Resilient Entangling Gates for Trapped Ions.

Constructing a large-scale ion trap quantum processor will require entangling gate operations that are robust in the presence of noise and experimental imperfection. We experimentally demonstrate how a new type of Mølmer-Sørensen gate protects against infidelity caused by heating of the motional mode used during the gate. Furthermore, we show how the same technique simultaneously provides significant protection against slow fluctuations and mis-sets in the secular frequency. Since this parameter sensitivity is worsened in cases where the ions are not ground-state cooled, our method provides a path towards relaxing ion cooling requirements in practical realizations of quantum computing and simulation.

Glutamate dehydrogenase is highly conserved among Clostridium difficile ribotypes.

gluD was highly conserved and glutamate dehydrogenase (GDH) was readily expressed in vitro by all 77 Clostridium difficile ribotypes assayed. All ribotypes, including ARL 002, ARL 027, and ARL 106, were reactive in assays that detect C. difficile GDH.

First Report of Tobacco ringspot virus in Joe-Pye Weed (Eupatorium purpureum) in Mississippi.

Eupatorium purpureum L. (joe-pye weed, sweet joe-pye weed, and sweetscented joe-pye weed) is a wildflower perennial plant native to the eastern United States. In May 2006, virus-like symptoms including systemic chlorosis, mottling, and downward rolling of leaf blades were observed in a joe-pye weed plant located on the Mississippi State University campus. Young symptomatic leaves were ground in 0.1 M phosphate buffer, pH 7.2, and the slurry was inoculated on leaves of several herbaceous hosts grown in a greenhouse. Systemic symptoms were observed 1 to 2 weeks postinoculation in Cucumis sativus (chlorotic spots followed by systemic ringspot and leaf deformation), Chenopodium quinoa (necrotic lesions/leaf deformation), Nicotiana benthamiana (mosaic/line patterns), and N. rustica (necrotic ring spots). Electron microscopy of partially purified preparations from infected joe-pye weed and cucumber plants revealed the presence of intact and empty isometric viral particles of approximately 30 nm in diameter resembling nepoviruses or comoviruses. The original joe-pye weed plant and artificially infected herbaceous plants were tested by ELISA (Agdia Inc., Elkhart, IN) for several nepoviruses/comoviruses and found to be positive for Tobacco ringspot virus (TRSV; genus Nepovirus, family Comoviridae). Total RNA extracted from the original virus source plant was reverse transcribed using oligodT primer and submitted to PCR with the primer set TRS-F (5'TATCCCTATGTGCTTGAGAG3') and TRS-R (5'CATAGACCACCAGAGTCACA3') designed from the published sequences in GenBank of the RNA 1 of Tobacco ringspot virus. A specific 766-bp PCR product was cloned and sequenced. Sequence analysis showed that the virus from the joe-pye weed shared 94% nucleotide identity (98% at amino acid level) with a "bud blight" isolate of TRSV (Accession No U50869) (2) in the sequenced genome portion and slightly lower (90 to 92%) with other sequenced isolates of the same virus, thus further confirming the identity of the virus. In 2008 and 2009, TRSV was detected in an additional 16 symptomatic specimens of the same host collected from six distinct locations in Mississippi. Our results show that E. purpureum is a new host for TRSV. Considering that the related plant species E. capillifolium (small dogfennel) was already reported as a host of TRSV in North Carolina (1), this suggests that these two common plants may represent additional reservoirs of this virus in the region. References: (1) M. C. Rush and G. V. Gooding. Phytopathology 60:1756, 1970, (2) P. A. Zalloua et al. Virology 219:1, 1996.

Impact of a novel species of Nosema on the southwestern corn borer (Lepidoptera: Crambidae).

A study was undertaken to elucidate the impact of an undescribed Nosema sp. on the southwestern corn borer (SWCB; Diatraea grandiosella Dyar). The Nosema sp. (isolate 506) included in the study was isolated from an overwintering SWCB larva in Mississippi. It was highly infectious per os, with a median infective dose of 2.0 x 10(3) spores per larva. Even at the highest dosage tested (10(7) spores per larva), minimal mortality (< or = 3%) was observed in infected larvae, pupae, and adults reared in the laboratory on an artificial diet. However, infected pupae (0- and 7-d-old) were smaller, and the time to adult eclosion from pupation was slightly increased. Furthermore, the number of eggs produced by infected SWCB female moths substantially decreased (32%), and this effect was most pronounced on day 2, when the greatest number of eggs were oviposited by infected and noninfected moths. For eggs produced by infected females mated with infected males, hatch was slightly decreased by 16 and 15% for eggs laid on days 2 and 3, respectively. In addition, egg hatch was reduced in eggs oviposited by noninfected females mated with infected males on day 3. A low prevalence of infection (< 6%) was observed in the F1 generation originating from infected females mating with noninfected males, from noninfected females mating with infected males, and from infected females mating with infected males. Nosema 506 spores were observed in the proximity of reproductive tissues of infected female and male moths. Spores also were detected on the chorion surface and within eggs laid by infected females. Furthermore, 1-11% of larvae hatching from surface-sterilized eggs were infected by Nosema 506 indicating a transovarial mechanism of transmission.

The use of meconia to nondestructively detect sublethal infections in heliothines (Lepidoptera: Noctuidae).

The utility of using meconia to nondestructively detect entomopathogens of lepidopterous heliothines was examined. Early-instar tobacco budworm [Heliothis virescens (F.)] or cotton bollworm [Helicoverpa zea (Boddie)] larvae were inoculated with cytoplasmic polyhedrosis virus (CPV), Serratia marcescens Bizio, or Nosema heliothidis Lutz and Splendor, and the presence of each of the entomopathogens in adults and the meconia discharged during adult eclosion was determined. As the dose of CPV occlusion bodies and N. heliothidis spores but not S. marcescens cells ingested by larvae increased, a greater number of both adults and meconia were infested with the entomopathogens. For all three entomopathogens, no difference was observed between males and females for any of the parameters tested. The accuracy of the meconium method for predicting the presence of the entomopathogens in the adults (i.e., number of individuals in which meconia and adults were both positive, or meconia and adults were both negative) was > or = 92% for CPV, and > or = 79% for S. marcescens and N. heliothidis. Very few false negative predictions (i.e., the meconium was negative but the adult was positive) were observed for CPV (< or = 1%). The prevalence of false negative predictions ranged from 2 to 9%, and 5 to 21% for S. marcescens and N. heliothidis, respectively. The prevalence of false positive predictions (i.e., the meconium was positive but the adult was negative) was < or = 7% for CPV, < or = 13% for S. marcescens, and 0% for N. heliothidis. The results of this study demonstrate that although not absolute, the meconium method will be an efficacious method to detect nondestructively entomopathogens causing sublethal infections in heliothines, and possibly other insects, and thereby facilitate the rearing of specific pathogen free insects.

Effects of Serratia marcescens on the F1 generation of laboratory-reared Heliothis virescens (Lepidoptera: Noctuidae).

The effects of the bacterium Serratia marcescens (Bizio) was investigated on the F1 generation of laboratory-reared Heliothis virescens (F.). There was no difference in adult male or female longevity (i.e., parental generation) for individuals inoculated with S. marcescens as larvae (Serratia treatment) and those that were free of the bacterium (control treatment). However, the number of eggs laid and the prevalence of eclosion of eggs from Serratia treatment adults were reduced relative to control treatment adults. A very low number of F1 Serratia treatment eggs exhibited signs of infection, but a higher prevalence of mortality was observed for F1 larvae (n = 2,888) for the Serratia (3.5-4.6%) than for the control (1.1-1.5%) treatment. No S. marcescens was isolated from dead control larvae; whereas, 48 -54% of dead F1 larvae for the Serratia treatment were positive for the bacterium. However, there was no significant difference in larval weights between treatments. There were also no differences in either mortality or weight of F1 male pupae between treatments, but F1 female pupae were significantly smaller and prevalence of mortality was higher for the Serratia treatment. Serratia marcescens was not isolated from any of the control F1 pupae, but 6% of pupal cadavers for the Serratia treatment were positive for the bacterium. No S. marcescens was recovered from the meconia of any of the F1 adults (n = 2,600) regardless of treatment, and there were no differences in adult weights between treatments. Although sublethal effects of S. marcescens were detected, the impact and prevalence of the bacterium were tremendously reduced over the F1 generation in the absence of all but the most basic management strategies.

Pathogens associated with southwestern corn borers and southern corn stalk borers (Lepidoptera: Crambidae).

A study was undertaken to isolate entomopathogens of southwestern corn borer, Diatraea grandiosella Dyer, and southern corn stalk borer, Diatraea crambidoides (Grote). Field-collected diapausing larvae of southwestern corn borer (three sites in Mississippi) and southern corn stalk borer (one site in North Carolina), and a laboratory strain of D. grandiosella in the diapause state were maintained in a simulated winter followed by a simulated spring environnent. Few larvae (< or = 6%) collected from any of the field sites died in the winter environment, and most insect mortality (11-25%) occurred after transfer of the larvae to the simulated spring environment. Mortality during the simulated spring period differed among the collection sites, and the highest mortality was recorded for southwestern corn borers from Washington County (25%), followed by Marshall (16%) and Oktibbeha (11%) Counties. A high level of mortality was also observed in southern corn stalk borers during the simulated spring period (27%). No viruses were observed, but a number of bacteria, microsporidia, and fungi were isolated from both southwestern corn borer and southern corn stalk borer larvae and pupae. In most instances, numerous bacterial taxa were isolated from cadavers, but on some occasions a single taxon predominated. The most prevalent bacterial taxon from larval and pupal cadavers was Enterococcus faecalis (Andrewes & Horder) Schleifer & Kilppel-Balz, but Bacillus spp., Pseudomonas aeruginosa (Schroeter) Migula, and Serratia marcescens Bizio were frequently isolated as well. Few fungi (1-7%) were recovered from southwestern corn borer and southern corn stalk borer larvae and pupae. The most common entomopathogenic taxon isolated was Beauveria bassiana (Balsamo) Vuillemin from southern corn stalk borer larvae. Microsporidia were not isolated from southern corn stalk borers. However, Nosema spp. were isolated from southwestern corn borer cadavers from Washington (15%), Marshall (1%), and Oktibbeha (3%) Counties in Mississippi. In addition, we observed parasitism of southern corn stalk borer larvae by Macrocentrus cingulum Reinhard (Hymenoptera: Braconidae). No parasitism of southwestern corn borers was observed. Isolates of Bacillus, Beauveria, Entercoccus, Nosema, Pseudomonas and Serratia were all pathogenic to southwestern corn borer larvae under controlled environmental conditions, and with the exception of B. bassiana, these are novel pathogens of Diatraea corn borers.

The role of gonadectomy and testosterone replacement on thymic luteinizing hormone-releasing hormone production.

We and others have identified luteinizing hormone-releasing hormone (LHRH) in cells of the immune system in both animals and humans. LHRH is an immunostimulant, and testosterone is an immunosuppressant. Because testosterone is known to modulate the concentrations of hypothalamic LHRH, we wondered whether testosterone might also alter the concentrations of rat thymic LHRH. Two weeks after castration or sham castration, adult male rats were implanted with either vehicle or testosterone capsules. All animals were killed 4 days after capsule implantation. Thymic LHRH concentration increased significantly in castrated animals. Testosterone replacement prevented this increase. The concentration of the LHRH precursor, proLHRH, decreased significantly, but testosterone replacement prevented this decrease. Steady-state concentrations of LHRH mRNA were not changed by castration or by hormonal replacement. In contrast to the post-castration increase in thymic LHRH, LHRH content of the hypothalamus decreased significantly. Whereas concentrations of LHRH were lower in the thymus than in the hypothalamus, proLHRH concentrations were much greater in the thymus. These data suggest that gonadal manipulation modulates LHRH molecular processing and its tissue concentration in the thymus in addition to those in the hypothalamus, and that the regulation of LHRH molecular processing by testosterone in the hypothalamus is different from that in the thymus.

Guidelines for the use of radio-iodine, thyroid hormone, and treatment of metastatic disease in patients with differentiated thyroid cancer.

The treatment of metastatic differentiated thyroid carcinoma is currently at a crossroad. The stunning effect of imaging doses of RAI on subsequent treatment doses is being recognized. Alternatives to RAI imaging for diagnostic purposes are being tested; these include ultrasonography for local and cervical nodal remnants/recurrences, Sestamibi and other isotope scanning that do not require the discontinuation of TSH suppression, and the measurement of circulating thyroglobulin that is rapidly becoming the cornerstone of the detection and the treatment follow-up of metastatic carcinoma.

Thyrotoxic hypokalemic periodic paralysis: six cases in non-Asian patients.

OBJECTIVE: To describe six cases of thyrotoxic hypokalemic periodic paralysis (THPP) in non-Asian men. METHODS: We present six cases of THPP, including clinical and laboratory findings, treatment, and outcome, and review the related literature. RESULTS: Hypokalemic periodic paralysis is a relatively common occurrence in Asian men with thyrotoxicosis; however, it is unusual in non-Asian patients with thyrotoxicosis. Among our six patients--four Caucasians, one African-American, and one Hispanic--the precipitating factors, initial manifestations, and clinical course varied. In general, treatment with 131 I or potassium eliminated the paralytic episodes. CONCLUSION: THPP needs to be distinguished from nonthyrotoxic hypokalemic periodic paralysis. Although THPP is unusual in non-Asian men, it must be recognized because of the severe and potentially fatal complications, which are reversible with potassium replacement and antithyroid therapy.

Hyperparathyroidism associated with a chronic hypothyroid state.

Reports of the coexistence of hyperparathyroidism and thyroid disease have raised the issue of a possible etiologic relationship. The present study tests the hypothesis that chronic elevation of thyroid-stimulating hormone (TSH) is related to the development of hyperparathyroidism. Four groups of 60 female rats were treated as follows: group 1, control; group 2, propylthiouracil (PTU) 0.0025%; group 3, PTU 0.0025% plus thyroxine, 5 microg two times per week; and group 4, only thyroxine. The animals' serum calcium, phosphorus, TSH, thyroxine, and parathyroid hormone (PTH) levels were evaluated at 0, 6, 12, and 18 months. Significant elevation of TSH was sustained throughout the 18 months in groups 2 and 3. The PTH levels were also significantly elevated in both group 2 and group 3 animals (P = 0.02). The histopathologic features of the parathyroids were evaluated at 18 months. In the group 2 (PTU only) animals, which had profound hypothyroid, 44% developed parathyroid adenomas. In the group 3 (PTU plus thyroxine) animals, who had mildly elevated TSH levels, 53% developed parathyroid adenomas. These findings are consistent with the hypothesis that prolonged TSH stimulation may lead to hyperparathyroidism in the rat model.

Jurkat cell proliferative activity is increased by luteinizing hormone-releasing hormone.

Jurkat cells were used to study the immunomodulatory role of luteinizing hormone-releasing hormone (LHRH) in immune cells. The Jurkat cell, a human mature leukemic cell line, phenotypically resembles resting human T lymphocytes and has been widely used to study T cell physiology. The data from this study demonstrate that the Jurkat cell concentration of immunoreactive LHRH was 210 +/- 36 pg/10(6) cells and that of proLHRH was 188 +/- 27 pg/10(6) cells (means +/- S.E.M.). The authenticity of this LHRH immunoreactivity is documented in two ways. First, both Jurkat LHRH and proLHRH immunoreactivity demonstrate dilutional parallelism with hypothalamic LHRH and proLHRH. Second, Jurkat lysates show LHRH bioactivity by releasing luteinizing hormone from rat anterior pituitary cells in culture. The presence of substantial amounts of LHRH in medium in which Jurkat cells were cultured for 72 h indicated that LHRH can be released from the cells. Using specific primers to exons 2 and 4 of the LHRH gene, we have found that Jurkat cells (like human T cells) express LHRH mRNA. The LHRH agonist, des-Gly10,D-Trp6-LHRH ethylamide, significantly increases the proliferative activity of Jurkat cells, as assessed by tritiated thymidine incorporation, from 15980 +/- 1491 c.p.m. in control to 28934 +/- 3395, 30457 +/- 3861 (P = 0.05 vs control) or 35299 +/- 5586 c.p.m. (P < 0.01 vs control) with 10(-11), 10(-9) or 10(-7) M agonist respectively. LHRH antagonist, [D-pGlu1,D-Phe2,D-Trp3,6]-LHRH, at a concentration of 10(-8) M decreases Jurkat cell proliferative activity form 17145 +/- 526 c.p.m. in control medium to 10653 +/- 1323 c.p.m. (P = 0.05). Co-incubation with the LHRH antagonist completely inhibits the proliferative stimulation induced by the LHRH agonist. Furthermore, applying monoclonal LHRH antibody to Jurkat cells inhibits the cell proliferative activity assessed by tritiated thymidine incorporation from 19900 +/- 2675 c.p.m. in control to 15680 +/- 2254, 15792 +/- 1854 and 9700 +/- 908 c.p.m. in media with 1:40, 1:20 and 1:10 dilution of purified antibody respectively (P < 0.01, 1:10 dilution compared with control). In addition, the cAMP level in LHRH-stimulated Jurkat cells is decreased to 74, 27 and 57% of control levels after 15, 30 and 45 min respectively of exposure to 10(-7) M LHRH agonist. In summary, Jurkat cells produce, process and release immunoreactive and bioactive LHRH, as do normal human T cells. Endogenous and exogenous LHRH increase Jurkat cell proliferative activity, and cAMP may be involved in LHRH-induced Jurkat cell proliferation. The Jurkat cell may be a useful model with which to study the role of LHRH in human T cell function.

Operating room: 2010.

Using expert systems, virtual reality, and commercial and futuristic technology, visionary operating room (OR) nurses will have the opportunity in the 21st century to dramatically improve the way the OR functions. Eliminating counting, decreasing occurrences of patient injuries, and improving staff and patient education are just some of the possibilities!

Failure of ethanol metabolites to alter gonadotropin secretion or luteinizing hormone synthesis in vitro.

The impact of ethanol on the male reproductive axis are multiple and varied, with both gonadal and control hypothalamic-pituitary pertubations being reported. There appears to be a discrepancy, however, between the in vivo and in vitro effects of ethanol on hypothalamic luteinizing hormones releasing hormone (LHRH) and the pituitary gonadotropins luteinizing hormone (LH) and follicle stimulating hormone (FSH). While in vivo data suggests a decrease in LHRH release after EtOH, in vitro studies find no effect on secretion. Similarly, in vivo acute EtOH profoundly diminishes LH synthesis and secretion, while in vitro impaired release with no alteration in the transcription of beta LH has been found. A potential exploration for these discrept results could be the in vivo metabolism of EtOH into acetaldehyde and acetate, or the subsequent formation of salsolinol, a product of acetate combining with dopamine. To test this possibility, a series of in vitro experiments were conducted exposing dispensed anterior pituitary cells from male rats to different doses of acetaldehyde, acetate or salsolinol for varying amounts of time for which gonadotropin secretion and beta LH mRNA levels were assessed. The results demonstrated no effect of either acetaldehyde or acetate on basal or LHRH stimulated LH release, FSH release or steady-state beta LH mRNA levels. These data suggest that the metabolites of EtOH, which occur in vivo but not in vitro, are not responsible for the discrepant gonadotropin changes reported between the in vivo and in vitro setting. Other potential mechanisms to explain this phenomenon include differences in the molarity of EtOH, hyperprolactinemia and suprapituitary influences including hypothalamic LHRH, catecholamines, excitatory amino acids, substance P and beta endorphin.

Congenital thyroid hemiagenesis.

Failure of embryologic development of a lobe of the thyroid gland is a rare anomaly. In order to characterize this unusual entity, we report our experience in seven patients with thyroid hemiagenesis involving the left lobe in five and the right lobe in two patients. The diagnosis was made as a result of evaluation and treatment of a thyroid nodule (4), diffuse thyroid enlargement with thyrotoxicosis (2), and a simple goiter in a patient with a prior history of radiation treatment for facial acne. In five patients thyroid scintigraphy demonstrated unilateral absence of function, four of whom had an ultrasound exam of the neck that revealed a corresponding absence of thyroid tissue. In one patient the diagnosis was made incidentally on a screening ultrasound exam of the neck. Thyroid hemiagenesis was unsuspected preoperatively in one patient with Graves' disease because of marked hyperplasia of a single thyroid lobe and isthmus. Thyroid hemiagenesis was confirmed in four patients who underwent thyroidectomy. The presence of a thyroid isthmus was established in six patients. Postoperatively, all patients were treated with thyroid hormone. Associated thyroid pathology included adenoma (1), follicular carcinoma (1), colloid nodule (2), Graves' disease (2), and a simple goiter (1). In conclusion, the diagnosis of thyroid hemiagenesis should be considered in any patient with unilateral absence of function on thyroid scintigraphy and confirmed by ultrasonography. Recognition of this rare congenital anomaly is important to avoid unnecessary contralateral neck exploration with its potential morbidity and to insure that all patients receive careful follow-up and appropriate thyroid hormone therapy when necessary.

Nodular disease during pregnancy.

The incidence of autoimmune disease of the thyroid approaches 10% in women. This autoimmune state, which predisposes to the development of thyroid neoplasia, especially in patients with subclinical hypothyroidism, combined with tumor growth and immunologic factors that occur in the pregnant state, account for the significant incidence of nodular thyroid disease in pregnancy. Thyroid carcinoma of follicular cell origin in a young woman can generally be expected to pursue a slow course with ample time for preoperative preparation and operative treatment. However, the pregnant state should be considered an exception and thyroid nodular disease with suspicious aspiration cytologic features should be managed with a certain degree of urgency. In an excellent article on the subject of pregnancy as a predisposing factor in thyroid neoplasia, Rosen and Walfish present a series of 30 patients with thyroid neoplasia arising during pregnancy. The incidence of thyroid carcinoma was 43% and the incidence of adenoma 37%, for an 80% overall incidence of neoplasia. Furthermore, during the course of the pregnancy, 20% of the patients showed marked increase in nodular growth, including a 26-year-old primiparous woman who developed a small nodule in the first trimester which proved to be cellular on needle aspiration biopsy. In spite of thyroid hormone treatment, the nodule grew markedly in the last trimester. At postpartum operation, the patient was found to have a papillary carcinoma with extensive unilateral neck and mediastinal node disease, which was clinically occult. These authors stress the importance of the operative treatment of thyroid neoplasia of pregnancy, either in the second trimester or immediately after delivery. We agree.

Reporting of cases of non-accidental injury: a survey of parents' responses.

Parental responses to the process of referral to statutory bodies because of their child's suspected non-accidental injury were obtained using the questionnaire method. The results were analysed in terms of their demographic details, subsequent social and emotional adjustment together with an evaluation of parental perception of the service they received. Parents' reported some positive outcomes as a result of the referral, but the majority of responses highlighted the need to develop a model of investigation that offers more emotional support to parents, giving them more and better information and allowing their point of view to be heard and respected.

Luteinizing hormone-releasing hormone (LHRH) in rat prostate: characterization of LHRH peptide, messenger ribonucleic acid expression, and molecular processing of LHRH in intact and castrated male rats.

Continuous administration of LHRH agonist suppresses the pituitary-gonadal axis, achieving chemical castration. Thus, LHRH agonist has been used as an alternative (to surgical castration) for the treatment of steroid-dependent prostate cancer. However, recent reports have demonstrated that LHRH agonist had a direct inhibiting effect on prostate cancer cell proliferation and that cancerous prostate tissue contained a LHRH-like peptide. In this paper we are reporting for the first time that the normal rat ventral prostate contained immunoactive and bioactive LHRH as well as its precursor molecule, pro-LHRH. Our investigation showed that the LHRH concentration in prostate increased 2 weeks after castration from 1.68 +/- 0.09 to 3 +/- 0.2 pg/mg tissue (P < 0.001). At the same time, the concentration of pro-LHRH decreased from 149 +/- 6.5 to 68 +/- 6.8 pg/mg tissue (P < 0.001). Furthermore, intact rat prostate expressed LHRH mRNA, which increased 13-fold 2 weeks after castration. In summary, the prostate of intact Sprague-Dawley rats has the capacity to produce the LHRH precursor and process it to the mature decapeptide, and this production/processing increases significantly after castration.

Immunoactivation enhances the concentration of luteinizing hormone-releasing hormone peptide and its gene expression in human peripheral T-lymphocytes.

An immunomodulatory role for LHRH was suggested when we reported the presence of immunoactive and bioactive LHRH and its mRNA in rat splenic and thymic lymphocytes. In this paper we report that human peripheral T-cells as well as its subsets CD4+ and CD8+ contained immunoactive and bioactive LHRH. Furthermore, analysis of phytohemagglutinin (PHA)-activated T-cell lysates for LHRH by RIA demonstrated that the mean concentration of LHRH in PHA-activated T-cells increased from 45 +/- 4.5 to 64 +/- 7 pg/10(6) cells after 24 h of culture and from 47 +/- 3.6 to 117 +/- 11.8 pg/10(6) cells (P < 0.01) after 48 h. While the LHRH concentration in PHA-activated cells increased over the last 24 h of culture h from 64 +/- 7 to 117 +/- 11.8 pg/10(6) cells (P < 0.001), there was no change in mean concentration of LHRH in T-cells kept in medium alone. In a preliminary study we found that fresh T-cells contain 20 +/- 1.4 pg pro-LHRH/10(6) cells, and PHA stimulation increased the pro-LHRH content similar to the increase in LHRH. As with unfractionated T-cells, a significant PHA-induced time-dependent enhancement of intracellular LHRH was noted in CD4+ and CD8+ T-cells. RNA extracted from lymphocytes was subjected to reverse transcription-polymerase chain reaction analysis using LHRH and histone-3.3, primers, the latter as an internal control. The polymerase chain reaction-generated data demonstrated that the relative amount of LHRH mRNA in cultured, but non-PHA-stimulated (resting), cells diminished dramatically between 5-24 h, but recovered by 48 h of culture. The relative amount of LHRH mRNA in PHA-stimulated cells revealed a markedly different pattern. LHRH message expression in PHA-activated cells increased slightly at 5 h of culture and was maximally stimulated by 24 h, but declined by 48 h of culture. The PHA activation-induced time-dependent enhancement of intracellular accumulation of LHRH peptide at 5 and 24 h was accompanied by increased LHRH message. However, the increased concentration of LHRH peptide at 48 h coincided with decreased LHRH message expression. The data from total protein synthesis in PHA-activated cells showed a progressive increase in protein synthesis, a pattern entirely similar to the changes in the cell content of LHRH.(ABSTRACT TRUNCATED AT 400 WORDS)

Comparison of morning or bedtime insulin with and without glyburide in secondary sulfonylurea failure.

OBJECTIVES: New treatment options are needed for glycemic control in NIDDM. We evaluated the effects of bedtime or morning insulin treatment, combined with daytime glyburide or given alone. RESEARCH DESIGN AND METHODS: Twenty-nine male patients with NIDDM, mean age 63 +/- 1.7 yr, body weight 124 +/- 2.98% of DBW, received a maximum glyburide dose (20 mg/day) for a minimum of 6 wk, to confirm sulfonylurea failure. Human lente insulin was added for 12 wk either AM (n = 14) or HS (n = 15) and adjusted to obtain fasting euglycemia (FPG; combination treatment phase). Glyburide was then stopped, and insulin was continued for 6 wk, aiming for normal FPG (insulin phase). RESULTS: After combination treatment phase, FPG decreased (P < 0.02) from 12.43 +/- 0.68 to 5.73 +/- 0.65 mM (AM) and from 12.68 +/- 0.76 to 5.51 +/- 0.48 mM (HS) (AM vs. HS, NS). Postbreakfast, presupper, and 0200 AM plasma glucose levels fell equally (P < 0.02) except for 1-h postprandial (AM 12.46 +/- 0.51 mM, HS 10.88 +/- 0.62 mM, AM vs. HS, P < 0.1). Mean HBA1c fell similarly in both AM and HS groups. At 2 wk of the insulin phase, FPG was higher in AM than HS, 9.8 +/- 0.76 vs. 7.56 +/- 0.7 mM (P < 0.1). At the end of insulin phase, plasma glucose levels were similar to the end of combination treatment phase, but the insulin dose had to be raised in AM by 39% (P < 0.02) and HS by 30% (P < 0.05). After the combination treatment phase, fasting C-peptide was significantly suppressed in HS group only, from 1.22 +/- 0.12 to 0.82 +/- 0.09 nM (P < 0.02). At the end of insulin phase, fasting C-peptide was further suppressed in both groups, but 2-h postprandial C-peptide levels decreased significantly in AM group only, from 1.85 +/- 0.23 to 1.42 +/- 0.13 nM (P < 0.02). Triglycerides and total and HDL cholesterol did not change significantly after either combination treatment phase or insulin phase. Mean weight gain was 6.5 lb during combination treatment phase (NS from baseline), without further change during insulin phase. Hypoglycemic reactions, all mild, were recorded at a rate of 1.35/patient in the AM group and 0.4/patient in the HS group (P < 0.025). CONCLUSIONS: Normal fasting glycemia and near-normal postprandial glucose profile could be obtained with combination therapy in NIDDM. Results were similar if insulin, alone or in combination with glyburide, was given before breakfast or at bedtime, but hypoglycemic reactions were more common with conventional morning insulin injections.