[Polymorphism of the Full-Length mRNA Sequences of MNS blood group-related genes GYPA, GYPB and GYPE].

OBJECTIVE: The characteristics of the full-length mRNA sequences of MNS blood group-related genes GYPA, GYPB and GYPE were analyzed to understand the polymorphism of MNS blood group genes. METHODS: Anticoagulated blood within 24 h from 500 unpaid blood donors (8 ml each) were randomly selected, and MN, Ss and Mia blood types were identified by serological methods. 5 samples with different combinations of MNS and Mia blood types were randomly selected from 500 samples, and peripheral blood mononuclear cells (PBMC) were isolated by density gradient centrifugation, then total mRNA was extracted. cDNA was prepared by using the reverse transcription kit. The target fragments were amplified by nested PCR, and the full-length mRNA sequences of GYPA, GYPB and GYPE were sequenced after gel cutting and recycling, and the base sequences were analyzed by Oligo 6.0 software. RESULTS: The MN, Ss and Mia phenotypes were detected by serological methods, and there were differences in agglutination intensity of red blood cells (RBC) and anti-Mia serum between different individuals. The full-length mRNA sequences of GYPA, GYPB and GYPE genes in 5 samples of different phenotype combinations were detected. The exon-6 was completely deleted from the GYPA mRNA in 1 sample, and the full-length of GYPA mRNA in the other 4 samples were complete. The exon-2 was completely deleted from the GYPB mRNA in 2 samples, with Mia blood type negative. 2 samples showed complete full-length of GYPB mRNA, with Mia blood type positive. There was base substitution in exon-5 of GYPB mRNA in 1 sample. The full-length of GYPE mRNA was intact in 5 samples. CONCLUSION: MNS blood group related-genes have obvious polymorphism, and the detection of full-length mRNA sequence lays a foundation for the analysis of GYPA, GYPB and GYPE gene structure and in-depth study of MNS blood group antigen expression.

Maternal Cold-Reacting Immunoglobulin G Anti-M of MNS Blood Group System Causing Hemolytic Disease of the Fetus.

Several cases of the hemolytic disease of the fetus and newborn (HDFN) caused by immunoglobulin G (IgG) anti-M antibodies have been reported, in which almost all the HDFN-associated anti-M were warmly reacting. Here we report two cases of severe HDFN associated with cold-reacting IgG anti-M. In both cases, pregnancy was terminated, in weeks 33 and 23 respectively, due to a diagnosis of fetal growth retardation (FGR). To our knowledge, these are the most severe HDFN cases caused by cold-reacting IgG anti-M.

Naturally occurring anti-PP1PK in a Chinese individual with p phenotype: A case based on compound heterozygosity including one novel allele.

BACKGROUND: The null phenotype in P1PK blood group, known as "p," is extremely rare in the whole world. Individuals of p phenotype spontaneously form anti-PP1PK isoantibody. Here, we report a case of p phenotype with naturally occurring anti-PP1PK isoantibodies in a Chinese individual. STUDY DESIGN AND METHODS: Serology tests, containing alloantibodies screening and identification, were conducted to demonstrate the phenotype in P1PK blood group. The genotype of A4GALT gene was identified by haplotypes separation and sequencing. RESULTS: The serological assay demonstrated the p phenotype of the proband, presenting with 1:64 titer of anti-PP1PK . The sequencing data revealed a compound heterozygote consisting of A4GALT*P1.01 with c.343A>T and a novel allele based on A4GALT*01N.05 with an addition polymorphism c.100G>A. The sequence of the novel allele has been submitted to GenBank and the accession number OM912503 was assigned. CONCLUSION: Our study demonstrates a case of naturally occurring anti-PP1Pk in a Chinese individual with p phenotype, which is based on compound heterozygosity including one novel allele. As the proband is a young lady, monitoring the titer of anti-PP1PK and early initiation of medical intervention are essential after her pregnancy.

DNA sequence analysis and Jk blood group genotype-phenotype assessment.

BACKGROUND: The Kidd (JK) blood group is critical for clinical blood transfusion. Various methods for Jk typing have been commonly used, including urea hemolysis, serological test, and genotyping. However, the application of molecular methods has so far been restricted to selected samples and not been applied to the population-scale analysis. METHODS: One hundred eighty-three blood samples, containing 174 samples collected from voluntary blood donors of Chinese Han individuals, together with 3 Jk (aw+b-) and 6 Jk (a-b-) samples, were investigated by standard serology urea hemolysis test and Sanger-sequencing. Complete coverage of exons 4-11 and intron-exon borders have been sequenced. RESULTS: We report the frequencies of three SNPs in exon 4, 7, and intron 9. Besides, sequence analysis revealed the simultaneous DNA variants of intron 7 (-68) and exon 9 (838) found in all samples, suggesting the co-inheritance of these SNPs-taking the observed SNPs frequencies into account. Further, we discuss the potential of the sequencing technique for high-resolution genotyping. CONCLUSIONS: The described sequencing method for Jk exons delivers a genotyping technique for Jk molecular characterization. According to the co-inheritance of these DNA variants in intron 7 (-68) and exon 9 (838), and their regularity linkage with Jk phenotypes, these two sites offer a potential sequencing target for rapid and far more simplified Jk typing that can supplement routine serology and urea hemolysis tests.

[Genotyping of Duffy Blood Group by Microchip Capillary Electrophoresis].

OBJECTIVE: To explore a method for rapidly screening the Duffy blood group genotypes and to establish an information bank of rare blood type donors. METHODS: The microfluidic capillary electrophoresis system and PCR-SSP method were used to analyze the Duffy genotype of 3 936 unrelated O-type blood donors in our center from December 2014 to September 2018. The serologic identification and typing of other blood type system phenotypes for FYa-negative specimen were performed. The Fy (a-b-) specimen was sequenced for genotyping. RESULTS: The phenotypes of FYa-negative specimens were consistent with the genotyping results of the microfluidic capillary electrophoresis system. The results of Duffy phenotyping in 3 936 specimens were follows: Fy (a+b-) 3 564 (90.54%), Fy(a+b+) 353 (8.97%), Fy(a-b+) 18 (0.46%), Fy (a-b-) 1 (0.03%). The gene frequency was FY*A (95.03%), FY*B (4.94%), and FY*Null (0.03%). The bank of rare blood types of 19 FYa-negative specimens was established. CONCLUSION: Microfluidic capillary electrophoresis system is suitable for Duffy blood group genotyping screening. It can be used to establish a bank of rare blood type, so as to solve the problem of urgent blood transfusion in patients with rare blood type, and to improve blood transfusion safety.

[Allele Frequency and Distribution of Single Nucleotide Polymorphisms in Promoter Region of Gene Encoding the Kidd Blood Group Antigens].

OBJECTIVE: To study the single nucleotide polymorphisms (SNPs) in promoter region of the Jk gene and its allele frequency as well as distribution characteristics in the Chinese Han nationality population. METHODS: 127 blood samples containing 8 Jk(a-b-) and 119 samples (as control) taken randomly from voluntary blood donors of Chinese Han nationality persons in Shenzhen Blood Center were collected. The Kidd phenotypes were identified by using the serologic test and urea hemolysis test; the Jk promoter, exon 1-11 region and respective flanking area were amplified and sequenced, then the sequence information was analyzed. RESULTS: 8 Jk(a-b-) samples all carried JkB/JkB allele which belongs to 2 kind of Jknull genotypes commonly observed in Chinese Han nationality population. 6 IVS5-1g>a and 2 896G>A were found in 8 Jk(a-b-) samples. Besides, all Jk(a-b-) samples were homozygous for JkB/JkB allele. Three SNPs-110(rs900974), -160(rs1484877) and -258(rs1484878) in promoter region of the Jk gene were found and sequenceds calculation of allele and genotype frequencies showed that the result accorded with Hardy-Weinberg equilibrium, indicating that the population in this study possesses representative characteristics of the Chinese Han nationality population. CONCLUSION: The polymorphism of the Jk gene occurs in promoter region. This study calculates the allele frequencies of three SNPs-110(rs900974), -160(rs1484877) and -258(rs1484878) in promoter region of the Jk gene, and shows their distribution characteristics in distinct Kidd phenotypes. These findings provide the basic foundation for further population genetics research.

[Establishment and Application of a Method for Determination of Glycosyltransferase Activity].

OBJECTIVE: To establish a method for determination of glycosyltransferase and to explore the enzyme A, B glycosyltransferase activity in human serum so as to lay the foundation for the determination of enzyme level and enzyme activity. METHODS: The glycosyltransferase activity kit was used to draw phosphate standard curves in our laboratory. The A and B glycosyltransferase activity were determined by the standard curves. RESULTS: The standard curves (y=2671.3x-0.596 R2=0.9998) for determing glycosyltransferase activity suitable for use in our laboratory were drawn. At the same time the method was set up for determination of A, B glycosyltransferase in human serum. CONCLUSION: The establised method of the determination of glycosyltransferase is suitable for common type of enzyme activity and suitable for the A, B glycosyltransferase in human serum.

[Molecular polymorphism of gypa gene in association with MN human blood group in Chinese Han population].

This study was purposed to investigate the molecular polymorphism of gypa gene in association with MN human blood group in Chinese Han population. The MN phenotypes of 202 random samples from unrelated Chinese Han volunteers were identified by serology techniques. The primer for gypa gene exon 2 were designed and synthesized according to reference sequences of NG-007470 gene from GenBank, the DNA of 202 samples was amplified by PCR, at the same time, the amplified products were analyzed by direct DNA sequencing. The results showed that all samples had 2 base substitutions at 1st and 56th nt of gypa exon 2, among them the MN phenotype heterozygote exited mainly in the form of 1A > C, 22T/C, 34A/G, 35T/G, 56T > C; the MM phenotype homozygote exited mainly in the form of 1A > C, 22C, 34G, 35T, 56T > C; the NN phenotype homozygote exited mainly in the form of 1A > C, 22T, 34A, 35G, 56T > C. It is concluded that the polymorphism of gypa gene in associated with MN blood group in Chinese Han population is decided by 5 nucleotide sites of 1, 22, 34, 35 and 56. The bases of 1 and 56 are non-functional gypa single nucleotide polymorphism.

Polymorphic analysis of the Lutheran blood group system in Chinese.

The Lutheran blood group is a complex system consisting of 19 identified antigens. It belongs to the immunoglobulin family of receptors and adhesion molecules. Four pairs of antigens show allelic relationships while other antigens are of very high incidence. In this study, we performed genetic polymorphism analyses by molecular techniques of the Lutheran blood group system in Chinese subjects. Blood samples were collected from randomly-selected healthy donors and analyzed by PCR-RFLP or SBT methods. LU1/2(Lu(a)/Lu(b)), LU6/9, LU8/14, and LU18/LU19(Au(a)/Au(b)) antigen polymorphisms were detected as follows: 1102 individuals were diagnosed as Lu(a-b+) type; 117 individuals were all LU(6+9-) genotypes; 119 individuals were all LU(8+14-) genotypes. Among 368 individuals, 278 showed homozygous nt1615A, 6 showed homozygous nt1615G, and 84 showed nt1615A/G heterozygosity. The gene frequencies of Au(a) and Au(b) in Chinese subjects were 0.8695 and 0.1304 respectively. A novel allele was identified in 4 Lu(18+19-) phenotype cases from 3 families.

Haemolytic disease of fetus and newborn caused by ABO antibodies in a cisAB offspring.

ABO hemolytic disease of fetus and newborn (ABO-HDFN) occurs almost exclusively in infants of blood group A or B who are born to group O mothers because IgG anti-A or -B occurs more commonly in group O than in group A or B individuals. We report a case of clinically significant ABO-HDFN where the mother was blood group O with elevated IgG anti-A and anti-B titers and delivered a child with an A2B phenotype. This unusual ABO constellation between mother and infant was based on the inheritance of a rare ABO allele encoding for a glycosyltransferase capable of synthesizing both A and B antigens. Because both anti-A and anti-B antibodies may have been involved in hemolysis in this case, it may be relevant to consider the cisAB phenomenon when monitoring ABO-incompatible pregnancies and births.

[Polymorphism of LW blood group gene in Chinese population].

In order to study the polymorphism of Landsteiner-Wiener (LW) blood group gene in Chinese population, peripheral blood samples anticoagulated with EDTA from 160 unrelated volunteer blood donors were randomly collected, and genomic DNA were extracted. 160 DNA samples were analyzed for exon 1 of LW gene by direct DNA sequencing, and detected for LWa/LWb allele by improved PCR-SSP genotyping. The results showed that all LW allele in 160 donors were LWa homozygous, and the LWa allele occurred commonly. In conclusion, LWa allele occurs with incidence of 100% of donors in this study, while LWb allele has not been found in Chinese population.

[Analysis on expression and molecular basis for ABO glycosyltransferase with dual specificity].

In order to elucidate the expression and molecular genetic background of ABO gene seven samples with ABO discrepancy further identified as bi-specific ABO gene were studied. All these samples were subjected to phenotyping by monoclonal and polyclonal antisera and were then genotyped by direct DNA sequencing and haplotype-sequencing at the exon 6 and 7 of ABO gene. As a result, six ABO dual-specific alleles were identified in Chinese population. An antigen expressed by these B (A) or Cis-AB individuals varied from very low level to the normal level, compared with common A blood group samples. In conclusion, molecular genetic backgrounds of two pairs out of four samples in all samples were the same, however, the ABO expression showed diverse.

[Study on ABO gene polymorphism in Uighur nationality in Xinjiang of China].

OBJECTIVE: To study the distribution of ABO gene polymorphism in Uighur population in Xinjiang area of China. METHODS: DNA was extracted from 160 Uygur unrelated donorso blood and PCR-sequence specific primer analysis was performed. Some difficult samples were further directly sequenced. RESULTS: Six alleles were detected in a population of 160 Uighur individuals, the gene frequencies of which were 0.2062(A101), 0.0563(A102), 0.0156(A201), 0.0031(A205),0.1875(B01),0.5312(O01), respectively. CONCLUSION: The characteristics for AB gene structure of Xinjiang Uighur suggests that genetic polymorphism is distinguished between Xinjiang Uighur nationality and Chinese Han nationality, and both of them have discrepancy and confluent characters.

Genotyping of samples lacking expected antibodies in ABO blood group.

We report nine donations with ABO inconsistency in reverse typing caused by partly or entirely missing antibodies. A and B antigens and antibodies were examined by serological blood typing, and ABO deoxyribonucleic acid (DNA) analyses were performed by sequence-specific priming and sequencing. A B101 allele was demonstrable in a case with O phenotype. The molecular mechanisms in deficiency of natural ABO antibody could be partly clarified. The ABO genotyping technique is an accurate method for determining the blood samples involved in ABO grouping discrepancies and is a valuable complement to serology for correct determination of donor blood status. The mechanisms involved in the absence of potent natural antibodies directed against A and B antigen lacking on an individual's own red cell membranes remain to be further investigated.

[Molecular genetic analysis of FUT1 and FUT2 gene in para-Bombay Chinese: a novel FUT1 allele is identified].

OBJECTIVE: Molecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay. METHODS: Seven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H. RESULTS: The FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status. CONCLUSION: A novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.