First report of Tomato spotted wilt orthotospovirus infecting agapanthus (Agapanthus praecox) in South Africa.

Agapanthus praecox Willd. is an ornamental flowering plant that is indigenous to southern Africa and was reported to be a host of tomato spotted wilt orthotospovirus (TSWV) in Australia in 2000 (Wilson et al. 2000). Tomato spotted wilt orthotospovirus (TSWV) belonging to the genus Orthotospovirus of the family Tospoviridae is a single-stranded negative sense RNA virus known to cause disease symptoms in many crops and ornamental plant species. This virus is in the top 10 of most economically important plant viruses worldwide (Rybicki 2015; Scholthof et al. 2011). In May 2021, leaf material from three agapanthus (Agapanthus praecox) plants displaying chlorotic mottling, and yellow lesions (Supplementary material 1A) was collected in Mbombela, South Africa. One gram of symptomatic leaf material was used for total RNA extraction from each of the three samples using a CTAB extraction protocol (Ruiz-García et al. 2019). The three RNA extracts were pooled, and a sequencing library was constructed using the Ion Total RNA-Seq Kit v2.0 and RiboMinus™ Plant Kit for RNA-Seq (ThermoFisher Scientific) (Central Analytical Facility (CAF), Stellenbosch University). The RNA library was sequenced on an Ion Torrent Proton Instrument (CAF). A total of 34,392,939 single-end reads were obtained. Data was trimmed for quality with Trimmomatic (CROP:250, MINLEN:50). De novo assembly was performed on the remaining 32,281,645 trimmed reads (average readlength: 100 nt, range: 50-250 nt) using SPAdes 3.13.0 and resulted in 4,788 contigs. BLASTn analysis identified viral contigs longer than 1,000 nucleotides (nts) with high nucleotide (nt) identity to TSWV (6 contigs), as well as to the newly discovered viruses, agapanthus tungro virus (AgTV) (1 contig), and agapanthus velarivirus (AgVV) (4 contigs) (Read et al 2021). Read mapping was performed against the relevant reference sequence with the highest nt identity to the contigs. For TSWV, 4995, 21221 and 14574 reads mapped to segment L (KY250488), M (KY250489) and S (KY250490) of isolate LK-1, respectively resulting in 99.97%, 100.00% and 99.97% genome coverage of the reference accessions. The nt identity between the reference accessions and the consensus sequences generated (OP921761-OP921763) were 97.26%, 97.64% and 97.82% for segment L, M and S. The presence of TSWV was confirmed in the HTS sample using an RT-PCR assay (primers L1 and L2) targeting the L segment of TSWV (Mumford et al. 1994). In July 2022, additional leaf samples displaying symptoms of chlorotic mottling, streaking, and ringspots were collected from 31 symptomatic and 3 asymptomatic agapanthus plants in public gardens in Stellenbosch, South Africa. Using the above-mentioned RT-PCR assay, 13 of the symptomatic samples tested positive for TSWV. All six plants displaying ring spot symptoms (Supplementary material 1B) were infected with TSWV. However, plants that displayed yellow streaking (five samples) and chlorotic mottling (two samples) (Supplementary material 1C-D) were also positive for TSWV which could be due to the presence of other viruses, plant growth stage, infection time or just variable symptom expression in a single host species as reported previously (Sherwood et al. 2003). The 275 bp RT-PCR amplicons of the HTS sample and three additional positive samples were validated with bidirectional Sanger sequencing (CAF) and had 96% identity to accession KY250488. The pairwise nt identity between amplicons was 98.55-100%. This is the first report of TSWV infecting agapanthus in South Africa. This study contributes information towards the distribution and incidence of TSWV and highlights the need for nurseries to screen plant material before propagation.

First report of the plum marbling disease associated agent, plum viroid I, in apricots (Prunus armeniaca) in South Africa.

Plum viroid I (PlVd-I) was recently identified as a new viroid in 2020 present in Japanese plum (Prunus salicina) displaying marbling and corky flesh symptoms (Bester et al. 2020). This viroid is a member of the species Apscaviroid plvd-I (genus Apscaviroid, family Pospiviroidae) (Walker et al. 2022). The first observation of apricot fruits with an uneven, indented surface and irregular shape was in 2003 on Prunus armeniaca cv. Charisma in the Western Cape, South Africa. The symptomatic apricot cv 'Charisma' scions showed symptoms only on the fruits, resembling the marbling disease deformities reported previously on fruits from PlVd-I-infected plum trees (Supplementary material 1). In the summer of 2019, representative leaf samples were collected from 13 'Charisma' apricot trees (seven symptomatic and six healthy trees) from two different apricot orchards on two geographical separate farms in the Western Cape. Total RNA was extracted from 1 g leaf petioles using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA (RiboMinus™ Plant Kit for RNA-Seq, ThermoFisher Scientific) was prepared, and a sequencing library (Ion Total RNA-Seq Kit v2.0, ThermoFisher Scientific) was constructed from a symptomatic sample (La4) (Central Analytical Facility, Stellenbosch University, CAF-SU). High-throughput sequencing was performed on an Ion Torrent™ Proton™ instrument (CAF-SU). De novo assembly using SPAdes 3.13.0 (default parameters) (Nurk et al. 2013) were performed using 93,760,198 reads (average read length: 143 nt). The 174679 scaffolds obtained were annotated using BLAST+ standalone against a local NCBI nucleotide database. One scaffold (443 nt, read coverage: 23.88) had the highest sequence identity (99.59%) to multiple PlVd-I isolates and two scaffolds of 1440 nucleotides (nt) and 2143 nt had high sequence identity to RNA1 and RNA2 of solanum nigrum ilarvirus 1 (SnIV1) (MN216370: 98%; MN216373: 98%) (Ma et al. 2020). These were the only viral sequences identified in the sample. Consensus sequences for SnIV1 were generated by read mapping using CLC Genomics Workbench 11.0.1 (Qiagen) (default parameters) to SnIV1 (MN216370; MN216373; MN216376) and deposited in GenBank (MT900926-MT900928). To confirm the presence of both PlVd-I and the apricot variant of SnIV1, reverse transcription polymerase chain reactions (RT-PCRs) were performed on the RNA of the 13 samples collected. The samples were tested for PlVd-I using primer set 22F/21R (Bester et al. 2020). Only the symptomatic samples tested positive for PlVd-I providing the first evidence of PlVd-I related symptoms in apricots. Three PlVd-I amplicons were bidirectionally Sanger sequenced (CAF-SU) and submitted to GenBank (MT385845-MT385847). The HTS PlVd-I sequence from sample La4 was 100% identical to MT385845, and 99.37% identical to MT385846 and MT385847. An RT-PCR assay was designed, targeting SnIV1 RNA2 (Ilar_RNA2_402F: CTATCTGCCCGAAGGTCAAC, Ilar_RNA2_1161R: CCTATCAAGAGCGAGCAATGG). All samples tested positive for SnIV1 irrespective of symptom status and therefor SnIV1 appears not be associated with specific symptoms in 'Charisma' apricots. This study is the first to report the presence of PlVd-I in symptomatic apricots presenting with uneven, indented surface morphology in South Africa. This study adds towards the investigation into possible alternative hosts for PlVd-I and will assist the South African certification scheme to assess the incidence and severity in apricots.

First report of 'Candidatus Liberibacter africanus' associated with African Greening of Citrus in Angola.

Huanglongbing (HLB, Asian Citrus Greening), the most devastating disease of citrus has not been detected in southern Africa (Gottwald, 2010). HLB is associated with 'Candidatus Liberibacter asiaticus' (CLas), a phloem-limited bacterium vectored by Diaphorina citri Kuwayama (Hemiptera: Liviidae), the Asian Citrus Psyllid (ACP). African Citrus Greening, associated with 'Candidatus Liberibacter africanus' (CLaf) and its vector the African Citrus Triozid, Trioza erytreae (Del Guercio) (Hemiptera: Triozidae), are endemic to Africa, although not previously reported from Angola. African Greening is less severe than HLB, largely due to heat sensitivity of CLaf and its vector. Introduction of HLB into southern Africa would be devastating to citrus production in commercial and informal sectors. Concern was raised that CLas or ACP might hae inadvertently been introduced into Angola. In July 2019, a survey was conducted in two citrus nurseries in Luanda and Caxito and in different orchards on 7 farms surrounding Calulo and Quibala. Yellow sticky traps for insects were placed at the various localities and collected after c. 3 weeks. Breeding signs of T. erytreae (pit galls) were observed on citrus in some locations, but no insect vectors were detected on traps. Trees were inspected for signs and symptoms of citrus pests and diseases, particularly those that resemble HLB (foliar blotchy mottle, shoot chlorosis, vein yellowing and corking, lopsided fruit with aborted seeds and colour inversion) and its vectors (pit galls on leaves or waxy exudates). Leaves and shoots with suspect symptoms were sampled for laboratory analysis (43 samples). DNA was extracted from petiole and midrib tissue of leaves using a modified CTAB extraction protocol of Doyle and Doyle (1990). Real-time PCR was done using universal Liberibacter primers of Roberts et al. (2015), CLaf specific primers of Li et al. (2006) and CLas specific primers of Bao et al. (2019). All real-time PCR protocols indicated the presence of CLaf in 6 samples (Tab. S1). CLas or other citrus Liberibacter species were not detected. The presence of CLaf in sample 37 was confirmed by constructing a library (NEXTFLEX® DNA Sequencing Kit, PerkinElmer) with extracted DNA and performing high-throughput sequencing on an Ion Torrent™ S5™ platform (Central Analytical Facility, Stellenbosch University). To improve the quality of the reads, all 233,617,700 obtained reads were trimmed from the 3' end to a maximum length of 240 nt using Trimmomatic (Bolger et al. 2014). The high quality reads were mapped to the Citrus sinensis reference genome (NC_023046.1) using Bowtie 2.3.4 (Langmead and Salzberg 2012) to subtract all the reads that had high identity to the host plant (number of mismatches allowed in the seed was set to 1). The 14,691,369 unmapped reads (6.2% of original data) were mapped to the CLaf reference genome NZ_CP004021.1 using CLC Genomics Workbench 10.1.1 (Qiagen) (Length fraction = 0.8; Similarity fraction = 0.9). A CLaf consensus genome was generated that spanned 99.7% of the reference genome and the 163001 mapped reads had a 22.9 mean read coverage. The consensus sequence was 99.7% identical to NZ_CP004021.1 and was submitted to Genbank as accession: CP054879. The positive CLaf detections were from trees with typical HLB or African Citrus Greening symptoms, viz. lopsided fruit with green stylar ends, aborted seed and stained columella at base of fruit button; yellow shoots with leaves showing symptoms of blotchy mottle and vein yellowing and corking (Fig. S1) in a commercial citrus farm outside Calulo and included 2 'Ponkan' mandarin (C. reticulata), 2 Valencia and 1 'Navelina' tree (C. sinensis), and a citrus nursery in Luanda (1 lime tree; C. aurantifolia) (Tab. S1). This first report of CLaf in Angola highlights the need to prevent spread by removing infected trees and managing the insect vector, as well as the need for further surveys to determine the occurrence of African Greening and its vectors in other provinces and to confirm the absence of exotic citrus pests and diseases. References Bao, M. et al. 2020. Plant Dis. 104:527 Bolger, A. M. et al. 2014. Bioinformatics. 30:2114-2120. Doyle, J.J. and Doyle, J.L. 1990. Focus 12:13 Gottwald, T.R. 2010. Annu. Rev. Phytopathol. 48:119 Langmead, B. and Salzberg, S. 2012. Nature Methods. 9:357-359. Li, W. et al. 2006. Jnl. Microbiol. Methods 66:104 Roberts, R. et al. 2015. Int. J. Syst. Evol. Micr. 65:723.

Bioinformatic Tools and Genome Analysis of Citrus tristeza virus.

High-throughput sequencing (HTS) is a powerful tool employed by plant virologists for the detection of viruses, the characterization of virus genomes and the study of host-pathogen interactions. Virus detection has been an important application of this technology, which has resulted in the discovery of novel viruses or viral strains as well as for the detection of known viruses in a plant sample. Here we describe the entire process that needs to be considered for the genome analysis of Citrus tristeza virus (CTV) by HTS, including the experimental design, sample preparation, nucleic acid purification, HTS library construction, and bioinformatic analysis.