RESUMEN
Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.
RESUMEN
Negevirus is a recently proposed taxon of arthropod-infecting virus, which is associated with plant viruses of two families (Virgaviridae and Kitaviridae). Nevertheless, the evolutionary history of negevirus-host and its relationship with plant viruses remain poorly understood. Endogenous nege-like viral elements (ENVEs) are ancient nege-like viral sequences integrated into the arthropod genomes, which can serve as the molecular fossil records of previous viral infection. In this study, 292 ENVEs were identified in 150 published arthropod genomes, revealing the evolutionary history of nege-like viruses and two related plant virus families. We discovered three novel and eight strains of nege-like viruses in 11 aphid species. Further analysis indicated that 10 ENVEs were detected in six aphid genomes, and they were divided into four types (ENVE1-ENVE4). Orthologous integration and phylogenetic analyses revealed that nege-like viruses had a history of infection of over 60 My and coexisted with aphid ancestors throughout the Cenozoic Era. Moreover, two nege-like viral proteins (CP and SP24) were highly homologous to those of plant viruses in the families Virgaviridae and Kitaviridae. CP- and SP24-derived ENVEs were widely integrated into numerous arthropod genomes. These results demonstrate that nege-like viruses have a long-term coexistence with arthropod hosts and plant viruses of the two families, Virgaviridae and Kitaviridae, which may have evolved from the nege-like virus ancestor through horizontal virus transfer events. These findings broaden our perspective on the history of viral infection in arthropods and the origins of plant viruses. IMPORTANCE: Although negevirus is phylogenetically related to plant virus, the evolutionary history of negevirus-host and its relationship with plant virus remain largely unknown. In this study, we used endogenous nege-like viral elements (ENVEs) as the molecular fossil records to investigate the history of nege-like viral infection in arthropod hosts and the evolution of two related plant virus families (Virgaviridae and Kitaviridae). Our results showed the infection of nege-like viruses for over 60 My during the arthropod evolution. ENVEs highly homologous to viral sequences in Virgaviridae and Kitaviridae were present in a wide range of arthropod genomes but were absent in plant genomes, indicating that plant viruses in these two families possibly evolved from the nege-like virus ancestor through cross-species horizontal virus transmission. Our findings provide a new perspective on the virus-host coevolution and the origins of plant viruses.
RESUMEN
Herbivorous insects harbor a variety of insect-specific viruses (ISVs) some of which are considered to be valuable biological agents for potential applications in biological defense and control strategies. Leaf beetles with chewing mouthparts are particularly known for their capacity to disrupt plant tissue while feeding, often creating openings that can act as entry points for plant pathogens. In this study, we have identified two new negative-sense RNA viruses infecting the leaf beetle Aulacophora indica, an important member of the Chrysomelidae family. These recently discovered viruses belong to the viral families Nyamiviridae and Chuviridae and have been preliminarily named Aulacophora indica nyami-like virus 1 (AINlV1) and Aulacophora indica chu-like virus 1 (AIClV1), respectively. The complete genomic sequences of these viruses were obtained using rapid amplification of cDNA ends (RACE) techniques. Detailed analysis of their genomic structures has confirmed their similarity to other members within their respective families. Furthermore, analysis of virus-derived small interfering RNA (vsiRNA) demonstrated a high abundance and typical vsiRNA pattern of AINlV1 and AIClV1, offering substantial evidence to support their classification as ISVs. This research enhances our understanding of viral diversity within insects.
RESUMEN
Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.
RESUMEN
Agricultural insects play a crucial role in transmitting plant viruses and host a considerable number of insect-specific viruses (ISVs). Among these insects, the white-backed planthoppers (WBPH; Sogatella furcifera, Hemiptera: Delphacidae) are noteworthy rice pests and are responsible for disseminating the southern rice black-streaked dwarf virus (SRBSDV), a significant rice virus. In this study, we analyzed WBPH transcriptome data from public sources and identified three novel viruses. These newly discovered viruses belong to the plant-associated viral family Solemoviridae and were tentatively named Sogatella furcifera solemo-like virus 1-3 (SFSolV1-3). Among them, SFSolV1 exhibited a prevalent existence in different laboratory populations, and its complete genome sequence was obtained using rapid amplification of cDNA ends (RACE) approaches. To investigate the antiviral RNA interference (RNAi) response in WBPH, we conducted an analysis of virus-derived small interfering RNAs (vsiRNAs). The vsiRNAs of SFSolV1 and -2 exhibited typical patterns associated with the host's siRNA-mediated antiviral immunity, with a preference for 21- and 22-nt vsiRNAs derived equally from both the sense and antisense genomic strands. Furthermore, we examined SFSolV1 infection and distribution in WBPH, revealing a significantly higher viral load of SFSolV1 in nymphs' hemolymph compared to other tissues. Additionally, in adult insects, SFSolV1 exhibited higher abundance in male adults than in female adults.
RESUMEN
The brown planthopper (BPH), Nilaparvata lugens, is a significant agricultural pest capable of long-distance migration and transmission of viruses that cause severe disease in rice. In this study, we identified a novel segmented RNA virus in a BPH, and this virus exhibited a close relationship to members of a recently discovered virus lineage known as "quenyaviruses" within the viral kingdom Orthornavirae. This newly identified virus was named "Nilaparvata lugens quenyavirus 1" (NLQV1). NLQV1 consists of five positive-sense, single-stranded RNAs, with each segment containing a single open reading frame (ORF). The genomic characteristics and phylogenetic analysis support the classification of NLQV1 as a novel quenyavirus. Notably, all of the genome segments of NLRV contained the 5'-terminal sequence AUCUG. The characteristic virus-derived small interfering RNA (vsiRNA) profile of NLQV1 suggests that the antiviral RNAi pathway of the host BPH was activated in response to virus infection. These findings represent the first documented report of quenyaviruses in planthoppers, contributing to our understanding of quenyaviruses and expanding our knowledge of insect-specific viruses in planthoppers.
Asunto(s)
Genoma Viral , Hemípteros , Sistemas de Lectura Abierta , Filogenia , Virus ARN , ARN Viral , Animales , Hemípteros/virología , Genoma Viral/genética , ARN Viral/genética , Virus ARN/genética , Virus ARN/clasificación , Virus ARN/aislamiento & purificación , Enfermedades de las Plantas/virología , Oryza/virología , Secuenciación Completa del Genoma , ARN Interferente Pequeño/genéticaRESUMEN
A negative-strand symbiotic RNA virus, tentatively named Nilaparvata lugens Bunyavirus (NLBV), was identified in the brown planthopper (BPH, Nilaparvata lugens). Phylogenetic analysis indicated that NLBV is a member of the genus Mobuvirus (family Phenuiviridae, order Bunyavirales). Analysis of virus-derived small interfering RNA suggested that antiviral immunity of BPH was successfully activated by NLBV infection. Tissue-specific investigation showed that NLBV was mainly accumulated in the fat-body of BPH adults. Moreover, NLBV was detected in eggs of viruliferous female BPHs, suggesting the possibility of vertical transmission of NLBV in BPH. Additionally, no significant differences were observed for the biological properties between NLBV-infected and NLBV-free BPHs. Finally, analysis of geographic distribution indicated that NLBV may be prevalent in Southeast Asia. This study provided a comprehensive characterization on the molecular and biological properties of a symbiotic virus in BPH, which will contribute to our understanding of the increasingly discovered RNA viruses in insects.
Asunto(s)
Hemípteros , Orthobunyavirus , Virus ARN , Animales , Femenino , Filogenia , Insectos , Virus ARN/genéticaRESUMEN
Throughout evolution, arboviruses have developed various strategies to counteract the host's innate immune defenses to maintain persistent transmission. Recent studies have shown that, in addition to bacteria and fungi, the innate Toll-Dorsal immune system also plays an essential role in preventing viral infections in invertebrates. However, whether the classical Toll immune pathway is involved in maintaining the homeostatic process to ensure the persistent and propagative transmission of arboviruses in insect vectors remain unclear. In this study, we revealed that the transcription factor Dorsal is actively involved in the antiviral defense of an insect vector (Laodelphax striatellus) by regulating the target gene, zinc finger protein 708 (LsZN708), which mediates downstream immune-related effectors against infection with the plant virus (Rice stripe virus, RSV). In contrast, an antidefense strategy involving the use of the nonstructural-protein (NS4) to antagonize host antiviral defense through competitive binding to Dorsal from the MSK2 kinase was employed by RSV; this competitive binding inhibited Dorsal phosphorylation and reduced the antiviral response of the host insect. Our study revealed the molecular mechanism through which Toll-Dorsal-ZN708 mediates the maintenance of an arbovirus homeostasis in insect vectors. Specifically, ZN708 is a newly documented zinc finger protein targeted by Dorsal that mediates the downstream antiviral response. This study will contribute to our understanding of the successful transmission and spread of arboviruses in plant or invertebrate hosts.
Asunto(s)
Arbovirus , Hemípteros , Oryza , Tenuivirus , Animales , Arbovirus/genética , Hemípteros/fisiología , Tenuivirus/fisiología , Insectos Vectores , Antivirales/metabolismo , Oryza/genética , Enfermedades de las PlantasRESUMEN
Non-retroviral endogenous viral elements (nrEVEs) are widely dispersed throughout the genomes of eukaryotes. Although nrEVEs are known to be involved in host antiviral immunity, it remains an open question whether they can be domesticated as functional proteins to serve cellular innovations in arthropods. In this study, we found that endogenous toti-like viral elements (ToEVEs) are ubiquitously integrated into the genomes of three planthopper species, with highly variable distributions and polymorphism levels in planthopper populations. Three ToEVEs display exonâintron structures and active transcription, suggesting that they might have been domesticated by planthoppers. CRISPR/Cas9 experiments revealed that one ToEVE in Nilaparvata lugens, NlToEVE14, has been co-opted by its host and plays essential roles in planthopper development and fecundity. Large-scale analysis of ToEVEs in arthropod genomes indicated that the number of arthropod nrEVEs is currently underestimated and that they may contribute to the functional diversity of arthropod genes.
Asunto(s)
Artrópodos , Hemípteros , Animales , Artrópodos/genética , Hemípteros/genética , RetroviridaeRESUMEN
Brochosomes, unique coatings on the integuments of Cicadellidae, are synthesized in specialized glandular sections of Malpighian tubules. However, limited knowledge exists regarding the protein composition of brochosomes. In this study, we conducted transcriptomic and proteomic profiling to characterize the brochosome protein composition in the rice green leafhopper Nephotettix cincticeps. Brochosomes were collected from the forewings of leafhoppers using ultrasonic treatment, allowing for more effective brochosome collection and shaking treatment, resulting in purer brochosomes. Transcriptome sequencing analysis identified 106 genes specifically expressed in the Malpighian tubules; combined with proteomic data, we identified 22 candidate brochosome proteins. These proteins were classified into 12 brochosomins (BSM) and 10 brochosome-associated proteins (BSAP) based on previous research. Conserved motif analysis and functional predictions unveiled unique motifs in each BSM, while BSAP appeared to play a crucial role in BSM folding and pathogen resistance. Comparative analysis of other Hemiptera species demonstrated that all BSM and some BSAP are specific to the Cicadellidae family. Our findings could contribute to understanding the mechanism of brochosome synthesis, its function, and evolutionary genesis.
RESUMEN
The leafhopper family Cicadellidae, comprising over 22,000 species, exhibits a unique behavior of anointing their bodies with excretions containing brochosomes. Brochosomes are synthesized in the distal segment of the Malpighian tubules and serve various functions, including hydrophobic protection and defense against pathogens and predators. In this study, we investigated the distribution, synthesis, and release mechanisms of brochosomes in the rice pest leafhopper Maiestas dorsalis. Using SEM and TEM, we observed brochosomes' consistent coverage on the integument throughout the insect's life cycle. Moreover, we identified four distinct developmental stages of brochosome synthesis within the distal segment of the Malpighian tubules, originating from the Golgi region. Most importantly, our research revealed a novel and highly efficient release mechanism involving the fusion of brochosome-containing vesicles, leading to a rapid and substantial release of brochosomes into the tubule lumen after molting. These findings shed light on the intricate processes of brochosome synthesis and release in leafhoppers, offering valuable insights into their functional significance and ecological role in these fascinating insects.
RESUMEN
Many insects rely on ancient symbiotic bacterial associations for essential nutrition. Auchenorrhyncha commonly harbor two obligate symbionts: Sulcia (Bacteroidetes) and a proteobacterial partner that supplies essential amino acids lacking in their plant-sap diets. In this study focusing on Maiestas dorsalis, we investigated the distribution and vertical transmission of two obligate symbiotic bacteria, Sulcia and Nasuia, within the leafhopper. Sulcia primarily inhabits the external region of the bacteriome, while Nasuia is restricted to the internal region. Both symbionts progressively infiltrate the ovary through the epithelial plug, ultimately reaching the developing primary oocyte. Furthermore, co-phylogenetic analysis suggests a close correlation between the evolution of Auchenorrhyncha insects and the presence of their obligate symbiotic bacteria. Genomic analysis further unveiled the extreme genome reduction of the obligate symbiotic bacteria, with Sulcia retaining genes involved in basic cellular processes and limited energy synthesis, while Nasuia exhibited further gene loss in replication, transcription, translation, and energy synthesis. However, both symbionts retained the genes for synthesizing the essential amino acids required by the host insect. Our study highlights the coevolutionary dynamics between Sulcia, proteobacterial partners, and their insect hosts, shedding light on the intricate nutritional interactions and evolutionary adaptations in Auchenorrhyncha insects.
RESUMEN
Fusarium wilt of banana (FWB), caused by Fusarium oxysporum f. sp. cubense (Foc), especially tropical race 4 (TR4), presents the foremost menace to the global banana production. Extensive efforts have been made to search for efficient biological control agents for disease management. Our previous study showed that Streptomyces sp. XY006 exhibited a strong inhibitory activity against several phytopathogenic fungi, including F. oxysporum. Here, the corresponding antifungal metabolites were purified and determined to be two cyclic lipopeptide homologs, lipopeptin A and lipopeptin B. Combined treatment with lipopeptin complex antagonized Foc TR4 by inhibiting mycelial growth and conidial sporulation, suppressing the synthesis of ergosterol and fatty acids and lowering the production of fusaric acid. Electron microscopy observation showed that lipopeptide treatment induced a severe disruption of the plasma membrane, leading to cell leakage. Lipopeptin A displayed a more pronounced antifungal activity against Foc TR4 than lipopeptin B. In pot experiments, strain XY006 successfully colonized banana plantlets and suppressed the incidence of FWB, with a biocontrol efficacy of up to 87.7%. Additionally, XY006 fermentation culture application improved plant growth parameters and induced peroxidase activity in treated plantlets, suggesting a possible role in induced resistance. Our findings highlight the potential of strain XY006 as a biological agent for FWB, and further research is needed to enhance its efficacy and mode of action in planta.
RESUMEN
The Janus kinase-signal transducer and activator of transcription (JAK-STAT) pathway is an evolutionarily conserved signaling pathway that can regulate various biological processes. However, the role of JAK-STAT pathway in the persistent viral infection in insect vectors has rarely been investigated. Here, using a system that comprised two different plant viruses, Rice stripe virus (RSV) and Rice black-streaked dwarf virus (RBSDV), as well as their insect vector small brown planthopper, we elucidated the regulatory mechanism of JAK-STAT pathway in persistent viral infection. Both RSV and RBSDV infection activated the JAK-STAT pathway and promoted the accumulation of suppressor of cytokine signaling 5 (SOCS5), an E3 ubiquitin ligase regulated by the transcription factor STAT5B. Interestingly, the virus-induced SOCS5 directly interacted with the anti-apoptotic B-cell lymphoma-2 (BCL2) to accelerate the BCL2 degradation through the 26S proteasome pathway. As a result, the activation of apoptosis facilitated persistent viral infection in their vector. Furthermore, STAT5B activation promoted virus amplification, whereas STAT5B suppression inhibited apoptosis and reduced virus accumulation. In summary, our results reveal that virus-induced JAK-STAT pathway regulates apoptosis to promote viral infection, and uncover a new regulatory mechanism of the JAK-STAT pathway in the persistent plant virus transmission by arthropod vectors.
Asunto(s)
Tenuivirus , Virosis , Animales , Quinasas Janus/metabolismo , Transducción de Señal , Factores de Transcripción STAT/metabolismo , Tenuivirus/metabolismo , Insectos Vectores , Proteínas Proto-Oncogénicas c-bcl-2/metabolismoRESUMEN
Salivary elicitors secreted by herbivorous insects can be perceived by host plants to trigger plant immunity. However, how insects secrete other salivary components to subsequently attenuate the elicitor-induced plant immunity remains poorly understood. Here, we study the small brown planthopper, Laodelphax striatellus salivary sheath protein LsSP1. Using Y2H, BiFC and LUC assays, we show that LsSP1 is secreted into host plants and binds to salivary sheath via mucin-like protein (LsMLP). Rice plants pre-infested with dsLsSP1-treated L. striatellus are less attractive to L. striatellus nymphs than those pre-infected with dsGFP-treated controls. Transgenic rice plants with LsSP1 overexpression rescue the insect feeding defects caused by a deficiency of LsSP1 secretion, consistent with the potential role of LsSP1 in manipulating plant defenses. Our results illustrate the importance of salivary sheath proteins in mediating the interactions between plants and herbivorous insects.
Asunto(s)
Hemípteros , Oryza , Animales , Oryza/genética , Hemípteros/genética , Herbivoria , Plantas Modificadas Genéticamente , NinfaRESUMEN
Similarly to other potyvirids, the bymovirus wheat yellow mosaic virus (WYMV) encodes a P3N-PIPO protein that is expressed by frameshifting occurring within the open reading frame of the P3 protein. P3N-PIPO is known to be essential for the cell-to-cell movement of several potyviruses, but this has not yet been confirmed for the WYMV. Here, we show that the WYMV P3N-PIPO protein influences disease symptom formation. Infection of Nicotiana benthamiana plants with a potato virus X (PVX)-based vector carrying the WYMV P3N-PIPO gene induced more severe disease symptoms and resulted in higher virus accumulation levels than did infection with PVX lacking the P3N-PIPO gene. N. benthamiana P3N-PIPO-interacting proteins were identified through co-immunoprecipitation (Co-IP) coupled with LC-MS/MS (mass spectrometry), and the interaction between P3N-PIPO and the N. benthamiana receptor-like kinase NbRLK6 was further verified by Co-IP and bimolecular fluorescence complementation (BiFC) of transiently-expressed proteins. Furthermore, our investigation showed that the disease symptom severity and accumulation level of PVX-P3N-PIPO were decreased in N. benthamiana plants when NbRLK6 expression was reduced by tobacco rattle virus-induced gene silencing.
Asunto(s)
Potexvirus , Potyvirus , Nicotiana , Virulencia , Triticum , Cromatografía Liquida , Proteínas Virales/metabolismo , Enfermedades de las Plantas , Espectrometría de Masas en Tándem , Potyvirus/genética , Potexvirus/genéticaRESUMEN
Numerous insects transmit viruses together with saliva to plant phloem, but the roles of saliva components remain elusive. Here, we report that calcium-binding protein (CBP), a universal insect saliva protein, is modified to benefit horizontal transmission of a devastating rice reovirus into plant phloem. CBP effectively competes with virus-induced filaments to target and traverse actin-based apical plasmalemma into saliva-stored cavities in salivary glands of leafhopper vector. Thus, the inhibition of CBP expression by viral infection facilitates filament-mediated viral secretion into salivary cavities and then into plant phloem. Furthermore, virus-mediated reduction of CBP secretion causes an increase of cytosolic Ca2+ levels in rice, triggering substantial callose deposition and H2O2 production. Thus, viruliferous vectors encounter stronger feeding barriers, probe more frequently, and secrete more saliva into plants, ultimately enhancing viral transmission. We thus conclude that the inhibition of CBP secretion facilitates viral secretion and increases host defense response to benefit viral transmission.
Asunto(s)
Hemípteros , Oryza , Animales , Hemípteros/metabolismo , Peróxido de Hidrógeno , Proteínas de Insectos/metabolismo , Insectos Vectores , Oryza/metabolismo , Floema , Saliva/metabolismoRESUMEN
The majority of plant viruses are transmitted by hemipteran insects. Bacterial symbionts in hemipteran hosts have a significant impact on the host life, physiology and ecology. Recently, the involvement of bacterial symbionts in hemipteran vector-virus and vector-plant interactions has been documented. Thus, the exploitation and manipulation of bacterial symbionts have great potential for plant viral disease control. Herein, we review the studies performed on the impact of symbiotic bacteria on plant virus transmission, including insect-bacterial symbiont associations, the role of these bacterial symbionts in viral acquisition, stability and release during viral circulation in insect bodies, and in viral vertical transmission. Besides, we prospect further studies aimed to understand tripartite interactions of the virus-symbiotic microorganisms-insect vector.
RESUMEN
A large number of insect-specific viruses (ISVs) have recently been discovered, mostly from hematophagous insect vectors because of their medical importance, but little attention has been paid to important plant virus vectors such as the whitefly Bemisia tabaci, which exists as a complex of cryptic species. Public SRA datasets of B. tabaci and newly generated transcriptomes of three Chinese populations are here comprehensively investigated to characterize the whitefly viromes of different cryptic species. Twenty novel ISVs were confidently identified, mostly associated with a particular cryptic species while different cryptic species harbored one or more core ISVs. Microinjection experiments showed that some ISVs might cross-infect between the two invasive whitefly cryptic species, Middle East Asia Minor 1 (MEAM1) and Mediterranean (MED), but others appeared to have a more restricted host range, reflecting the possibility of distinct long-term coevolution of these ISVs and whitefly hosts. Moreover, analysis of the profiles of virus-derived small-interfering RNAs indicated that some of the ISVs can successfully replicate in whitefly and the antiviral RNAi pathway of B. tabaci is actively involved in response to ISV infections. Our study provides a comprehensive analysis of the RNA virome, the distinct relationships and cross-cryptic species infectivity of ISVs in an agriculturally important insect vector.
Asunto(s)
Hemípteros/virología , Virus ARN/clasificación , Virus ARN/genética , Viroma , Animales , Bases de Datos Genéticas , Especificidad del Huésped , Insectos Vectores/virología , Metagenoma , Metagenómica/métodos , Filogenia , ARN ViralRESUMEN
Many insect species, such as aphids, leafhoppers, planthoppers, and whiteflies harbor obligate bacterial symbionts that can be transovarially transmitted to offspring through the oocytes of female insects. Whether obligate bacterial symbionts can carry important molecules/resources to the embryos to support egg development is still unknown. Here, we show that the vitellogenin (Vg) precursor of rice leafhopper Nephotettix cincticeps is biosynthesized by the fat body, secreted into the hemolymph and subsequently cleaved into the 35- and 178-kDa subunits, whereas only the 178-kDa subunit is taken up by the leading end of oocytes in a receptor-dependent manner or moves into the posterior pole of the terminal oocyte in association with obligate bacterial symbiont "Candidatus Nasuia deltocephalinicola" (hereafter Nasuia) in a receptor-independent manner. Furthermore, the 178-kDa Vg subunit can directly interact with a surface channel molecule (porin) on the envelope of Nasuia, allowing Vg to enter bacterial cytoplasm. Thus, Vg can hitchhike the ancient oocyte entry path of Nasuia, the common obligate symbiont of leafhoppers. Knocking down a Nasuia growth-related protein expression or treatment with porin antibody strongly prevents the ability of Nasuia to carry Vgs into oocytes and impair insect egg development. Nasuia-carried Vgs provide at least 20% of the total Vgs in the developing eggs. We anticipate that the bacterial symbiont-mediated Vg uptake into oocytes to support efficient egg development may be a common pattern shared by many insects.IMPORTANCE Many insects harbor obligate bacterial symbionts that can be vertically transmitted to offspring by female insects through eggs. Here, we report that leafhopper vitellogenin (Vg) recognizes and binds a surface channel molecule (porin) on the envelope of obligate bacterial symbiont Nasuia, which potentially induces the opening of porin channels for Vg to access the cytoplasm of Nasuia Thus, Vg can exploit bacterial symbionts as the independent carriers into the oocytes. Such Nasuia-carried Vg contents support efficient insect egg development. Thus, our findings indicate that insects have evolved strategies to exploit the symbionts for carrying additional Vgs to guarantee optimal insect reproduction.