Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 46
Filtrar
Más filtros










Base de datos
Intervalo de año de publicación
1.
Opt Express ; 32(4): 5273-5286, 2024 Feb 12.
Artículo en Inglés | MEDLINE | ID: mdl-38439259

RESUMEN

We investigate theoretically the photoelectron momentum distributions (PMDs) of the helium atom in the few-cycle nonlinear chirped laser pulse. The numerical results show that the direction of the spider-like interference structure in PMDs exhibits periodic variations with the increase of the chirp parameter. It is illustrated that the direction of the spider-like interference structure is related to the direction of the electron motion by tracking the trajectories of the electrons. We also demonstrate that the carrier-envelope phase can precisely control the opening of the ionization channel. In addition, we investigate the PMDs when a chirp-free second harmonic (SH) laser pulse is added to the chirped laser field, the numerical results show that the interference patterns can change from only spider-like interference structure to both spider-like and ring-like interference structures.

2.
Regen Ther ; 25: 1-9, 2024 Mar.
Artículo en Inglés | MEDLINE | ID: mdl-38108044

RESUMEN

With the rapid development of society and the economy, population aging has become a common challenge faced by many countries in the world today. Structural and functional changes in the cardiovascular system can occur with age, increasing the incidence and severity of cardiovascular diseases in older adults. Due to the limited regenerative capacity of myocardial cells, myocardial infarction and its resulting heart failure and congenital heart disease have become the number one killer of human health. At present, the treatment of cardiovascular diseases includes drug therapy and nondrug therapy. Nondrug therapy mainly includes minimally invasive interventional therapy, surgical diagnosis and treatment, and cell therapy. Long-term drug treatment may cause headache due to vasodilation, lower blood pressure, digestive system dysfunction and other side effects. Surgical treatment is traumatic, difficult to treat, and expensive. In recent years, stem cell therapy has exhibited broad application prospects in basic and clinical research on cardiovascular disease because of its plasticity, self-renewal and multidirectional differentiation potential. Therefore, this paper looks at stem cell therapy for diseases, reviews recent advances in the mechanism and clinical transformation of cardiovascular aging and related diseases in China, and briefly discusses the development trend and future prospects of cardiovascular aging research.

3.
Mol Biotechnol ; 65(7): 1076-1084, 2023 Jul.
Artículo en Inglés | MEDLINE | ID: mdl-36436163

RESUMEN

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.


Asunto(s)
Células Madre Mesenquimatosas , ARN Pequeño no Traducido , Humanos , ARN Pequeño no Traducido/metabolismo , Cordón Umbilical
4.
Front Oncol ; 12: 896433, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-35646697

RESUMEN

Metabolic reprogramming is a hallmark of glioma, and sterol O-acyltransferase 1 (SOAT1) is an essential target for metabolic therapy. However, the prognostic value of SOAT1 and its association with immune infiltration has not been fully elucidated. Using RNA-seq and clinical data of glioma patients from The Cancer Genome Atlas (TCGA), SOAT1 was found to be correlated with poor prognosis in glioma and the advanced malignancy of clinicopathological characteristics. Next, the correlation between SOAT1 expression and tumor-infiltrating immune cells was performed using the single-sample GSEA algorithm, gene expression profiling interactive analysis (GEPIA), and tumor immune estimation resource version 2 (TIMER2.0); it was found that SOAT1 expression was positively correlated with multiple tumor-infiltrating immune cells. To further verify these results, immunofluorescence was conducted on paraffin-embedded glioma specimens, and a positive trend of the correlation between SOAT1 expression and Treg infiltration was observed in this cohort. Finally, differentially expressed gene analysis, and Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses were performed to explore the biological processes and signaling pathways that SOAT1 may be involved in during glioma pathogenesis. A protein-protein interaction network was established, and co-expression analysis was conducted to investigate the regulatory mechanism of SOAT1 in glioma. To the best of our knowledge, this is the first comprehensive study reporting that SOAT1 may serve as a novel prognostic biomarker associated with immune infiltrates, providing a novel perspective for glioma metabolic therapy.

5.
J Cancer ; 13(6): 1745-1757, 2022.
Artículo en Inglés | MEDLINE | ID: mdl-35399707

RESUMEN

Glioblastoma (GBM) is the most lethal malignant tumor in the central nervous system, with a median survival of only 14 months. Cholesterol, which is the main component of cell membrane and the precursor of many hormones, is one of the most important lipid components in human body. Since reprogramming of the cholesterol metabolic profile has been discovered in many cancers including GBM, cholesterol metabolism becomes a promising potential target for therapy. Since GBM cells rely on external cholesterol to survive and accumulate lipid droplets to meet their rapid growth needs, targeting the metabolism of cholesterol by different strategies including inhibition of cholesterol uptake and promotion of cholesterol efflux by activating LXRs and disruption of cellular cholesterol trafficking, inhibition of SREBP signaling, inhibition of cholesterol esterification, could potentially oppose the growth of glial tumors. In this review, we discussed the above findings and describe cholesterol synthesis and homeostatic feedback pathways in normal brain tissues and brain tumors, statin use in GBM and the role of lipid rafts and cholesterol precursors and oxysterols in the treatment and pathogenesis of GBM are also summarized.

6.
IUCrJ ; 8(Pt 5): 805-813, 2021 Sep 01.
Artículo en Inglés | MEDLINE | ID: mdl-34584741

RESUMEN

Electron diffraction techniques in transmission electron microscopy (TEM) have been successfully employed for determining the unit-cell parameters of crystal phases, albeit they exhibit a limited accuracy compared with X-ray or neutron diffraction, and they often involve a tedious measurement procedure. Here, a new package for determining unit-cell parameters from a single electron diffraction pattern has been developed. The essence of the package is to reconstruct a 3D reciprocal primitive cell from a single electron diffraction pattern containing both zero-order Laue zone and high-order Laue zone reflections. Subsequently, the primitive cell can be reduced to the Niggli cell which, in turn, can be converted into the unit cell. Using both simulated and experimental patterns, we detail the working procedure and address some effects of experimental conditions (diffraction distortions, misorientation of the zone axis and the use of high-index zone axis) on the robustness and accuracy of the software developed. The feasibility of unit-cell determination of the TiO2 nanorod using this package is also demonstrated. Should the parallel-beam, nano-beam and convergent-beam modes of the TEM be used flexibly, the software can determine unit-cell parameters of unknown-structure crystallites (typically >50 nm).

7.
Neoplasma ; 68(6): 1147-1156, 2021 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-34427100

RESUMEN

The cystine/glutamate antiporter xCT (SLC7A11) is frequently upregulated in many cancers, including glioblastoma (GBM). SLC7A11-mediated cystine taken up is reduced to cysteine, a precursor amino acid for glutathione synthesis and antioxidant cellular defense. However, little is known about the biological functions of SLC7A11 and its effect on therapeutic response in GBM. Here, we report that the expression of SLC7A11 is higher in GBM compared with normal brain tissue, but is negatively associated with tumor grades and positively impacts survival in the bioinformatic analysis of TCGA and CGGA database. Additionally, a negative association between SLC7A11 and mismatch repair (MMR) gene expression was identified by Pearson correlation analysis. In the GBM cells with glucose-limited culture conditions, overexpression of SLC7A11 significantly decreased MMR gene expression, including MLH1, MSH6, and EXO1. SLC7A11-overexpressed GBM cells demonstrated elevated double-strand break (DSB) levels and increased sensitivity to radiation treatment. Taken together, our work indicates that SLC7A11 might be a potential biomarker for predicting a better response to radiotherapy in GBM.


Asunto(s)
Sistema de Transporte de Aminoácidos y+ , Reparación de la Incompatibilidad de ADN , Glioblastoma , Sistema de Transporte de Aminoácidos y+/genética , Sistema de Transporte de Aminoácidos y+/metabolismo , Línea Celular Tumoral , Expresión Génica , Glioblastoma/genética , Glioblastoma/radioterapia , Glucosa , Humanos
8.
Nanoscale ; 13(23): 10402-10413, 2021 Jun 21.
Artículo en Inglés | MEDLINE | ID: mdl-34096958

RESUMEN

Solid solution AuFe nanoparticles were synthesized for the first time under ambient conditions by an adapted method previously established for the Fe3O4-Au core-shell morphology. These AuFe particles preserved the fcc structure of Au incorporated with paramagnetic Fe atoms. The metastable AuFe can be segregated by transformation into Janus Au/Fe particles with bcc Fe and fcc Au upon annealing. The ferromagnetic Fe was epitaxially grown on low index fcc Au planes. This preparation route delivers new perspective materials for magnetoplasmonics and biomedical applications and suggests the reconsideration of existing protocols for magnetite-gold core-shell synthesis.

9.
Cells Tissues Organs ; 210(2): 118-134, 2021.
Artículo en Inglés | MEDLINE | ID: mdl-34182545

RESUMEN

Based on the characteristics of modern weapon injury, a repetitive model of traumatic systemic inflammatory response syndrome (SIRS) and an evaluation system were established. The models were treated with GFP-labeled tree shrew umbilical cord mesenchymal stem cells (UCMSCs). Forty out of 50 tree shrews were used to make a unilateral femoral comminuted fracture. Lipopolysaccharide was injected intravenously to create a traumatic SIRS model. The other 10 shrews were used as normal controls. After the model was established for 10 days, 20 tree shrews were injected intravenously with GFP-labeled UCMSCs, and 18 tree shrews were not injected as the model control group. The distribution of GFP-labeled cells in vivo was measured at 2 and 10 days after injection. Twenty days after treatment, the model group, the normal control group, and the treatment group were taken to observe the pathological changes in each tissue, and blood samples were taken for the changes in liver, renal, and heart function. Distribution of GFP-positive cells was observed in all tissues at 2 and 10 days after injection. After treatment, the HE staining results of the treatment group were close to those of the normal group, and the model group had a certain degree of lesions. The results of liver, renal, and heart function tests in the treatment group were returned to normal, and the results in the model group were abnormally increased. UCMSCs have a certain effect on the treatment of traumatic SIRS and provide a new technical solution for modern weapon trauma treatment.


Asunto(s)
Trasplante de Células Madre Mesenquimatosas , Células Madre Mesenquimatosas , Humanos , Riñón , Síndrome de Respuesta Inflamatoria Sistémica/terapia , Cordón Umbilical
10.
J Phys Condens Matter ; 33(21)2021 May 03.
Artículo en Inglés | MEDLINE | ID: mdl-33588386

RESUMEN

The microstructure of quasi-one-dimensional KCr3As3(133) superconductors, which were prepared by chemical cation deintercalation from their counterpart K2Cr3As3(233) compounds, are investigated using scanning transmission electron microscopy. The nominal KCr3As3crystals generally exhibit irregular nanoscale 133-phase domains accompanied by an amorphous As-deficient phase and cracks as a result of alkali cation deintercalation processes. Analysis of local defective structures reveals the existence of an intermediate state in the transformation from 233 to 133 phase and a possible K-deficient 233-type structure as a nanoscale cluster. Our microscopic investigations offer insight into the microstructure of KCr3As3and the alkali metal cation deintercalation processes.

11.
PLoS One ; 15(12): e0244160, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-33370374

RESUMEN

Ischemia-reperfusion injury is an important contributor to acute kidney injury and a major factor affecting early functional recovery after kidney transplantation. We conducted this experiment to investigate the protective effect of induced multipotent stem cell transplantation on renal ischemia-reperfusion injury. Forty rabbits were divided into four groups of 10 rabbits each. Thirty rabbits were used to establish the renal ischemia-reperfusion injury model, and ten rabbits served as the model group and were not treated. Among the 30 rabbits with renal ischemia-reperfusion injury, 10 rabbits were treated with induced peripheral blood mononuclear cells (PBMCs), and 10 other rabbits were treated with noninduced PBMCs. After three weekly treatments, the serum creatinine levels, urea nitrogen levels and urine protein concentrations were quantified. The kidneys were stained with hematoxylin-eosin (HE), periodic acid-Schiff (PAS) and Masson's trichrome and then sent for commercial metabolomic testing. The kidneys of the rabbits in the model group showed different degrees of pathological changes, and the recovery of renal function was observed in the group treated with induced cells. The results indicate that PBMCs differentiate into multipotent stem cells after induction and exert a therapeutic effect on renal ischemia-reperfusion injury.


Asunto(s)
Clara de Huevo/química , Riñón/irrigación sanguínea , Leucocitos Mononucleares/trasplante , Daño por Reperfusión/terapia , Animales , Diferenciación Celular , Extractos Celulares/farmacología , Células Cultivadas , Leucocitos Mononucleares/citología , Leucocitos Mononucleares/efectos de los fármacos , Células Madre Pluripotentes/citología , Conejos
12.
Aging (Albany NY) ; 12(17): 16899-16920, 2020 Sep 14.
Artículo en Inglés | MEDLINE | ID: mdl-32924972

RESUMEN

BACKGROUND: To study the effect of allogeneic umbilical cord mesenchymal stem cell transplantation on the structure and function of the thymus in aged C57 mice and provide a new method for the treatment of senile thymic atrophy. RESULTS: The changes in the thymus cortex and medulla volume and the lymphocyte ratio were analyzed by immunofluorescence. For thymus tissue sections, immunohistochemical staining was performed to detect p16, p53, SOD, becline1, LC3b, p62, sirt1, and sirt3. Changes in CK5, CK8, CD4 and CD8 expression were observed. Treatment with mUCMSCs could promote hair regeneration in aging mice and regenerate the thymus structure. CONCLUSIONS: mUCMSCs inhibited senescence of the thymus and promoted structural and functional thymus regeneration by downregulating the senescence genes p53 and p16 and upregulating the SOD, Sirt1 and Sirt3 genes, but the mechanism requires further research. METHODS: C57 mice were obtained and met the requirements of thymic aging. mUCMSCs were infused via the tail vein at a dose of 1×107 cells/kg twice per week for 3 weeks. Six weeks after the last transplantation, the thymus was weighed, and the thymus-to-body weight ratio was calculated. The thymus tissue was stained with HE.

13.
Nanoscale ; 12(27): 14919-14925, 2020 Jul 16.
Artículo en Inglés | MEDLINE | ID: mdl-32638795

RESUMEN

Studying the magnetic transition between different topological spin textures in noncentrosymmetric magnets under external stimuli is an important topic in chiral magnetism. Here, using in situ Lorentz transmission electron microscopy (LTEM) we directly visualize the thermal-driven magnetic transitions and dynamic characteristics in FeGe thin plates. A novel protocol-dependent phase diagram of FeGe thin plates was obtained via pulsed laser excitation. Moreover, by setting the appropriate specimen temperature, the relaxation of chiral magnetic states in FeGe specimens was recorded and analyzed with an Arrhenius-type relaxation mechanism. We present the field-dependent activation energy barriers for chiral state transitions and the magnetic transition pathways of these spin textures for FeGe thin plates. Our results unveil the effects of thermal excitation on the topological spin texture transitions and provide useful information about magnetic dynamics of chiral magnetic state relaxation.

14.
J Chem Phys ; 152(11): 114202, 2020 Mar 21.
Artículo en Inglés | MEDLINE | ID: mdl-32199423

RESUMEN

Investigating the local micromagnetic structure of ferromagnetic nanowires (NWs) at the nanoscale is essential to study the structure-property relationships and can facilitate the design of nanostructures for technology applications. Herein, we synthesized high-quality iron and cobalt NWs and investigated the magnetic properties of these NWs using off-axis electron holography. The Fe NWs are about 100 nm in width and a few micrometers in length with a preferential growth direction of [100], while the Co NWs have a higher aspect-ratio with preferential crystal growth along the [110] direction. It is noted that compact passivation surface layers of oxides protect these NWs from further oxidation, even after nearly two years of exposure to ambient conditions; furthermore, these NWs display homogeneous ferromagnetism along their axial direction revealing the domination of shape anisotropy on magnetic behavior. Importantly, the average value of magnetic induction strengths of Fe NWs (2.07 {±} 0.10 T) and Co NWs (1.83 {±} 0.15 T) is measured to be very close to the respective theoretical value, and it shows that the surface oxide layers do not affect the magnetic moments in NWs. Our results provide a useful synthesis approach for the fabrication of single-crystalline, defect-free metal NWs and give insight into the micromagnetic properties in ferromagnetic NWs based on the transmission electron microscopy measurements.

15.
Sci Rep ; 10(1): 2861, 2020 Feb 18.
Artículo en Inglés | MEDLINE | ID: mdl-32071362

RESUMEN

Strong unidirectional anisotropy in bulk polycrystalline B20 FeGe has been measured by ferromagnetic resonance spectroscopy. Such anisotropy is not present in static magnetometry measurements. B20 FeGe exhibits inherent Dzyaloshinskii-Moriya interaction, resulting in a nonreciprocal spin-wave dispersion. Bulk and micron sized samples were produced and characterized. By X-band ferromagnetic resonance spectroscopy at 276 K ± 1 K, near the Curie temperature, a distribution of resonance modes was observed in accordance with the cubic anisotropy of FeGe. This distribution exhibits a unidirectional anisotropy, i.e. shift of the resonance field under field inversion, of KUD = 960 J/m3 ± 10 J/m3, previously unknown in bulk ferromagnets. Additionally, more than 25 small amplitude standing spin wave modes were observed inside a micron sized FeGe wedge, measured at 293 K ± 2 K. These modes also exhibit unidirectional anisotropy. This effect, only dynamically measurable and not detectable in static magnetometry measurements, may open new possibilities for directed spin transport in chiral magnetic systems.

16.
Sci Rep ; 9(1): 17646, 2019 11 27.
Artículo en Inglés | MEDLINE | ID: mdl-31776475

RESUMEN

Inflammatory bowel disease (IBD) is a persistent and chronic disease that is characterized by destructive gastrointestinal (GI) inflammation. Researchers are trying to identify and develop new and more effective treatments with no side effects. Acute and chronic mouse models of IBD were established using dextran sulfate sodium (DSS) solution. To evaluate the efficacy and mechanism, umbilical cord mesenchymal stem cells (UCMSCs) were obtained from Kunming (KM) mice and humans. In the chronic IBD study, the survival rates of the normal control, model, mouse UCMSC (mUCMSC) and human UCMSC (hUCMSC) groups were 100%, 40%, 86.7%, and 100%, respectively. The histopathological scores of the normal control, intraperitoneal injection, intravenous treatment, and model groups were 0.5 ± 0.30, 5.9 ± 1.10, 8.7 ± 1.39, and 8.8 ± 1.33 (p = 0.021). UCMSCs promoted the expression of the intestinal tight junction protein occludin, downregulated the protein expression of the autophagy marker LC3A/B in colon tissue, and upregulated the expression of VEGF-A and VEGFR-1 at the injured site. This study provides an experimental model for elucidating the therapeutic effects of UCMSCs in IBD. We provide a theoretical basis and method for the clinical treatment of IBD using UCMSCs.


Asunto(s)
Enfermedades Inflamatorias del Intestino/terapia , Células Madre Mesenquimatosas , Cordón Umbilical/citología , Animales , Células Cultivadas , Humanos , Trasplante de Células Madre Mesenquimatosas , Ratones , Ocludina/metabolismo , Uniones Estrechas/metabolismo , Regulación hacia Arriba , Factor A de Crecimiento Endotelial Vascular/metabolismo , Receptor 1 de Factores de Crecimiento Endotelial Vascular/metabolismo
17.
Beilstein J Nanotechnol ; 10: 1434-1442, 2019.
Artículo en Inglés | MEDLINE | ID: mdl-31431855

RESUMEN

The prominent role of oxygen vacancies in the photocatalytic performance of bismuth tungsten oxides is well recognized, while the underlying formation mechanisms remain poorly understood. Here, we use the transmission electron microscopy to investigate the formation of oxygen vacancies and the structural evolution of Bi2WO6 under in situ electron irradiation. Our experimental results reveal that under 200 keV electron irradiation, the breaking of relatively weak Bi-O bonds leads to the formation of oxygen vacancies in Bi2WO6. With prolonged electron irradiation, the reduced Bi cations tend to form Bi clusters on the nanoflake surfaces, and the oxygen atoms are released from the nanoflakes, while the W-O networks reconstruct to form WO3. A possible mechanism that accounts for the observed processes of Bi cluster formation and oxygen release under energetic electron irradiation is also discussed.

18.
Aging (Albany NY) ; 11(2): 590-614, 2019 01 23.
Artículo en Inglés | MEDLINE | ID: mdl-30673631

RESUMEN

The relationship between bone marrow mesenchymal stem cells (BMSCs) and aging, as well as the antiaging effects of BMSCs, was observed. An aging macaque BMSC model was established. We isolated BMSCs from young and aged macaques and used RT-PCR and Western blot to confirm the aging-related mRNAs and their expression, revealing that TERT, SIRT1 and SIRT6 expression was decreased in the aged BMSCs. The morphology, immunophenotype, differentiation potential, proliferation potential, and antiaging effects of aged and young BMSCs on 293T cells were compared. The expression of aging-related genes and the difference between the secreted cytokines in natural aging and induced aging BMSCs were observed. The transcriptome of peripheral blood mononuclear cells from macaques was analyzed by high-throughput sequencing. Finally, the transcriptional characteristics and regulatory mechanisms of gene transcription in aging macaques were investigated.


Asunto(s)
Envejecimiento/fisiología , Senescencia Celular/fisiología , Macaca , Células Madre Mesenquimatosas/fisiología , Animales , Citocinas/genética , Citocinas/metabolismo , Regulación de la Expresión Génica/fisiología , Células HEK293 , Humanos , Leucocitos Mononucleares/metabolismo , Transcriptoma
19.
Sci Rep ; 8(1): 11295, 2018 07 26.
Artículo en Inglés | MEDLINE | ID: mdl-30050080

RESUMEN

High-quality, 25 nm octahedral-shaped Fe3O4 magnetite nanocrystals are epitaxially grown on 9 nm Au seed nanoparticles using a modified wet-chemical synthesis. These Fe3O4-Au Janus nanoparticles exhibit bulk-like magnetic properties. Due to their high magnetization and octahedral shape, the hybrids show superior in vitro and in vivo T2 relaxivity for magnetic resonance imaging as compared to other types of Fe3O4-Au hybrids and commercial contrast agents. The nanoparticles provide two functional surfaces for theranostic applications. For the first time, Fe3O4-Au hybrids are conjugated with two fluorescent dyes or the combination of drug and dye allowing the simultaneous tracking of the nanoparticle vehicle and the drug cargo in vitro and in vivo. The delivery to tumors and payload release are demonstrated in real time by intravital microscopy. Replacing the dyes by cell-specific molecules and drugs makes the Fe3O4-Au hybrids a unique all-in-one platform for theranostics.


Asunto(s)
Sistemas de Liberación de Medicamentos , Óxido Ferrosoférrico/administración & dosificación , Oro/administración & dosificación , Imagen por Resonancia Magnética/métodos , Nanopartículas del Metal/química , Nanomedicina Teranóstica/métodos , Animales , Línea Celular Tumoral , Modelos Animales de Enfermedad , Himenópteros , Ratones , Neoplasias Experimentales/diagnóstico por imagen , Neoplasias Experimentales/tratamiento farmacológico , Soluciones para Nutrición Parenteral
20.
Phys Rev Lett ; 120(16): 167204, 2018 Apr 20.
Artículo en Inglés | MEDLINE | ID: mdl-29756913

RESUMEN

Whereas theoretical investigations have revealed the significant influence of magnetic surface and edge states on Skyrmonic spin texture in chiral magnets, experimental studies of such chiral states remain elusive. Here, we study chiral edge states in an FeGe nanostripe experimentally using off-axis electron holography. Our results reveal the magnetic-field-driven formation of chiral edge states and their penetration lengths at 95 and 240 K. We determine values of saturation magnetization M_{S} by analyzing the projected in-plane magnetization distributions of helices and Skyrmions. Values of M_{S} inferred for Skyrmions are lower by a few percent than those for helices. We attribute this difference to the presence of chiral surface states, which are predicted theoretically in a three-dimensional Skyrmion model. Our experiments provide direct quantitative measurements of magnetic chiral boundary states and highlight the applicability of state-of-the-art electron holography for the study of complex spin textures in nanostructures.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA