First Report of Barley yellow dwarf virus and Cereal yellow dwarf virus Affecting Cereal Crops in Azerbaijan.

A field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5'TTCGGMSARTGGTTGTGGTCCA 3' and YanR-new 5'TGTTGAGGAGTCTACCTATTTNG 3' (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5'TCACSTTCGGRCCGWSTYTWTCAG 3' (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5'TTGTACCGCTTGATCCACGG 3' et CYDV-rev-New 5'GTCTGCGCGAACCATTGCC 3', both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen. References: (1) M. Deb and J. M. Anderson. J. Virol. Meth. 148:17, 2008. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) C. M. Malmstrom and R. Shu. J. Virol. Meth. 120:69, 2004. (4) W. A. Miller and L. Rasochovà. Ann. Rev. Phytopathol. 35:167, 1997.

First Report of Wheat dwarf virus and Its Vector (Psammotettix provincialis) Affecting Wheat and Barley Crops in Syria.

A field survey covering the major cereal-production areas of Syria was conducted during May 2009. A total of 938 wheat and 971 barley samples with typical symptoms of viral infection were collected from 45 wheat and 58 barley fields. All collected samples were tested by the tissue-blot immunoassay (1) at the Virology Laboratory of ICARDA, Syria using six specific cereal virus antisera, including polyclonal antibody AS-0216 for Wheat dwarf virus (WDV) provided by the German Collection of Microorganisms and Cell Cultures (DSMZ). Serological tests showed that WDV was detected in 16 wheat (cv. Cham 8) and five barley (cv. Arabic abiad) samples collected from Al-Hasskah governorate (eastern region of Syria) and showing dwarfing, yellowing, and reduced heading. Samples that reacted with WDV antiserum were transmitted from infected plants to healthy plants of oat (Avena sativa L.), barley (Hordeum vulgare L.), wheat (Triticum aestivum L.), and some grass species using four different leafhopper species, collected from Syrian wheat and barley fields, in a persistent manner. Leafhopper transmission tests indicated that only Psammotettix provincialis Ribaut was able to transmit Syrian barley WDV isolates (SB 1248-09 and SB 1249-09) from infected barley plants to healthy barley (48 plants became infected of 50 plants inoculated) and oats (45 of 50) under greenhouse conditions. The identity of P. provincialis was confirmed by the British Museum. Total DNA was extracted from six WDV-positive samples (three wheat and three barley) and tested by PCR using WDV primer set (WDV-F: 5'-TTGAGCCAATCTTCGTC-3'; WDV-R: 5'-GGAAAGACTTCCTGGGC-3') described by Oluwafemi (2). All six Syrian WDV-positive samples generated amplicons around the expected size (~253 bp). The amplicons from one isolate from wheat (SW 2131-09, GenBank Accession No. HQ113095) and one isolate from barley (SB 1248-09, GenBank Accession No. HQ113096) showed they had 86% sequence identity with each other, suggesting that both isolates can be considered to belong to the same species (3). Barley isolate SB 1248-09 had 99% sequence identity to an Iranian isolate of Barley dwarf virus (FJ620684.1) and 92% identity to most European barley-WDV isolates (e.g., Germany [AM942044.1] and Hungary [FM999832.1]), whereas, the wheat isolate (SW 2131-09) had 98 to 100% identity with most European wheat-WDV isolates (e.g., Czech Rep [FJ546191.1] and Germany [AM296023.1]) and a Chinese isolate (EF536868.1). WDV has been reported to infect cereals in few countries in West Asia and North Africa (Turkey, Tunisia, and Morocco) and causes economic losses on wheat in many countries in Europe (e.g., Sweden). WDV has been reported to be transmitted in a persistent manner only by leafhoppers (P. alienus Dahlbom) (4) to a wide range of cereal and wild grasses. Two strains of WDV are known, one that primarily infects wheat and another that infects barley. To our knowledge, this is the first record of WDV (both strains) infecting wheat and barley crops in Syria and the first report of P. provincialis as a WDV vector worldwide. References: (1) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (2) S. Oluwafemi. Afr. J. Biotechnol. 5:590, 2006. (3) J. Stanley et al. Page 301 in: The International Committee on the Taxonomy of Viruses. 8th Report. Elsevier/Academic Press, London, 2005. (4) J. Vacke. Biol. Plant. 3:228, 1961.

First Report of Beet mosaic virus Infecting Chickpea (Cicer arietinum) in Tunisia.

Chickpea plants with severe yellowing and tip wilting were observed in the Cap-Bon Region of Tunisia in 2006. The viral-like symptoms resulted in yield loss of approximately 25% in some fields. A total of 110 symptomatic chickpea plants was collected from nine chickpea fields and tested at the Virology Laboratory of ICARDA, Syria for eight legume viruses using tissue-blot immunoassay (TBIA) (3). Polyclonal antisera produced at the ICARDA Virology Laboratory were used to test for Chickpea chlorotic dwarf virus (genus Mastrevirus, family Geminiviridae), Broad bean stain virus (genus Comovirus, family Secoviridae), Broad bean mottle virus (genus Bromovirus, family Bromoviridae), and Bean yellow mosaic virus and Pea seed borne mosaic virus (genus Potyvirus, family Potyviridae). Antiserum to Beet mosaic virus (BtMV; genus Potyvirus, family Potyviridae) (AS-0143) was provided by the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany). In addition, three monoclonal antibodies (MAb) were used to detect Faba bean necrotic yellows virus (FBNYV; genus Nanovirus, family Nanoviridae) (MAb 3-2E9) (1), potyviruses (PVAS-769 [MAb PTY 3 Potyvirus Group] American Type Culture Collection, Manassas, VA), and luteoviruses (MAb B-2-5G4) (2). Twenty-two of the plants tested positive with MAb PTY 3 and BtMV antisera, 56 samples reacted with MAb B-2-5G4, and eight plants with the FBNYV MAb, whereas 24 plants tested negative with all antisera. Because reactions with the BtMV antiserum were unexpected, detection of BtMV was confirmed by reverse transcription-(RT)-PCR assays using BtMV-specific primers (LN26 and LN27) (4), which produced an amplicon of expected size (1,050 bp) from all plants that reacted with BtMV antiserum but not from plants that were serologically negative. Leaf tissue from a BtMV-infected plant was ground in 0.01 M potassium phosphate buffer, pH 7.2 (1:20, wt/vol), mixed with 0.5% celite, and used for mechanical inoculation of chickpea seedlings (cv. Beja 4). In addition, adults of three legume aphid species (Aphis craccivora, A. fabae, and Acyrthosiphon pisum) were starved for 1 h before feeding on BtMV-infected chickpea leaves for an acquisition access period of 5 min. Fifteen aphids of each species were placed on each chickpea plant, allowed to feed for 24 h, and then sprayed with an insecticide. Tip wilting symptoms appeared on plants 15 to 20 days after mechanical and aphid inoculations but not on plants used as negative control treatments (inoculated mechanically with healthy leaf tissue or with aphids that had fed on noninfected chickpea plants). Use of BtMV antiserum for TBIA analysis of inoculated plants revealed systemic BtMV infections in 35 of 92 plants inoculated mechanically and 15 of 75 plants inoculated with viruliferous A. fabae only. To our knowledge, this is the first record of BtMV infecting chickpea in Tunisia. References: (1) A. Franz et al. Ann. Appl. Biol. 128:255, 1996. (2) L. Katul. Characterization by serology and molecular biology of bean leaf roll virus and faba bean necrotic yellows virus. Ph.D. thesis. University of Gottingen, Germany, 1992. (3) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (4) L. G. Nemchinov et al. Arch. Virol. 149:1201, 2004.

First Report of Faba bean necrotic yellows virus Affecting Legume Crops in Azerbaijan.

A total of 482 chickpea (Cicer arietinum L.), 182 lentil (Lens culinaris Medik.), 12 vetch (Vicia sativa L.), 5 field pea (Pisum sativum L.), and 3 faba bean (Vicia faba L.) samples were collected from plants with symptoms suggestive of a viral infection (leaf rolling, yellowing, and stunting) from the major legume-production areas of Azerbaijan in the 2007 and 2008 growing seasons. All samples were tested by the tissue-blot immunoassay (3) at the Virology Laboratory of ICARDA, Syria using 11 specific legume virus antisera including a monoclonal antibody (2-5H9) (1) for Faba bean necrotic yellows virus (FBNYV). Laboratory tests showed that FBNYV was detected in 73, 61, 11, 3, and 2 samples of chickpea, lentil, vetch, field pea, and faba bean, respectively. Total DNA was extracted from six FBNYV-positive samples (two chickpea, two lentil, and two vetch) and tested by PCR with the following four primer sets (FBNYV, Milk vetch dwarf virus [MDV], Subterranean clover stunt virus [SCSV], and nanovirus DNA-R primers [F103 and R101]) (2). All six Azeri samples as well as the reference nanovirus isolates (SCSV-Australia, MDV-Japan, and FBNYV-Syria) generated amplicons of the expected size (~770 bp) using the nanovirus DNA-R primers (F103 & R101). In addition, Azeri samples and FBNYV-Syria yielded a PCR amplicon of the expected size (666 bp) with the FBNYV primer pair. The MDV- and SCSV-specific primers did not generate amplicons with these six samples. Sequence analysis of the FBNYV amplicons from two isolates (AzL 282-07 from lentil [GenBank Accession No. GQ351600] and AzV 277-07 from vetch [GenBank Accession No. GQ371215]) showed that they were 99% identical with each other. Comparing the sequence of AzL 282-07 with that of other nanoviruses revealed identities of 97% (FBNYV-Spain; DQ830990), 96% (FBNYV-Iran; AM493900), 92% (FBNYV-Syria; Y11408), 92% (FBNYV-Egypt; AJ132183), 78% (MDV; AB044387) and 69% (SCSV-Australia; U16734). FBNYV has been reported to infect food legumes in many countries in West Asia and North Africa and cause economic losses on faba bean in Egypt, Jordan, and Syria. To our knowledge, this is the first record of FBNYV infecting legume crops in Azerbaijan. References: (1) A. Franz et al. Ann. Appl. Biol. 128:255, 1996. (2) S. G. Kumari et al. Phytopathol. Mediterr. 47:42, 2008. (3) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994.

First Report of Chickpea Chlorotic Dwarf Virus Infecting Spring Chickpea in Syria.

During May 2003, a high incidence of symptoms suggestive of virus infection in spring chickpea were observed in many fields in Al-Ghab Valley, Syria, the ICARDA farm (near Aleppo, Syria), as well as in other locations in northern Syria, including the Idleb governorate. Symptoms observed were yellowing, stunting, and necrosis. A total of 1,345 chickpea samples with these symptoms (331 from Al-Ghab Valley, 269 from the ICARDA farm, and 745 from the Idleb governorate) were collected and tested for the presence of five viruses with tissue-blot immunoassay (TBIA) (4) at the Virology Laboratory of ICARDA, using the following antisera: monoclonal antibodies for Faba bean necrotic yellows virus (FBNYV, genus Nanovirus) (1); Bean leafroll virus (BLRV, family Luteoviridae) (4B10) (3); Beet western yellows virus (BWYV, genus Polerovirus, family Luteoviridae [ATCC PVAS-647, American Type Culture Collection, Manassas, VA]); and Soybean dwarf virus (SbDV, family Luteoviridae, [ATCC PVAS-650]) and polyclonal antibodies for Chickpea chlorotic dwarf virus (CpCDV, genus Mastrevirus, family Geminiviridae, provided by H. J. Vetten, BBA, Braunschweig, Germany). The most common virus present was BWYV (detected in 54.1% of samples tested), followed by CpCDV (19.2%), BLRV (10.2%), and FBNYV (5.5%). SbDV was not detected in any of the samples tested. Using immunosorbent electron microscopy, infected chickpea samples revealed low numbers of geminivirus-like particles after 15 min of incubation on CpCDV antiserum-coated grids. When CpCDV was purified from infected chickpea plants, the virus coat protein was 32 kDa with sodium dodecyl sulfate-polyacrylamide gel electrophoresis typical of CpCDV coat protein (2) and reacted strongly with CpCDV antiserum in western blots. The CpCDV vector in Syria was found to be Orosius albicinctus Distant, and is thought to be similar to Orosius orientalis (Matsumura), the reported vector of CpCDV (2). FBNYV, BWYV, and BLRV infection of chickpea have been previously reported from Syria, but to our knowledge, this is the first report of CpCDV infecting chickpea in Syria. References: (1) A. Franz et al. Ann. Appl. Biol. 128:255, 1996. (2) N. M. Horn et al. Ann. Appl. Biol. 122:467, 1993. (3) L. Katul. Characterization by serology and molecular biology of bean leaf roll virus and faba bean necrotic yellows virus. Ph.D. thesis. University of Gottingen, Germany, 1992. (4) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994.

First Report of Barley yellow striate mosaic virus Infecting Barley and Wheat in Lebanon.

Symptoms suggestive of virus infection in barley, bread wheat, and durum wheat were observed at high incidence in November 2000 in Terbol, Beqa'a Valley, Lebanon. The symptoms were mainly stunting, accompanied by leaf striping and yellowing. Symptomatic plant samples (27 barley, 37 bread wheat, and 81 durum wheat) were collected and tested for the presence of four different viruses by tissue-blot immunoassay (TBIA) (1) at the Virology Laboratory of ICARDA, Aleppo, Syria. Antisera used were for Barley stripe mosaic virus (BSMV, genus Hordeivirus) (2); Barley yellow dwarf virus (BYDV, genus Luteovirus, family Luteoviridae) (PAV serotype) (2); Wheat streak mosaic virus (WSMV, genus Tritimovirus, family Potyviridae) (3); and Barley yellow striate mosaic virus (BYSMV, genus Cytorhabdovirus, family Rhabdoviridae) provided by M. Conti, Instituto di Fitovirologia applicata, Turino, Italy. BYSMV was detected in 12 barley, 18 bread wheat, and 56 durum wheat samples; the corresponding numbers of barley, bread wheat, and durum wheat plants testing positive for BYDV-PAV were 4, 7, and 6, respectively. BSMV and WSMV were not detected in any of the samples tested. BYSMV was purified from infected wheat plants, and the purified preparation had a UV 260:280 ratio of 1.18, typical of Rhabdoviruses. In SDS-polyacrylamide gel electrophoresis, the purified virus preparation indicated the presence of 66, 47, and 15 kDa structural proteins, typical of the G, N and M proteins of Rhabdoviruses. In western blot, the 66 and 47 kDa protein bands reacted strongly with BYSMV antiserum. This is the first record of BYSMV infecting barley and wheat in Lebanon. References: (1) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (2) K. M. Makkouk and S. G. Kumari. Rachis Newsl. 12:24, 1993. (3) K. M. Makkouk and S. G. Kumari. Rachis Newsl. 16:74, 1997.

First Record of Pea enation mosaic virus Naturally Infecting Chickpea and Grasspea Crops in Syria.

Virus-like symptoms not commonly encountered on most chickpea (Cicer arietinum L.) and grasspea (Lathyrus sativus L.) genotypes were noticed at the ICARDA farm near Aleppo, Syria, during April and May 2001. Primary symptoms included stunting, accompanied by leaf mottling and yellowing. The causal agent was transmitted by the pea aphid (Acyrthosiphon pisum Harris) in a persistent manner. Efficiency of transmission was 100% when aphids acquired the virus from grasspea and then inoculated lentil, whereas transmission efficiency was 21% when aphids acquired the virus from chickpea and then inoculated lentil. Samples of symptomatic chickpea and grasspea reacted strongly with the antiserum prepared against a Dutch isolate (E154) of Pea enation mosaic virus (PEMV), provided by L. Bos (Wageningen, the Netherlands) (1), using tissue blot immunoassay (2). Negatively stained preparations from chickpea and grasspea revealed typical PEMV-like isometric particles ≍30 nm in diameter. With immunoelectron microscopy, these particles were effectively trapped and strongly decorated with PEMV antibodies (immunoglobulin G diluted 1:10) provided by M. Musil (Bratislava, formerly Czechoslovakia) (4). The virus capsid protein was 22 kDa based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis, typical of the PEMV coat protein, and reacted strongly with PEMV antiserum (E154) in western blots. This is the first report of PEMV naturally infecting chickpea and grasspea in Syria and, to our knowledge, the first report in West Asia. PEMV reached epidemic levels on lentil in Syria for the first time in 1994 (3). Field symptoms observed in May 2001 suggest that PEMV may also seriously affect lentil, chickpea, and grasspea crops in Syria. References: (1) K. Mahmood and D. Peters. Neth. J. Plant Pathol. 79:138, 1973. (2) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (3) K. M. Makkouk et al. Plant Dis. 83:303, 1999. (4) M. Musil et al. Acta Virol. 14:285, 1970.

First Record of Barley yellow striate mosaic virus and Cereal yellow dwarf virus-RPV Infecting Wheat in Uzbekistan.

A preliminary survey to identify virus diseases affecting wheat in Uzbekistan was conducted during May 2001. The survey covered 12 wheat fields from 2 cereal-growing regions (Tashkent-Angren and Tashkent-Samarkand). A total of 250 wheat samples with symptoms suggestive of virus infection were collected and tested for the presence of nine viruses by tissue-blot immunoassay (TBIA) (1) at the Virology Laboratory of ICARDA, Aleppo, Syria, using the following antisera: monoclonal antibodies for Cereal yellow dwarf virus-RPV (CYDV-RPV) (ATCC PVAS-669 [American Type Culture Collection, Manassas, VA]) and Barley yellow dwarf virus-MAV (BYDV-MAV) (ATCC PVAS-673); and polyclonal antibodies for BYDV-SGV and BYDV-RMV (3); BYDV-PAV, Barley stripe mosaic virus, and Wheat streak mosaic virus (from Virology Laboratory, ICARDA); Wheat dwarf virus (provided by J. Vacke, Research Institute of Crop Production, Prague, Czeck Republic); and Barley yellow striate mosaic virus (BYSMV) isolated from Lebanon (2). The most common virus present was BYDV-PAV (detected in 12% of the 250 samples tested), followed by BYDV-SGV (10.8%), BYSMV (5.6%), BYDV-RMV (2.4%), BYDV-MAV (2%), and CYDV-RPV (1.2%). CYDV-RPV was detected in three fields; one field was 50 km southeast of Tashkent, and the other two fields were between Tashkent and Samarkand. The majority of BYSMV-positive samples originated from the same field, ≈40 km northeast of Samarkand. Field symptoms of BYSMV-infected plants included yellow flag leaf and stunting. All samples that produced a positive reaction to BYSMV-Lebanon antiserum were tested against four other rhabdovirus antisera: BYSMV-Italy, BYSMV-Morocco, Cereal chlorotic mottle virus, and American wheat striate mosaic virus. Serological tests showed that 100% of the samples reacted strongly with BYSMV-Italy and BYSMV-Morocco. In sodium dodecyl sulfate-polyacrylamide gel electrophoresis, followed by western blots, extracts from BYSMV-infected plants were found to contain 66- and 47-kDa structural proteins, typical of G and N proteins of rhabdoviruses, both of which reacted strongly with BYSMV-Italy antiserum. To our knowledge, this is the first report of BYSMV and CYDV-RPV in Uzbekistan. References: (1) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (2) K. M. Makkouk et al. Plant Dis. 85:446, 2001. (3) G. N. Webby and R. M. Lister. Plant Dis. 76:1125, 1992.

First Record of Barley yellow striate mosaic virus, Barley stripe mosaic virus, and Wheat dwarf virus Infecting Cereal Crops in Tunisia.

A survey conducted during April 2000 to identify viruses infecting cereal crops in different regions (Beja, Bizerte, Cap-bon, Jendouba, Kairouan, Siliana, and Zaghouan) of Tunisia covered 15 barley, 21 durum wheat, and 7 bread wheat randomly selected fields. Virus incidences were determined on the basis of laboratory testing of 100 to 200 randomly collected samples from each field. A total of 5,227 random (1,654 barley, 2,546 durum wheat, and 1,027 bread wheat) and 1,430 symptomatic (451 barley, 746 durum wheat, and 233 bread wheat) samples were collected. Samples were tested for the presence of five different viruses by tissueblot immunoassay (TBIA) (1) at the Virology Laboratory of INRAT. Antisera used were for Barley stripe mosaic virus (2), Barley yellow dwarf virus (PAV serotype) (2), Wheat streak mosaic virus (3), Barley yellow striate mosaic virus (BYSMV) provided by E. Luisoni, IFA, Turino, Italy (4), and Wheat dwarf virus (WDV) provided by J. Vacke, Research Institute of Crop Production, Prague, Chech Republic. BYDVPAV was detected in seven barley (from three fields), 25 durum wheat (10 fields), and eight bread wheat (three fields) samples from all except the Siliana region. BYSMV was detected in three barley (three fields), 16 durum wheat (six fields), and four bread wheat (three fields) samples from the Beja, Bizerte, Cap-bon, Jendouba, and Siliana regions. WDV was detected in five barley (three fields), nine durum wheat (four fields), and four bread wheat (one field) samples from the Beja, Cap-bon, and Bizerte regions. BSMV was detected in 49 barley (six fields) and 25 durum wheat (five fields) samples from the Beja, Bizerte, Cap-bon, Kairouan, and Zaghouan regions. This is the first record of BYSMV, BSMV, and WDV infecting cereal crops in Tunisia, but their incidence in fields was less than 1%. However, BSMV incidence was 10.5% in one barley field from the Cap-bon region. Virus incidence in symptomatic plants was a bit higher and ranged from 0.8% for WDV in bread wheat to 6% for BSMV in barley. References: (1) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (2) K. M. Makkouk and S. G. Kumari. Rachis Newsl. 12(1/2):24, 1993. (3) K. M. Makkouk and S. G. Kumari. Rachis Newsl. 16(1/2):74, 1997. (4) R. G. Milne et al. Intervirology 25:83, 1986.

First Report of Soybean Dwarf Virus Infecting Lentil and Beet Western Yellows Virus Infecting Lentil and Chickpea Crops in Ethiopia.

A survey conducted during November 14-23, 1998, to identify viruses infecting chickpea (Cicer arietinum) and lentil (Lens culinaris) crops in the Shewa province of Ethiopia covered 33 chickpea and 32 lentil fields randomly selected. Identity of the viruses present and virus incidence were determined on the basis of laboratory testing of 100 to 200 randomly collected samples in addition to 15 to 20 symptomatic samples from each field. A total of 5,427 lentil and 3,836 chickpea samples were collected and tested for the presence of 12 different viruses by tissue blot immunoassay (1) at the Plant Pathology Laboratory in Debre Zeit Agriculture Research Center, Ethiopia. All antisera were virus specific, including those for beet western yellows virus (BWYV; ATCC PVAS-647) and soybean dwarf virus (SbDV; ATCC PVAS-650). More than 21% of the samples from 5 chickpea fields were infected; the most common virus was BWYV. Also, at least 21% of the samples from 11 lentil fields were virus positive; the most widespread virus was PSbMV. Highest rates of infection: of lentil in a single field, PSbMV in 58.5% of the samples; in a chickpea field, 41.3% of the samples positive for BWYV. Other viruses such as faba bean necrotic yellows nanovirus (FBNYV) and broad bean wilt fabavirus in chickpea and FBNYV, broad bean stain comovirus, bean yellow mosaic potyvirus, and cucumber mosaic cucumovirus in lentil were detected at very low incidence. Reference: (1) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994.