RESUMEN
Fusarium wilt caused by Fusarium oxysporum f. sp. cubense (Foc), is the most lethal soil-borne fungal pathogen infecting bananas. Foc race 1 (R1) and 4 (R4) are the two most predominant races affecting the economically important Cavendish group of bananas in India. A total of seven vegetative compatibility groups (VCGs) from three pathogenic races were isolated during our field survey and were found to be highly virulent towards cv. Grande Naine. According to comparative genome analyses, these Indian Foc VCGs were diverse in genomic organization and effector gene profiles. As a result, false-positive results were obtained with currently available molecular markers. In this context, the study has been initiated to develop PCR-based molecular markers for the unambiguous identification of Indian Foc R1 and R4 isolates. Whole-genome sequences of Foc R1 (GCA_011316005.3), Foc TR4 (GCA_014282265.3), and Foc STR4 (GCA_016802205.1), as well as the reference genomes of Foc (ASM799451v1) and F. oxysporum f. sp. lycopersici (Fol; ASM14995v2), were aligned to identify unique variable regions among the Foc races. Using putative chromosome and predicted gene comparison, race-specific unique Foc virulence genes were identified. The putative lineage-specific identified genes encoding products secreted in xylem (SIX) that may be necessary for disease development in the banana. An in silico analysis was performed and primers were designed from a region where sequences were dissimilar with other races to develop a specific marker for Foc R1, R4, TR4, and STR4. These race-specific markers allowed target amplification in the characterized highly virulent Foc isolates, and did not show any cross-amplification to any other Foc races, VCGs or banana pathogens, Fusarium species, and non-pathogenic Fusarium oxysporum isolates. The study demonstrated that the molecular markers developed for all the three Foc races of India could detect the pathogen in planta and up to 0.025 pg µL-1 DNA levels. Thus, the markers developed in this study are novel and could potentially be useful for the accurate diagnosis and detection of the Indian Foc races which are important for the effective management of the disease.
RESUMEN
Fusarium wilt is caused by the fungus Fusarium oxysporum f. sp. cubense (Foc) and is the most serious disease affecting bananas (Musa spp.). The fungus is classified into Foc race 1 (R1), Foc race 2, and Foc race 4 based on host specificity. As the rate of spread and the ranges of the devastation of the Foc races exceed the centre of the banana's origin, even in non-targeted cultivars, there is a possibility of variation in virulence-associated genes. Therefore, the present study investigates the genome assembly of Foc races that infect the Cavendish (AAA) banana group in India, specifically those of the vegetative compatibility group (VCG) 0124 (race 1), 0120 (subtropical race 4), and 01213/16 (tropical race 4). While comparing the general features of the genome sequences (e.g., RNAs, GO, SNPs, and InDels), the study also looked at transposable elements, phylogenetic relationships, and virulence-associated effector genes, and sought insights into race-specific molecular mechanisms of infection based on the presence of unique genes. The results of the analyses revealed variations in the organisation of genome assembly and virulence-associated genes, specifically secreted in xylem (SIX) genes, when compared to their respective reference genomes. The findings contributed to a better understanding of Indian Foc genomes, which will aid in the development of effective Fusarium wilt management techniques for various Foc VCGs in India and beyond.
RESUMEN
Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.
RESUMEN
PURPOSE: Correlation of body mass index (BMI) with clinical outcome in patients with glioblastoma is not well documented. Hence, we studied the association between survival and pretreatment BMI in glioblastoma patients. METHODS AND MATERIALS: In this retrospective study, only patients with histopathology-confirmed glioblastoma were included. Their BMIs were calculated from height and weight measurements and recorded in medical records at their first examination. Treatment plans for all patients consisted of concurrent radiation therapy and temozolomide, followed by maintenance therapy with temozolomide. The primary endpoint was overall survival (OS). Univariate and multivariate Cox proportional hazards models were used to estimate the mortality risk associated with BMI as a continuous and categorical variable. A BMI of 18.5 to 24.9 kg/m2 was classified as normal, 25.0 to 29.9 kg/m2 as overweight, and ≥30.0 kg/m2 as obese. RESULTS: Data from 392 patients treated from January 2008 through June 2016 were analyzed. At a median follow-up of 48.6 months, the median OS was 13.5 months in normal subjects, 15.4 months in overweight subjects, and 15.1 months in obese subjects. A total of 81% of the patients died. The hazard ratios for overweight and obese patients were 0.70 (95% confidence interval, 0.54-0.92; P = .009) and 0.66 (95% confidence interval, 0.45-0.98; P = .04), respectively, when adjusted for age, Karnofsky performance score, and extent of resection. Sex, diabetes, and hypertension had no significant interactions. CONCLUSIONS: Patients with elevated BMIs had significantly better OS in our series of patients. The mechanism of this interaction needs to be explored further to understand this association.
