Plasma mtDNA copy numbers are associated with GSTK1 expression and inflammation in type 2 diabetes.

AIMS: Mitochondrial dysfunction is involved in the pathogenesis of type 2 diabetes. Glutathione S-transferase kappa 1 (GSTK1) is critical to maintain mitochondrial function and homeostasis. We aimed to investigate whether a potential link exists between mitochondrial DNA (mtDNA) copy numbers and inflammation, non-esterified fatty acids (NEFA) and GSTK1 expression in type 2 diabetes. METHODS: We assessed mtDNA copy numbers in plasma and GSTK1 expression in white blood cells in 123 people with type 2 diabetes and in 121 healthy controls using a quantitative polymerase chain reaction (qPCR). An automatic chemistry or immunoassay analyser was used to determine serum glucose, lipids and inflammatory markers. Multiple linear regression and multivariable logistic regression models were used to evaluate associations and risks. RESULTS: Compared with healthy controls, individuals with diabetes showed higher mtDNA copy numbers (t = -3.938, P < 0.001) and lower GSTK1 expression (Z = -2.985, P = 0.002). mtDNA copy number was associated with type 2 diabetes risk [odds ratio (OR) = 1.80, 95% confidence intervals (CI) 1.25-2.58, P = 0.001] after controlling for confounding factors. In individuals with diabetes, mtDNA copy number was negatively associated with GSTK1 expression (ß = -0.235, P = 0.036) and positively associated with serum high-sensitive C-reactive protein (hsCRP) (ß = 0.839, P < 0.001), tumour necrosis factor alpha (TNF-α) (ß = 0.549, P < 0.001), interleukin-6 (IL-6) (ß = 0.589, P = 0.006) and NEFA (ß = 0.001, P = 0.020). In the diabetic group, individuals with an abnormal increase in NEFA, hsCRP, TNF-α and IL-6 showed significantly elevated mtDNA copy numbers (all P < 0.05). CONCLUSIONS: mtDNA copy numbers in plasma might have an important role in the progression of diabetic chronic inflammation via inhibition of GSTK1 and could be a potential biomarker for type 2 diabetes.

A simplified method for the simultaneous detection of nervous necrosis virus and iridovirus in grouper Epinephelus spp.

Grouper nervous necrosis virus (GNNV) and grouper iridovirus (GIV) are major grouper-infecting viruses in southern China that can cause serious economic losses. A duplex reverse transcription-PCR (duplex RT-PCR) method was developed for the simultaneous detection of GNNV and GIV. Eight groups of primers specifically targeting the capsid protein genes of GNNV and GIV were designed and analyzed. The primer set GN4 was selected and used to amplify fragments of 887 bp and 319 bp in length from GNNV and GIV, respectively. Furthermore, the duplex PCR assay was shown to be sensitive because it could detect at least 20 pg of plasmid-viral DNA from a mixture of viruses. Using this assay, 18 GNNV infected groupers and 7 GIV infected groupers were detected amongst 41 suspected samples in Hainan. The duplex RT-PCR assay proved to be a rapid, specific, and sensitive method for detecting the two grouper viruses. This method could be used to facilitate better control of fish viruses through early detection. Keywords: duplex reverse transcription-PCR; nervous necrosis virus; iridovirus; grouper.

MicroRNA-200c suppresses tumor metastasis in oral squamous carcinoma by inhibiting epithelial-mesenchymal transition.

OBJECTIVE: To examine the potential mechanisms implicating miR-200c and epithelial-mesenchymal transition (EMT) in oral squamous carcinoma (OSC). MATERIALS AND METHODS: 32 pairs of OSC tissue samples and matched para-carcinoma normal tissue from patients undergoing routine surgery in the Xuzhou Stomatological Hospital from 2014-2016. HOC313 cells were cultured and transfected with miR-200c mimics and scrambled mimics. Cell migration, invasion assays, Luciferase reporter assay, and Western blot assay were conducted. RESULTS: miR-200c was downregulated in OSC tissues compared with adjacent normal tissues (n=32). miR-200c knockdown in the human oral cancer cell line HOC313 significantly suppressed cell invasion and migration, indicating the ability to inhibit tumor progression. Luciferase reporter assay indicated that miR-200c directly bound to the 3'-untranslated regions (3'-UTR) of Zinc finger E-box-binding homeobox (ZEB1) directly. Moreover, miR-200c significantly inhibited HOC313 cell EMT via negatively regulating ZEB1 protein expression. CONCLUSIONS: MiR-200c plays a pivotal role in controlling OSC metastasis via inhibiting EMT, which provides potential therapeutic targets for OSC.

Similarities and differences in the default mode network across rest, retrieval, and future imagining.

The default mode network (DMN) has been identified reliably during rest, as well as during the performance of tasks such as episodic retrieval and future imagining. It remains unclear why this network is engaged across these seemingly distinct conditions, though many hypotheses have been proposed to account for these effects. Prior to generating hypotheses explaining common DMN involvement, the degree of commonality in the DMN across these conditions, within individuals, must be statistically determined to test whether or not the DMN is truly a unitary network, equally engaged across rest, retrieval and future imagining. To provide such a test, we used comparable paradigms (self-directed, uninterrupted thought of equal duration) across the three conditions (rest, retrieval, and future imagining) in a within-participant design. We found lower than expected pattern similarity in DMN functional connectivity across the three conditions. Similarity in connectivity accounted for only 40-50% of the total variance. Partial Least Squares (PLS) analyses revealed the medial temporal regions of the DMN were preferentially coupled with one another during episodic retrieval and future imagining, whereas the non-medial temporal regions of the DMN (e.g., medial prefrontal cortex, lateral temporal cortex, and temporal pole) were preferentially coupled during rest. These results suggest that DMN connectivity may be more flexible than previously considered. Our findings are in line with emerging evidence that the DMN is not a static network engaged commonly across distinct cognitive processes, but is instead a dynamic system, topographically changing in relation to ongoing cognitive demands. Hum Brain Mapp 38:1155-1171, 2017. © 2016 Wiley Periodicals, Inc.

Characterization and effects of miR-21 expression in esophageal cancer.

The aim of this study was to investigate the expression of miR-21 in esophageal cancer and the impact of miR-21 on apoptosis, invasion, and the expression of target genes in esophageal cancer cells. Fluorescence quantitative polymerase chain reaction analysis was used to detect the expression of miR-21 in human esophageal tissues, adjacent tissues, and an esophageal cancer cell line (TE-13). The antisense miR-21 oligonucleotide was generated commercially using the solid-phase chemical synthesis method. Transient transfection was used to transfect esophageal cancer cells (TE-13 antisense and TE-13 control cells). Flow cytometry and Transwell cell assays were used to detect the apoptosis and invasion of esophageal cancer cells, respectively. The western blot method was used to detect the expression of PTEN, PDCD4, and K-ras proteins. These analyses determined that mir-21 expression significantly increased in esophageal cancer tissues and in TE-13 cells, and that this phenomenon was not associated with staging or lymph node metastasis. The apoptosis rate of TE-13 control cells was lower than that of antisense TE-13 cells indicating an enhanced invasive ability. In tissues adjacent to esophageal cancer and in TE-13 antisense cells, the expression of PTEN and PDCD4 was found to be higher than that in the control group, whereas the expression of K-ras showed the opposite pattern. Together, these results suggest that miR- 21 might be involved in the development and metastasis of esophageal cancer, through interaction with its PDCD4 and K-ras target genes.

Association of miR-21 with esophageal cancer prognosis: a meta-analysis.

The present study aimed to explore the relationship between miRNA expression and survival in patients with esophageal cancer (EC) using meta-analysis. We searched PubMed, EMBASE, CNKI, Wanfang, and ISI Web of Science databases without time restrictions, and extracted relevant data, such as the name of first author, publication year, age, gender, number of case, etc. from the studies included. We calculated the pooled hazard ratios (HRs) using the RevMan 5.2 software. A total of five studies involving 504 subjects were included in the meta-analysis, with the purpose of analyzing the association of miRNA-21 expression with EC prognosis. The pooled HR of elevated versus decreased miR-21 expression in EC was 1.87 [95% confidence interval (CI): 1.37-2.55, P < 0.001], with elevated miR-21 expression being associated with poorer prognosis for patients with EC. Our results support a prognostic role for miR-21 in EC.

First Report of Chilli ringspot virus on Chili Pepper in China.

Viral diseases have been a major limiting factor in the production of chili pepper (Capsicum chinense Jacp. cv. Yellow Lantern) in Hainan Province, China. In a 2009 disease survey, we found heavily infected fields of chili pepper exhibiting typical viral disease symptoms in three counties in Hainan. Total RNA was extracted from leaves of 14 randomly sampled plants and used as templates for reverse transcription (RT)-PCR using a pair of primers (forward 5' CGTAGACAACACACTCATGGT 3', reverse 5' GTTTTCCCAGTCACGAC(T)16 3') that were originally designed to detect Chilli veinal mottle virus (ChiVMV) (2). PCR fragments of 1.6 kb were amplified from the diseased but not the symptom-free samples and were subsequently sequenced. While most samples were found to be infected with ChiVMV, sequences of PCR fragments from three samples showed identities greater than 90% to two sequences of Chilli ringspot virus (ChiRSV), a member of Potyviridae, available in GenBank (Accession Nos. DQ925439 and DQ925438) (1), but less than 60% to that of the Hainan isolate of ChiVMV (Accession No. GQ981316), a distinct potyvirus (2). Furthermore, two of the samples contained one ChiRSV genotype while the third sample contained a different ChiRSV genotype, with a sequence identity of 91.7% between the two. Using these sequences, we subsequently designed a pair of primers (forward 5' TGGGATAGAGCATCTGAGC 3' and reverse 5' GAGTCATTTAGGTCATAATCAGTTT 3') for specific amplification of ChiRSV but not ChiVMV by RT-PCR. A ChiRSV-specific 0.6-kb DNA fragment was amplified from 8 of the 14 samples. Sequencing of these amplicons confirmed the presence of ChiRSV in these samples. Flexuous, rod-shaped virus particles, typical of the potyviruses, were observed by electron microscopy in the virion preparations purified from chili plants infected only with ChiRSV. Virion protein was purified and subjected to analysis by the MALDI-TOF/TOF tandem mass spectrometer (BGI, Shenzhen, China), yielding 35 peptide fragments that share the highest sequence homology to the coat protein of Vietnamese ChiRSV C8 and C9 isolates (GenBank Accession Nos. ABL09413 and ABL09414) (1) with protein sequence coverage of 61.8% and 52.9%, respectively. On the basis of these data, we concluded that the chili plants in Hainan were infected with ChiRSV. This virus was first reported in Vietnam in 2008 (1) but has not been found elsewhere. Leaves of the chili plants infected only with the Hainan isolate of ChiRSV displayed green banding along the main and major lateral veins, light interveinal chlorosis, and crinkling, similar to the symptoms of ChiVMV previously reported in Hainan (2). However, ChiVMV-infected leaves were notably more distorted than those infected by ChiRSV. We did not observe the characteristic ringspots described on ChiRSV-infected chili peppers in Vietnam (1). The difference in the symptoms may be accounted for by different ChiRSV genotypes, chili varieties, or a combination of both. The finding of two distinct viruses causing similar symptoms will help to improve identification and management of viral diseases on chili peppers. References: (1) C. Ha et al. Arch. Virol. 153:45, 2008. (2) J. Wang et al. Plant Dis. 90:377, 2006.

Extended magnetic reconnection across the dayside magnetopause.

The extent of where magnetic reconnection (MR), the dominant process responsible for energy and plasma transport into the magnetosphere, operates across Earth's dayside magnetopause has previously been only indirectly shown by observations. We report the first direct evidence of X-line structure resulting from the operation of MR at each of two widely separated locations along the tilted, subsolar line of maximum current on Earth's magnetopause, confirming the operation of MR at two or more sites across the extended region where MR is expected to occur. The evidence results from in-situ observations of the associated ion and electron plasma distributions, present within each magnetic X-line structure, taken by two spacecraft passing through the active MR regions simultaneously.

Effect of total flavonoid fraction of Astragalus complanatus R. Brown on angiotensin II-induced portal-vein contraction in hypertensive rats.

The objective of the present study was to examine further the underlying mechanism of the antihypertensive effect of the total flavonoid (TF), extracted from the seed of Astragalus complanatus R.Brown. Renovascular hypertension rats (RHR) were established by the two-kidney one clip (2K1C) method. The effect of TF on the contraction of portal vein was studied in an isolated preparation. The response of portal vein to angiotensin II (Ang II) was expressed as a percentage of the 100 mmol/l KCl induced maximum contraction. We took the dose-response curve of portal vein to Ang II (from 10(-9) to 10(-6) mmol/l) as the control and then observed the change of curve after TF and Valsartan (Ang II receptor blocker) administration. Ang II induced a concentration-dependent increase of the contraction amplitude (maximal increase, 46.53+/-5.15% of 100 mmol/l KCl induced contraction at Ang II 10(-6) mmol/l in RHR). The Ang II-induced portal vein contraction was prevented by TF with a concentration related manner (maximal inhibition amplitude from 46.53+/-5.15% to 22.525+/-4.67% of 100 mmol/l KCl contraction at 10(-6)mmol/l Ang II and 3.12 x 10(-1) mg/l TF in RHR). The effect of TF on Ang II-induced portal vein contraction was similar to Valsartan. These results showed that the antihypertensive action of TF was attributed to the dilation of vessels and is related to the blockade of the Ang II receptor.

A highly sensitive and specific multiplex RT-PCR to detect foot-and-mouth disease virus in tissue and food samples.

Three sets of primers to detect foot-and-mouth disease virus (FMDV) using multiplex RT-PCR were designed based on several reference nucleotide sequences, and their reaction conditions were determined. By testing ten-fold serial dilutions of FMDV, the sensitivity of multiplex RT-PCR is 100 times higher than conventional RT-PCR. Meanwhile, its specificity was confirmed compared with other related vesicular disease viruses. Furthermore, 30 field samples from different animals were tested, and the results supported the method's potential applications in routine veterinary quarantine and epidemic surveillance of FMDV.

The complete genome sequence of foot-and-mouth disease virus O/Akesu/58 strain and its some molecular characteristics.

The complete genome of O/Akesu/58 strain of foot-and-mouth disease virus (FMDV) was sequenced. The phylogenetic analysis revealed that it is not closely related to epidemic strains or previous strains compared with reference sequences (the identities of complete VP1 nucleotide sequences range from 77.5 to 84.0%). Its cell-receptor-binding site is a SGD (Ser-Gly-Asp) motif instead of RGD (Arg-Gly-Asp), and 43 bases were deleted in PKs region of the 5'UTR, although deletions were not found in other gene regions.

Comparisons of the complete genomes of two Chinese isolates of a recent foot-and-mouth disease type Asia 1 virus.

China reported the first outbreak of foot-and-mouth disease (FMD) serotype Asia 1 in Chinese Hong Kong in March, 2005. Subsequently, this type of the virus was reported from mainland of China in April 2005. Up to September of 2006, it was detected in more than 15 areas of China. In this paper, the complete genomes of two Chinese isolates, Asia 1/HNK/CHA/05 and Asia 1/JS/CHA/05, of foot-and-mouth disease virus (FMDV) were sequenced and compared with some Chinese sequences and reference sequences from other countries. The identities between Asia 1/HNK/CHA/05 and Asia 1/JS/CHA/05 of 5'-UTR, L gene, P1 (VP1) gene, P2 gene, P3 gene, 3'-UTR are 84.8, 87.6, 86.4 (82.3%), 92.5, 92.8 and 95.3%, respectively. The data revealed that these two strains do not belong to the same genotype depending on the analysis of VP1 sequences, and neither of them have deleted bases in 5'UTR and 3A genes compared with the reference sequences. In addition, the secondary structures of their 5'UTR and 3'UTR are discussed.