Lower Gluteal Liposuction Combined With Upper Gluteal and Infragluteal Region Fat Grafting: A Novel Concept to Improve Gluteal Ptosis.

BACKGROUND: Gluteal ptosis results in a severe disturbance of gluteal aesthetics. Currently, satisfactory procedures for improving gluteal ptosis are lacking. OBJECTIVES: To improve gluteal ptosis, the authors propose a novel concept of combined liposuction of the lower gluteal region and fat grafting to the upper gluteal and infragluteal regions, and verify its efficacy and safety. METHODS: Patients who underwent liposuction of the lower gluteal region combined with fat grafting to the upper gluteal and infragluteal regions between January 2020 and July 2023 were retrospectively reviewed. Postoperative changes in the gluteal ptosis grade, complications, and patient satisfaction were evaluated. RESULTS: A total of 28 patients were enrolled in this study; 21 (75.0%) patients had gluteal ptosis grade 4 and 7 (25.0%) patients had gluteal ptosis grade 5. The median fat removal volume was 210 mL, and the median fat graft injected volume was 355 mL in the gluteal region and 180 mL in the infragluteal region. All patients showed improvement in gluteal ptosis; 16 (57.1%) patients improved by 1 grade and 12 (42.9%) patients showed a 2-grade improvement. All patients were satisfied with their posttreatment outcomes. Only 1 patient showed lateral translocation of the fat graft. No other complications were observed. CONCLUSIONS: Liposuction of the lower gluteal region combined with fat grafting to the upper gluteal and infragluteal regions is effective in improving gluteal ptosis, with a low risk of complications and high patient satisfaction.

A novel comprehensive strategy for high-thoroughly studying released compounds during the combustion process of herbs. A case study for Artemisia argyi Levl. et Vant.

The comprehensive study of compound variations in released smoke during the combustion process is a great challenge in many scientific fields related to analytical chemistry like traditional Chinese medicine, environment analysis, food analysis, etc. In this work, we propose a new comprehensive strategy for efficiently and high-thoroughly characterizing compounds in the online released complex smokes: (i) A smoke capture device was designed for efficiently collecting chemical constituents to perform gas chromatography-mass spectrometry (GC-MS) based untargeted analysis. (ii) An advanced data analysis tool, AntDAS-GCMS, was used for automatically extracting compounds in the original acquired GC-MS data files. Additionally, a GC-MS data analysis guided instrumental parameter optimizing strategy was proposed for the optimization of parameters in the smoke capture device. The developed strategy was demonstrated by the study of compound variations in the smoke of traditional Chinese medicine, Artemisia argyi Levl. et Vant. The results indicated that more than 590 components showed significant differences among released smokes of various moxa velvet ratios. Finally, about 88 compounds were identified, of which phenolic compounds were the most abundant, followed by aromatics, alkenes, alcohols and furans. In conclusion, we may provide a novel approach to the studies of compounds in online released smoke.

Prediction of recurrence-related factors for patients with early-stage cervical cancer following radical hysterectomy and adjuvant radiotherapy.

OBJECTIVE: To analyze recurrent factors in patients with clinical early-stage cervical cancer (ESCC) following hysterectomy and adjuvant radiotherapy. METHODS: We collected data from patients with ESCC, staged according to the 2009 Federation International of Gynecology and Obstetrics (FIGO) staging criteria, who underwent hysterectomy followed by adjuvant radiotherapy between 2012 and 2019. These patients were subsequently restaged using the 2018 FIGO criteria. Univariable and multivariable analyses, along with nomogram analyses, were conducted to explore factors associated with recurrence-free survival (RFS). RESULTS: A total of 310 patients met the inclusion criteria, with a median follow-up time of 46 months. Among them, 126 patients with ESCC were restaged to stage III C1 or III C2 after surgery due to lymph node metastasis (LNM) based on the 2018 FIGO staging criteria. Of these, 60 (19.3%) experienced relapse. The 1-, 3-, and 5-year RFS rates were 93.9%, 82.7%, and 79.3%, respectively. Multivariate analysis revealed that the number of positive lymph nodes (LNs), tumor diameter (TD) > 4 cm, and parametrial invasion (PI) were associated with recurrence. The nomogram indicated their predictive value for 3-year and 5-year RFS. Notably, the 5-year recurrence rate (RR) increased by 30.2% in patients with LNM, particularly those with ≥ 3 positive LNs (45.5%). Patients with stage III C2 exhibited a significantly higher RR than those with IIIC1 (56.5% vs. 24.3%, p < 0.001). The 5-year RFS for patients with TD > 4 cm was 65.8%, significantly lower than for those with TD ≤ 4 cm (88.2%). Subgroup analysis revealed higher 5-year RRs in patients with stage III C2 than that in patients with III-C1 (56.5% vs. 24.3%, p < 0.001), demonstrating a significant difference in the RFS survival curve. CONCLUSION: RR in patients with clinical ESCC after hysterectomy followed by adjuvant radiotherapy is correlated with the number of positive LNs, TD > 4 cm, and PI. Emphasis should be placed on the common high-risk factor of LNM association with recurrence after radical hysterectomy in ESCC.

On-Tissue Spatial Proteomics Integrating MALDI-MS Imaging with Shotgun Proteomics Reveals Soy Consumption-Induced Protein Changes in a Fragile X Syndrome Mouse Model.

Fragile X syndrome (FXS), the leading cause of inherited intellectual disability and autism, is caused by the transcriptional silencing of the FMR1 gene, which encodes the fragile X messenger ribonucleoprotein (FMRP). FMRP interacts with numerous brain mRNAs that are involved in synaptic plasticity and implicated in autism spectrum disorders. Our published studies indicate that single-source, soy-based diets are associated with increased seizures and autism. Thus, there is an acute need for an unbiased protein marker identification in FXS in response to soy consumption. Herein, we present a spatial proteomics approach integrating mass spectrometry imaging with label-free proteomics in the FXS mouse model to map the spatial distribution and quantify levels of proteins in the hippocampus and hypothalamus brain regions. In total, 1250 unique peptides were spatially resolved, demonstrating the diverse array of peptidomes present in the tissue slices and the broad coverage of the strategy. A group of proteins that are known to be involved in glycolysis, synaptic transmission, and coexpression network analysis suggest a significant association between soy proteins and metabolic and synaptic processes in the Fmr1KO brain. Ultimately, this spatial proteomics work represents a crucial step toward identifying potential candidate protein markers and novel therapeutic targets for FXS.

[Effects of Combined Pollution of Microplastics and Lead on Maize Seed Germination and Growth].

Microplastics are a new contaminant that are causing worldwide concern. However, an understanding of their impact on agricultural seed germination remains inadequate. To investigate the effects of combined microplastic and heavy metal contamination on crop seed germination and growth, the effects of exposure to different single and combined concentrations of lead (Pb) and three microplastics[polyethylene (PE), polypropylene (PP), and polyvinyl chloride (PVC)] on maize seed germination and growth were investigated using maize seeds. The results showed that:the inhibition of maize seed germination by Pb single exposure generally increased with Pb concentration. Compared with that in CK, 500, 1000, and 1500 mg·L-1 PE exposure significantly inhibited maize seed germination, but 100 and 300 mg·L-1 exposure had no significant effect (except at d 5). All PP concentration exposures significantly inhibited maize seed germination, with higher concentrations resulting in stronger inhibition. Compared to that under PP and PE exposure, PVC single exposure inhibited maize germination less, and 500, 1000, and 1500 mg·L-1 exposures produced a facilitative effect at the later stages of germination. The germination index, germination potential, and vigor index of maize seeds decreased with the increase in the single exposure concentration of lead and three types of microplastics, significantly decreased compared with that of CK under the combined exposure of Pb and PE, and did not change significantly under the combined exposure of PP and Pb or PVC and Pb. Among the three types of microplastics, PVC had the least effect on corn seed vigor. Both single exposures of 10 mg·L-1Pb and 100 mg·L-1 of the three microplastics promoted maize stalk and root growth, whereas other concentrations showed mostly inhibitory effects. When the PE concentration was 500 mg·L-1, the 10 and 20 mg·L-1Pb exposures both promoted maize seed stalk and root growth; however, the combined PP and Pb exposures did not produce significant inhibition, whereas 500 mg·L-1PVC and 10 mg·L-1Pb showed the strongest inhibition of maize stalk and root growth under combined PVC and Pb exposures. The effects of combined exposure to microplastics and Pb on the germination and growth of maize seeds were essentially antagonistic, thus slowing down the toxic effects of their respective single exposures on maize seeds.

[Distribution Characteristics and Risk Assessment of Microplastics in Farmland Soil in Guyuan].

The farmland ecosystem faces the emerging risk of microplastic pollution. To investigate the distribution characteristics of microplastics in agricultural soils in Guyuan City, the abundance, type, color, size, and shape of microplastics in Guyuan City agricultural soils were analyzed using field survey, microscopic observation, and Fourier transform infrared spectroscopy. In addition, the risk of microplastic pollution was assessed using the pollution load index method (PLI). The results showed that the microplastic abundance of agricultural soils (0-20 cm) in Guyuan City ranged from 186.32 to 1286.24 n·kg-1, and the microplastic abundance of soils in facility agriculture increased significantly by 35.56% and 228.91% compared with those in non-facility agriculture with and without film, respectively, and the microplastic abundance in the arable layer was 0.31 times higher than that in the plough pan layer. PE (26.42% to 62.83%) and PP (27.64% to 42.62%) were the main microplastic polymer types, and the number of soil polymer species was significantly greater in facility agriculture than that in non-facility agriculture. Microplastics <100 µm accounted for 32.21%-42.52%, whereas >1000 µm accounted for only 0.28%-12.31%. The particle size of microplastics in the arable layer was 47.39% higher than that in the plough pan layer, and the particle size of microplastics was the largest in facility agriculture and the smallest in non-facility film-free planting. Microplastics were mostly in the form of films, fibers, fragments, and microbeads, with the greatest abundance in the form of fibers and the second largest in the form of films. A total of seven colors of microplastics were monitored, mainly white and black. The overall risk of contamination in the study area was low, and the highest risk of microplastic contamination was found in the soil of facility agriculture. The results of the study will provide data reference for the assessment of microplastic contamination in agricultural soils and microplastic soil environmental behavior in China.

Arginase from Priestia megaterium and the Effects of CMCS Conjugation on Its Enzymological Properties.

Arginase has shown promising potential in treating cancers by arginine deprivation therapy; however, low enzymatic activity and stability of arginase are impeding its development. This study was aimed to improve the enzymological properties of a marine bacterial arginase by carboxymethyl chitosan (CMCS) conjugation. An arginase producing marine bacterium Priestia megaterium strain P6 was isolated and identified. The novel arginase PMA from the strain was heterologously expressed, purified, and then conjugated to CMCS by ionic gelation with calcium chloride as the crosslinking agent. Enzymological properties of both PMA and CMCS-PMA conjugate were determined. The optimum temperature for PMA and CMCS-PMA at pH 7 were 60 °C and 55 °C, respectively. The optimum pH for PMA and CMCS-PMA at 37 °C were pH 10 and 9, respectively. CMCS-PMA showed higher thermostability than PMA over 55-70 °C and higher pH stability over pH 4-11 with the highest pH stability at pH 7. At 37 °C and pH of 7, i.e., around the human blood temperature and pH, CMCS-PMA was higher than the free PMA in enzymatic activity and stability by 24% and 21%, respectively. CMCS conjugation not only changed the optimum temperature, optimum pH, and enzymatic activity of PMA, but also improved its pH stability and temperature stability, and thus made it more favorable for medical application.

Formin-related protein 1 facilitates proliferation and aggressive phenotype of clear cell renal cell carcinoma through MAPK/MMP2 pathway.

BACKGROUND: Formin-related protein-1(FRL1) has reportedly been overexpressed in a variety of malignancies, such as clear cell renal cell carcinoma (ccRCC). However, the clinical value and molecular mechanisms underlying ccRCC tumorigenesis and progression in association with FRL1 remain poorly understood. METHODS: Immunohistochemical analysis was performed on 119 paraffin-embedded RCC tissue samples to detect FRL1 expression and analyze its prognostic value. Colony formation, the CCK-8 assay, flow cytometry, and in vivo nude mice subcutaneous experiments were used to identify the effects of FRL1 on growth and proliferation. In vitro tests for wound healing, migration, and invasion were used to assess the involvement of FRL1 in invasion and metastatic potential. The process of epithelial-mesenchymal transition process (EMT) and the MMP2 expression were detected in stably transfected RCC cells via western blotting, as well as in tumor tissue paraffin sections from xenograft model. RESULTS: Both FRL1 mRNA and protein levels were noticeably elevated in ccRCC cell lines and samples. Aberrant overexpression of FRL1 was associated with unfavorable clinicopathological features of ccRCC and indicated poor prognosis. Ectopic overexpression of FRL1 increased the growth-promoting traits of ccRCC cells as well as the migratory and invasive capacity of RCC cells, whereas FRL1-silencing caused the opposite results. In addition, FRL1 promoted epithelial-mesenchymal transition (EMT) and upregulated the expression of matrix metalloproteinase 2 (MMP2). Finally, overexpression of FRL1 upregulated phosphorylation level of ERK1/2 with no effect on total level of ERK1/2 in the RCC cells. MAPK/ERK inhibitor reversed the promotional effects of FRL1. CONCLUSION: FRL1 was overexpressed in ccRCC tissues and predicted poor prognosis. FRL1 contributes to invasion and aggressive phenotype of ccRCC by facilitating EMT through MAPK/MMP2 axis.

Identification of Oak-Barrel and Stainless Steel Tanks with Oak Chips Aged Wines in Ningxia Based on Three-Dimensional Fluorescence Spectroscopy Combined with Chemometrics.

With the increased incidence of wine fraud, a fast and reliable method for wine certification has become a necessary prerequisite for the vigorous development of the global wine industry. In this study, a classification strategy based on three-dimensional fluorescence spectroscopy combined with chemometrics was proposed for oak-barrel and stainless steel tanks with oak chips aged wines. Principal component analysis (PCA), partial least squares analysis (PLS-DA), and Fisher discriminant analysis (FDA) were used to distinguish and evaluate the data matrix of the three-dimensional fluorescence spectra of wines. The results showed that FDA was superior to PCA and PLS-DA in classifying oak-barrel and stainless steel tanks with oak chips aged wines. As a general conclusion, three-dimensional fluorescence spectroscopy can provide valuable fingerprint information for the identification of oak-barrel and stainless steel tanks with oak chips aged wines, while the study will provide some theoretical references and standards for the quality control and quality assessment of oak-barrel aged wines.

Pyroptosis and its role in cancer.

Programmed cell death (PCD) is mediated by specific genes that encode signals. It can balance cell survival and death. Pyroptosis is a type of inflammatory, caspase-dependent PCD mediated by gasdermin proteins, which function in pore formation, cell expansion, and plasma membrane rupture, followed by the release of intracellular contents. Pyroptosis is mediated by caspase-1/3/4/5/11 and is primarily divided into the classical pathway, which is dependent on caspase-1, and the non-classical pathway, which is dependent on caspase-4/5/11. Inflammasomes play a vital role in these processes. The various components of the pyroptosis pathway are related to the occurrence, invasion, and metastasis of tumors. Research on pyroptosis has revealed new options for tumor treatment. This article summarizes the recent research progress on the molecular mechanism of pyroptosis, the relationship between the various components of the pyroptosis pathway and cancer, and the applications and prospects of pyroptosis in anticancer therapy.

First Report of Meloidogyne arenaria Infecting Maize in Guizhou Province of China.

Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rar：TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1，MZ555753.1, U42342.1）were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.

The Synergistic Effects between Sulfobetaine and Hydrophobically Modified Polyacrylamide on Properties Related to Enhanced Oil Recovery.

In order to explore the mechanism responsible for the interactions in the surfactant-polymer composite flooding and broaden the application range of the binary system in heterogeneous oil reservoirs, in this paper, the influences of different surfactants on the viscosity of two polymers with similar molecular weights, partially hydrolyzed polyacrylamide (HPAM) and hydrophobically modified polyacrylamide (HMPAM), were studied at different reservoir environments. In addition, the relationship between the surfactant-polymer synergistic effects and oil displacement efficiency was also investigated. The experimental results show that for HPAM, surfactants mainly act as an electrolyte to reduce its viscosity. For HMPAM, SDBS and TX-100 will form aggregates with the hydrophobic blocks of polymer molecules, reducing the bulk viscosity. However, zwitterionic surfactant aralkyl substituted alkyl sulfobetaine BSB molecules can build "bridges" between different polymer molecules through hydrogen bonding and electrostatic interaction. After forming aggregates with HMPAM molecules, the viscosity will increase. The presence of two polymers all weakened the surfactant oil-water interfacial membrane strength to a certain extent, but had little effect on the interfacial tension. The synergistic effect of the "bridge" between HMPAM and BSB under macroscopic conditions also occurs in the microscopic pores of the core, which has a beneficial effect on improving oil recovery.

Dynamic Interfacial Tensions of Surfactant and Polymer Solutions Related to High-Temperature and High-Salinity Reservoir.

Betaine is a new surfactant with good application prospects in high-temperature and high-salinity reservoirs. The interfacial properties of two kinds of betaine mixtures with a good synergistic effect were evaluated in this paper. On this basis, the effects of temperature-resistant, salt-resistant polymers with different contents of 2-acrylamide-2-methylpropanesulfonic acid (AMPS) on dynamic interfacial tensions (IFTs) against n-alkanes and crude oil were studied. The experimental results show that the IFTs between betaine ASB and n-alkanes can be reduced to ultra-low values by compounding with anionic surfactant petroleum sulfonate (PS) and extended anionic surfactant alkoxyethylene carboxylate (AEC), respectively. ASB@AEC is very oil-soluble with nmin value ≥14, and ASB@PS is relatively water-soluble with nmin value of 10. The water solubility of both ASB@PS and ASB@AEC is enhanced by the addition of water-soluble polymers. The HLB of the ASB@AEC solution becomes better against crude oil after the addition of polymers, and the IFT decreases to an ultra-low value as a result. On the contrary, the antagonistic effect in reducing the IFT can be observed for ASB@PS in the same case. In a word, polymers affect the IFTs of surfactant solutions by regulating the HLB.

Efficacy and Safety of Perioral Mound Region Liposuction-A Novel Concept to Improve Perioral Mound Fullness.

BACKGROUND: Fullness of the perioral mound is considered a dissatisfying aspect of premature aging and has become a common complaint of patients seeking facial rejuvenation. OBJECTIVES: The authors propose a novel concept of improving perioral mound fullness by liposuction and verify its safety and efficacy through cadaver and clinical studies. METHODS: A cadaver study was conducted to discover the soft tissue structure of the perioral mound region and identify a vital use for liposuction. For clinical evaluation, 37 patients with perioral mound fullness who underwent liposuction were retrospectively reviewed. RESULTS: The cadaver study results showed moderate fatty tissue in the subcutaneous layer of the perioral mound region. The liposuction manipulation was limited to the subcutaneous fat layer. Among the 37 patients (including 74 perioral mound regions), the median fat removal volume per perioral mound region was 2.0 (1.2, 2.3) mL. After liposuction, the subcutaneous fat thickness significantly decreased (median 5.0 [3.9, 6.6] mm vs 0.7 [0.4, 1.0] mm per perioral mound region, P < .001). All patients were satisfied with their posttreatment outcomes. Two patients (5.4%) had slight skin hyperpigmentation in the liposuction area after treatment and recovered naturally in 3 months without any intervention. No other complications were noted. CONCLUSIONS: Liposuction is effective in improving perioral mound fullness with a low risk of complications.

Mesenchymal stem cells in fibrotic diseases-the two sides of the same coin.

Fibrosis is caused by extensive deposition of extracellular matrix (ECM) components, which play a crucial role in injury repair. Fibrosis attributes to ~45% of all deaths worldwide. The molecular pathology of different fibrotic diseases varies, and a number of bioactive factors are involved in the pathogenic process. Mesenchymal stem cells (MSCs) are a type of multipotent stem cells that have promising therapeutic effects in the treatment of different diseases. Current updates of fibrotic pathogenesis reveal that residential MSCs may differentiate into myofibroblasts which lead to the fibrosis development. However, preclinical and clinical trials with autologous or allogeneic MSCs infusion demonstrate that MSCs can relieve the fibrotic diseases by modulating inflammation, regenerating damaged tissues, remodeling the ECMs, and modulating the death of stressed cells after implantation. A variety of animal models were developed to study the mechanisms behind different fibrotic tissues and test the preclinical efficacy of MSC therapy in these diseases. Furthermore, MSCs have been used for treating liver cirrhosis and pulmonary fibrosis patients in several clinical trials, leading to satisfactory clinical efficacy without severe adverse events. This review discusses the two opposite roles of residential MSCs and external MSCs in fibrotic diseases, and summarizes the current perspective of therapeutic mechanism of MSCs in fibrosis, through both laboratory study and clinical trials.

[Modernization of Chinese medicine Salviae Miltiorrhizae Radix et Rhizoma: a review].

Modernization of Chinese medicine is an important development direction of traditional Chinese medical sciences. It is of great significance to understand the mechanism of Chinese medicine with basic research, which can also accelerate the development and utilization of Chinese medicine. Salviae Miltiorrhizae Radix et Rhizoma is one of the most commonly used Chinese medicines in China for the prevention and treatment of cardiovascular and cerebrovascular diseases. It has received key and extensive attention worldwide in the following aspects: main active ingredients and their pharmacological mechanism, function and regulation of their biosynthetic pathway and application of their synthetic biology as well as the clinical preparations. The new and developing chemical analysis, network pharmacology, molecular pharmacognosy and omics make the modernization research of Salviae Miltiorrhizae Radix et Rhizoma comprehensive and in-depth. This study systematically reviewed the modernization research of Salviae Miltiorrhizae Radix et Rhizoma, which focused on its pharmacological effects, preparation research, biosynthesis and regulation mechanism of the active ingredients, and expected to exert the model role of Salviae Miltiorrhizae Radix et Rhizoma in the research of Chinese medicine.

Insights into enhanced removal of Cd2+ from aqueous solutions by attapulgite supported sulfide-modified nanoscale zero-valent iron.

The sulfidation of nanoscale zerovalent iron (nZVI) has received increasing attention for reducing the oxidizability of nZVI and improving its reactivity toward heavy metal ions. Here, a sulfide (S)-modified attapulgite (ATP)-supported nanoscale nZVI composite (S-nZVI@ATP) was rapidly synthesized under acidic conditions and used to alleviate Cd2+ toxicity from an aqueous solution. The degree of oxidation of S-nZVI@ATP was less than that of nZVI@ATP, indicating that the sulfide modification significantly reduced the oxidation of nZVI. The optimal loading ratio was at an S-to-Fe molar ratio of 0.75, and the adsorption performance of S-nZVI@ATP for Cd2+ was significantly improved compared with that of nZVI@ATP. The removal of Cd2+ by S-nZVI@ATP was 100% when the adsorbent addition was 1 g/L, the solution was 30 mL, and the adsorption was performed at 25 °C for 24 h with an initial Cd2+ concentration of 100 mg/L. Kinetics studies showed that the adsorption process of Cd followed the pseudo-second-order model, indicating that chemisorption was the dominant adsorption mechanism. The adsorption of Cd2+ by S-nZVI @ATP is dominated by the complexation between the iron oxide or iron hydroxide shell of S-nZVI and Cd2+ and the formation of Cd(OH)2 and CdS precipitates.

Red meat consumption and risk for dyslipidaemia and inflammation: A systematic review and meta-analysis.

Aim: The study (PROSPERO: CRD42021240905) aims to reveal the relationships among red meat, serum lipids and inflammatory biomarkers. Methods and results: PubMed, EMBASE and the Cochrane databases were explored through December 2021 to identify 574 studies about red meat and serum lipids markers including total cholesterol (TC), triglyceride (TG), low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), C-reactive protein (CRP) or hypersensitive-CRP (hs-CRP). Finally, 20 randomized controlled trials (RCTs) involving 1001 people were included, red meat and serum lipid markers and their relevant information was extracted. The pooled standard mean difference (SMD) was obtained by applying a random-effects model, and subgroup analyses and meta-regression were employed to explain the heterogeneity. Compared with white meat or grain diets, the gross results showed that the consumption of red meat increased serum lipid concentrations like TG (0.29 mmol/L, 95% CI 0.14, 0.44,P<0.001), but did not significantly influence the TC (0.13 mmol/L, 95% CI -0.07, 0.33, P = 0.21), LDL-C (0.11 mmol/L, 95% CI -0.23, 0.45, P = 0.53), HDL-C (-0.07 mmol/L, 95% CI -0.31, 0.17, P = 0.57),CRP or hs-CRP (0.13 mmol/L, 95% CI -0.10, 0.37,P = 0.273). Conclusion: Our study provided evidence to the fact that red meat consumption affected serum lipids levels like TG, but almost had no effect on TC, LDL-C, HDL-C and CRP or hs-CRP. Such diets with red meat should be taken seriously to avoid the problem of high lipid profiles. Systematic review registration: [https://www.crd.york.ac.uk/PROSPERO], identifier [CRD42021240905].

Identification of stemness index-related long noncoding RNA SNHG12 in human bladder cancer based on WGCNA.

BACKGROUND: Cancer stem cells (CSCs) have an key role in the beginning, progression and treatment of bladder cancer. In the current study, our target was to identify CSCS-related genes in bladder cancer. METHODS: Bladder cancer (BLCA) transcriptome data were acquired from The Cancer Genome Atlas (TCGA) database. WGCNA was used to screen genes connected with the mRNA expression-based stemness index (mRNAsi).Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were used to analyze the biological function of mRNAsi-related genes. Univariate Cox regression and LASSO Cox regression algorithms were applied to build a risk score model. Additionally, a ceRNA regulatory netwok based on key mRNAsi-related genes was established via TargetScan, miRDB, miRTarBas and miRcode database,and lncRNA SNHG12 was selected for further in vitro and invivo functional assays. RESULTS: Between BLCA and normal samples were identified 1560 differentially expressed genes (DEGs).845 DEGs were most significantly associated with mRNAsi according to WGCNA analysis, which were mainly enriched in GO terms and KEGG pathways related to cell proliferation. Univariate Cox regression and LASSO Cox regression algorithms screened 25 mRNAsi-related genes to construct the risk score model with the significant ability to estimate prognosis of BLCA patients. A ceRNA network, including 8 lncRNA, 11 miRNA and 9 mRNAsi-related mRNA, was constructed.We found that lncRNAs ADAMTS9-AS1 and SNHG12 were observably related to the survival of BLCA patients. To verify this finding, we selected SNHG12 for further study. RT-PCR experiments revealed that SNHG12 was high expression in both bladder cancer tissues and cells.SNHG12 promoted proliferation, invasion, migration, apoptosis and stemness of bladder cancer cells in vitro and tumour proliferation in vivo. CONCLUSION: Our study identified 25 biomarkers associated with stemness indices in BLCA and established a ceRNA network based on key mRNAsi-related genes.SNHG12 promoted BLCA proliferation, invasion, migration, apoptosis and stemness in vitro. It was also showed that SNHG12 promoted tumour growth.

High expression of eIF4A1 predicts unfavorable prognosis in clear cell renal cell carcinoma.

BACKGROUND: Clear cell renal cell carcinoma (ccRCC) is a worldwide malignancy with high morbidity and mortality. Translation initiation factor 4A1 (eIF4A1), which is an ATP-dependent RNA helicase as a part of eIF4F complex, has been linked to malignant transformation and progression, and a variety of cancers display dysregulation of this enzyme. However, its role in ccRCC remains unclear. In our study, we examined its potential effects in ccRCC. METHODS: Based on Proteomic data, TCGA and ONCOMINE database, RCC cell lines and tissues, the expression of eIF4A1 between ccRCC and normal tissues were investigated. A correlation was evaluated between the prognostic model for OS and ccRCC progression. Analysis of functional enrichment and PPI network were performed. After examining differentially expressed genes between the eIF4A1 high and low-expression groups, we performed GSEA analysis. Furthermore, we investigated immune cell infiltration of eIF4A1. Then we determined eIF4A1 functions in the establishment and maintenance of cell viability, migration and invasion of cell lines. Flow cytometry was utilized to detect cell cycle. RESULTS: The eIF4A1 was up-regulated in ccRCC tissues and cell lines. An increased level of eIF4A1 was linked to lower survival rates and impaired immunity. Depletion of eIF4A1 could arrest tumor cells in G1 phase, so as to seriously limit cell proliferation and weaken the capacity of cell migration. CONCLUSION: ccRCC patients with high eIF4A1 expression are at increased risk of poor prognosis, furthermore eIF4A1 plays a prominent role in facilitating tumor cell proliferation and migration which may further be a potential prognostic biomarker and therapeutic target.