequence repeat (CAGCA)n and had four to 14 repeats, and Group 3 (749-898 bp long), which included the neotype strain of M. pachydermatis, was characterized by the sequence (CAGCATAACATAACACACAACA)n in the IGS1 region. Group 2 possessed partial sequences of both Groups 1 and 3. Each group shared only 41.7-55.4% similarity in the IGS1 region with the other groups. The internal transcribed spacer (ITS) region and D1/D2 26S rDNA in the rRNA gene were also sequenced for representative strains in each IGS group. The groups were distinguished by both ITS (698-712 bp long including 5.8S rDNA) and D1/D2 26S rDNA (624 bp long) sequences with sequence similarities of 91.7-96.0% and 99.7-99.0%, respectively. Our results indicate that the sequence of the IGS region of M. pachydermatis has a remarkable intraspecies diversity, compared with ITS or D1/D2 26S rDNA, and that multiple genotypic strains of M. pachydermatis colonize animal skin.

Intron mobility results in rearrangement in mitochondrial DNAs of heterokaryon incompatible Aspergillus japonicus strains after protoplast fusion.

Mitochondrial transmission was carried out under selective conditions between incompatible Aspergillus japonicus strains always using an oligomycin-resistant mitochondrial donor and selecting for recipient nuclei and oligomycin-resistant mitochondria. All attempted intraspecific mitochondrial transmissions were successful, but the transmission between closely related A. japonicus and A. aculeatus failed. Under selection pressure, resistant progeny harbor the mitochondrial DNA (mtDNA) of the donor strain, which may remain unchanged or may be modified by the introns of the recipient mitochondrial genome. Detailed analysis of a certain strain harboring rearranged mtDNA suggests that the mtDNA profiles of recombinant-like progeny are strongly influenced by the characteristics and mobility of introns of both parental mtDNAs. Both intron loss and intron acquisition play a role in the rearrangement of mtDNA. In certain parental combinations, a particular intron was lost very frequently.

Effects of double-stranded RNA viruses on the reproduction of Phaffia rhodozyma.

DsRNA viruses were transferred from a virus-containing strain to a virus-free strain of Phaffia rhodozyma by protoplast fusion. The resulting new strain carried all three types of dsRNA of the virus-containing strain and had the electrophoretic karyotype of the virus-free strain. The effects of the dsRNA viruses on the host fitness were checked by following the asexual and the sexual reproductivity. The results demonstrated that viruses have no effect on the growth rate during the lag and log phases of the vegetative reproduction, but the maximum cell numbers in the stationary phase differ significantly. Inconclusive results were obtained as concerns the effects of viruses on the sexual reproduction.

Genetic diversity in the red yeast Cryptococcus hungaricus and its phylogenetic relationship to some related basidiomycetous yeasts.

Cryptococcus hungaricus is a basidiomycetous yeast with the abilities to synthesize carotenoid pigments and to grow under psychrophile conditions. Six C. hungaricus strains have been isolated so far from different habitats. In this study we wished to clarify the relationships amongst them. Morphological and physiological characters, mitochondrial DNA restriction profiles, and the presence of mycoviruses were examined. Internal transcribed spacers together with the 5.8S rDNA, the D1/D2 region of 26S rDNA, and partial sequences of the 18S rRNA gene were also analysed. On the basis of the phylogenetic analyses the type strain CBS 4214(T) together with four other C. hungaricus isolates were closely related to Bullera armeniaca and Bullera crocea, while strain CBS 6569 was much more similar to Cystofilobasidium than to the other C. hungaricus isolates.

Simple detection method for distinguishing dead and living yeast colonies.

A rapid and simple assay was developed for detection of yeast colonies containing dying or dead cells. Methylene blue, phloxin B, rose bengal and trypan blue at concentrations of 5-10 micromol l(-1) were shown to stain non-viable cells in colonies of Saccharomyces cerevisiae, Schizosaccharomyces pombe, Candida albicans and Filobasidium capsuligenum without staining or affecting the viability of living cells of the colonies.

Topology of microtubules and actin in the life cycle of Xanthophyllomyces dendrorhous (Phaffia rhodozyma).

The morphology of budding and conjugating cells and associated changes in microtubules and actin distribution were studied in the yeast Xanthophyllomyces dendrorhous (Phaffia rhodozyma) by phase-contrast and fluorescence microscopy. The non-budding interphase cell showed a nucleus situated in the central position and bundles of cytoplasmic microtubules either stretching parallel to the longitudinal cell axis or randomly distributed in the cell; none of these, however, had a character of astral microtubules. During mitosis, the nucleus divided in the daughter cell, cytoplasmic microtubules disappeared and were replaced by a spindle. The cytoplasmic microtubules reappeared after mitosis had finished. Actin patches were present both in the bud and the mother cell. Cells were induced to mate by transfer to ribitol-containing medium without nitrogen. Partner cells fused by conjugation projections where actin patches had been accumulated. Cell fusion resulted in a zygote that produced a basidium with parallel bundles of microtubules extended along its axis and with actin patches concentrated at the apex. The fused nucleus moved towards the tip of the basidium. During this movement, nuclear division was taking place; the nuclei were eventually distributed to basidiospores. Mitochondria appeared as vesicles of various sizes; their large amounts were found, often lying adjacent to microtubules, in the subcortical cytoplasm of both vegetative cells and zygotes.

Homothallic life cycle in the diploid red yeast Xanthophyllomyces dendrorhous (Phaffia rhodozyma).

Sexual activity was induced in the basidiomyceteous Phaffia rhodozyma (Xanthophyllomyces dendrorhous) by depletion of nitrogen from the culture medium. This activity involved both mating between two yeast cells and the formation of basidiospores. Mating is possibly started by a G1 phase arrest of the cell cycle, as in other yeasts. The life cycle exhibited homothallic features. Crosses between genetically marked strains, and pulse-field gel electrophoresis of the chromosomal DNA of cells derived from individual spores revealed evidence of karyogamy, meiosis and even recombination. The segregation ratio in tetrads pointed to diploid vegetative cells, which formed tetraploid zygotes and the immediate meiosis then gave rise to diploid progenies again. Apart from the type strain Phaffia rhodozyma CBS 5905, all the examined strains were able to sporulate.

Rapid atrazine mineralisation in soil slurry and moist soil by inoculation of an atrazine-degrading Pseudomonas sp. strain.

The evaluation of pesticide-mineralising microorganisms to clean-up contaminated soils was studied with the widely applied and easily detectable compound atrazine, which is rapidly mineralised by several microorganisms including the Pseudomonas sp. strain Yaya 6. The rate of atrazine removal was proportional to the water content of the soil and the amount of bacteria added to the soil. In soil slurry, 6 mg atrazine kg soil-1 was eliminated within 1 day after application of 0.3 g dry weight inoculant biomass kg soil-1 and within 5 days when 0.003 g kg soil-1 was used. In partially saturated soil (60% of the maximal water-holding capacity) 15 mg atrazine kg soil-1 was used. In unsaturated soil, about 60% [U-ring-14C] atrazine was converted to 14CO2 within 14 days. Atrazine was very efficiently removed by the inoculant biomass, not only in soil that was freshly contaminated but also in soil aged with atrazine for up to 260 days. The bacteria exposed to atrazine in unsaturated sterile soil were still active after starvation period of 240 days: 15 mg newly added atrazine kg soil-1 was eliminated within 5 days.

Isolation of dsRNA-associated VLPs from the strain Cryptococcus hungaricus CBS 6569.

Double-stranded RNAs (dsRNAs) with molecular masses 1.7 and 5.0 kbp, respectively, were isolated from the strain Cryptococcus hungaricus CBS 6569. The dsRNAs were copurified with eicosahedric virus-like particles, 29 nm in diameter. This strain produced a protease-sensitive 'toxin' which inhibited the growth of strain C. hungaricus CBS 4214. The toxin had maximum activity at pH 3.7. The highest toxin amount was attained after a culture period of four days.

A novel method for hybridization of Saccharomyces species without genetic markers.

Protoplasts of Saccharomyces cerevisiae were inactivated by treatment with different concentrations of antifungal compounds for various periods. Of the 14 compounds tested, N-ethylmaleimide proved to be the most efficient. The inactivation effect was fully reproducible. The inactivated protoplasts could be reactivated and still function as fusion partners. They were fused with untreated protoplasts by polyethylene glycol treatment and produced viable hybrid cells. Nuclear and extrachromosomal genetic analysis and chromosome separation of the fusion products from fusion experiments involving inactivated and non-inactivated protoplasts revealed that N-ethylmaleimide did not affect either of the genomes and hence it was perfectly suited for the hybridization of any type yeast cells without genetic markers.

Variability and inheritance of double-stranded RNA viruses in Phaffia rhodozyma.

The present survey demonstrates polymorphism in both the length and the number of double-stranded RNAs (dsRNAs) among six Phaffia rhodozyma strains. Strains with one-, three- and four-types of dsRNA molecules were found, while two strains proved to be dsRNA-free. Elongated icosahedral virus-like particles (VLPs) 34x26 nm in size were detected in strains carrying four- or three-types of dsRNAs. One 3.7-kb dsRNA molecule was found not to form part of the VLP genome. Transmission of the VLPs of strain ATCC 24203 was followed through the basidiospores during the sexual cycle. Cytoplasmic inheritance was observed.

A physical method for separating Saccharomyces cerevisiae cells according to their ploidy.

A centrifugation technique, using genetically marked Saccharomyces cerevisiae strains, has been developed to separate Saccharomyces cerevisiae cells of different ploidy levels from exponential phase cultures. The method involves the conversion of yeast cells to protoplasts, the separation of the protoplasts on an osmotically stabilized Nycodenz gradient, and their regeneration. This type of selection may be of importance where selectable markers are not available.