Therapy-induced carboplatin-DNA adduct levels in human ovarian tumours in relation to assessment of adduct measurement in mouse tissues.

Despite an increasing understanding of the molecular mechanisms by which platinum drug DNA adducts interact with cellular processes, the relationship between adduct formation in tumours and clinical response remains unclear. We have determined carboplatin-DNA adduct levels in biopsies removed from ovarian cancer patients following treatment. Reliability of DNA adduct measurements in tissues samples were assessed using experimental animals. Platinum-DNA adduct levels were measured using inductively coupled plasma mass spectrometry (ICP-MS) and plasma drug concentrations determined by atomic absorption spectrometry (AAS). Adduct levels in tissues and plasma pharmacokinetics were determined in Balb/c mice exposed to platinum drugs. Comparisons of adduct levels in tumour and normal tissue were made in nu/nu mice carrying human neuroblastoma xenografts. At 30 min post-cisplatin administration, adduct levels in DNA from kidney and liver were approximately 10- and 6-fold higher than spleen or tumour. By 60 min, levels in liver and kidney, but not spleen or tumour, had fallen considerably. Carboplatin showed high adduct levels only in kidney. Adduct levels in tumour xenografts were comparable to those induced in vitro with similar drug exposures. In clinical samples removed 6h after drug administration, adduct levels ranged from 1.9 to 4.3 and 0.2 to 3.6 nmol Pt/g DNA for tumour biopsies and peripheral blood mononuclear cells, respectively. No correlation was apparent between these two data sets. The present results demonstrate that reliable measurements of adducts in clinical tumours are feasible. Future results should provide insight into drug resistance.

The impact of the human DNA topoisomerase II C-terminal domain on activity.

BACKGROUND: Type II DNA topoisomerases (topos) are essential enzymes needed for the resolution of topological problems that occur during DNA metabolic processes. Topos carry out an ATP-dependent strand passage reaction whereby one double helix is passed through a transient break in another. Humans have two topoII isoforms, alpha and beta, which while enzymatically similar are differentially expressed and regulated, and are thought to have different cellular roles. The C-terminal domain (CTD) of the enzyme has the most diversity, and has been implicated in regulation. We sought to investigate the impact of the CTD domain on activity. METHODOLOGY/PRINCIPLE FINDINGS: We have investigated the role of the human topoII C-terminal domain by creating constructs encoding C-terminally truncated recombinant topoIIalpha and beta and topoIIalpha+beta-tail and topoIIbeta+alpha-tail chimeric proteins. We then investigated function in vivo in a yeast system, and in vitro in activity assays. We find that the C-terminal domain of human topoII isoforms is needed for in vivo function of the enzyme, but not needed for cleavage activity. C-terminally truncated enzymes had similar strand passage activity to full length enzymes, but the presence of the opposite C-terminal domain had a large effect, with the topoIIalpha-CTD increasing activity, and the topoIIbeta-CTD decreasing activity. CONCLUSIONS/SIGNIFICANCE: In vivo complementation data show that the topoIIalpha C-terminal domain is needed for growth, but the topoIIbeta isoform is able to support low levels of growth without a C-terminal domain. This may indicate that topoIIbeta has an additional localisation signal. In vitro data suggest that, while the lack of any C-terminal domain has little effect on activity, the presence of either the topoIIalpha or beta C-terminal domain can affect strand passage activity. Data indicates that the topoIIbeta-CTD may be a negative regulator. This is the first report of in vitro data with chimeric human topoIIs.

Specific adducts recognised by a monoclonal antibody against cisplatin-modified DNA.

Numerous clinical or experimental studies have employed monoclonal antibody CP9/19 for quantification of cisplatin DNA adducts. The nature of adducts recognised by CP9/19 on polymeric DNA were defined using synthetic deoxynucleotides reacted with cisplatin. Total adduct levels were determined by atomic absorption spectrometry. The nature of adducts formed were confirmed by analysis of enzymatic hydrolysates using an established ion-exchange chromatography method combined with inductively coupled plasma mass spectrometry. Of the Pt bound to oligonucleotide A (TTTTTGGTTTTTGGTTTTTGGTTTTTGGTTTTT), 77% was recovered in a product consistent with the expected 1,2 intra-strand cross-link between GG. For oligonucleotide B (TTTTTAGTTTTTAGTTTTTAGTTTTTAGTTTTT), 62% of the bound Pt was recovered in a product consistent with the 1,2 intra-strand cross-link between AG. Of Pt bound to oligothymydylic acid, 65% was recovered in a product not previously described, small quantities of which were also formed on oligonucleotides A and B. The concentrations of adducts required to cause 50% reduction of signal in a competitive enzyme-linked immunosorbant assay (ELISA) (K-values) were determined. Adducts on sequences containing no guanine or only non-adjacent guanine residues, including sequences containing adenines adjacent to guanines, exhibited low or undetectable immunoreactivities (K-values = from 1 to >100 pmoles Pt per assay well). Adducts formed on oligodeoxynucleotides containing guanine doublets interspersed amongst thymine residues were the most immunoreactive (K-values: 2-7 fmoles adduct per assay well), comparable to adducts on calf-thymus DNA. The only cisplatin-DNA adducts recognised with high sensitivity by antibody CP9/19 were those involving adjacent guanine residues but immunorecognition of these was influenced by the surrounding DNA sequence.