The association between antibiotic use in infancy and childhood overweight or obesity: a systematic review and meta-analysis.

PURPOSE: Antibiotic use is associated with alteration of the gut microbiome and metabolic activity. As childhood obesity is a predisposing factor for adult obesity, addressing childhood risk factors to weight gain in early life is important. This review aims to investigate the association between infant antibiotic exposure (aged < 24 months) and childhood obesity or overweight. METHODS: Articles were retrieved from CINAHL, Cochrane CENTRAL, Embase and MEDLINE. Eligible articles investigated antibiotic use in exposed versus unexposed infants and measured childhood weight change. Data were synthesized narratively and meta-analysed where possible. RESULTS: After title/abstract and full-text screening, 17 articles representing 15 unique studies were included for narrative synthesis. We found a small association between antibiotic exposure in infancy (<24 months) and childhood overweight or obesity. The strongest associations were observed in boys versus girls and children exposed to multiple antibiotic courses or broad-spectrum drugs. Meta-analysis of 12 sets of results comparing the earliest age of exposure to any antibiotic with overweight or obesity at the latest age of outcome found a pooled odds ratio of 1.05 (95% confidence interval: 1.00-1.11). CONCLUSIONS: Antibiotic exposure in infants, aged < 24 months, was associated with a small increase in odds of childhood overweight or obesity in some subgroups of children.

Mechanisms of and variables affecting UVR photoadaptation in human skin.

Humans have been exposed to solar UV radiation since their appearance on Earth and evolution has enabled most individuals to adapt to this exposure, to some degree. UV radiation produces several deleterious effects in human skin and light-skinned individuals are at greatest risk for both acute and long-term negative effects such as DNA damage, sunburn, immune suppression and skin cancer. The benefits of photoadaptation, which leads to a decreased response after acclimatization, are that humans who have skin that is capable of photoadaptation can work and play in the sun with reduced fear of painful sunburn. However, the effects of photoadaptation on DNA damage and development of skin cancer are quite complex and less well-understood. In this article, we have reviewed the current state of knowledge of UVR photoadaptation in human skin. However, more studies are needed to explore the use of UVR photoadaptation to protect against critical endpoints, such as skin cancer.

Tailoring 2D and 3D molecular sieves structures for polyolefin composites: do all roads lead to remarkable performances?

Multiple synthetic strategies were performed in order to tether a zirconium-based catalyst to the 2D and 3D molecular sieves for olefin polymerizations. The anchoring of fluorene silane to the mesoporous MCM-41 was performed in order to obtain a stable catalyst for olefin polymerization (1@MCM-41). Using spectroscopic methods, this system was shown to have the metal center locked on a face down conformation with the surface. Also, immobilized zirconium complexes have been prepared on three different types of aminopropyl-modified supports (2@magadiite, 2@MCM-41 and 3@MCM-48). The advantage of this latter method of immobilization would be the reduction of the steric effect caused by the support: the catalyst, distant from the surface, is more exposed to the monomer and this situation may lead to an increase in the catalytic activity compared to 1@MCM-41. However, a medium size chain as a spacer between the support and the metallocene is still flexible enough to bend and predisposes the metal center to interact with the support surface; this effect is more evident when the nature of the support is of fixed pore dimensions. These supported catalysts exhibited activity for ethylene polymerization, resulting in linear PEs with high melting temperatures. In order to retain a metallocene assembled as in a homogeneous environment, a multi-step reaction was investigated (4@magadiite) but it led to the leaching of the organic moieties from the surface during catalyst preparation. The best catalytic performance was achieved when homogeneous Oct-amido catalyst (5) was reacted with the surface of magadiite and n-alkyl-AlPO-kan.

Evaluation of Oxacillin and Cefoxitin Disk Diffusion and MIC Breakpoints Established by the Clinical and Laboratory Standards Institute for Detection of mecA-Mediated Oxacillin Resistance in Staphylococcus schleiferi.

Staphylococcus schleiferi is a beta-hemolytic, coagulase-variable colonizer of small animals that can cause opportunistic infections in humans. In veterinary isolates, the rate of mecA-mediated oxacillin resistance is significant, with reported resistance rates of >39%. The goal of this study was to evaluate oxacillin and cefoxitin disk diffusion (DD) and MIC breakpoints for detection of mecA-mediated oxacillin resistance in 52 human and 38 veterinary isolates of S. schleiferi Isolates were tested on multiple brands of commercial media and according to Clinical and Laboratory Standards Institute (CLSI) methods. Zone diameters and MIC values were interpreted using CLSI breakpoints (CLSI, Performance Standards for Antimicrobial Susceptibility Testing. M100-S27, 2017) for Staphylococcus aureus/Staphylococcus lugdunensis, coagulase-negative staphylococci (CoNS), and Staphylococcus pseudintermedius Results were compared to those of mecA PCR. Twenty-nine of 90 (32%) isolates were mecA positive. Oxacillin inhibition zone sizes and MICs interpreted by S. pseudintermedius breakpoints reliably differentiated mecA-positive and mecA-negative isolates, with a categorical agreement (CA) of 100% and no very major errors (VMEs) or major errors (MEs) for all media. For cefoxitin DD results interpreted using S. aureus/S. lugdunensis and CoNS breakpoints, CA values were 85% and 75%, respectively, and there were 72% and 64% VMEs, respectively, and 0 MEs. For cefoxitin MICs interpreted using S. aureus/S. lugdunensis breakpoints, CA was 81%, and there were 60% VMEs and no MEs. Our data demonstrate that oxacillin DD or MIC testing methods using the current S. pseudintermedius breakpoints reliably identify mecA-mediated oxacillin resistance in S. schleiferi, while cefoxitin DD and MIC testing methods perform poorly.

Predicting the risk of cucurbit downy mildew in the eastern United States using an integrated aerobiological model.

Cucurbit downy mildew caused by the obligate oomycete, Pseudoperonospora cubensis, is considered one of the most economically important diseases of cucurbits worldwide. In the continental United States, the pathogen overwinters in southern Florida and along the coast of the Gulf of Mexico. Outbreaks of the disease in northern states occur annually via long-distance aerial transport of sporangia from infected source fields. An integrated aerobiological modeling system has been developed to predict the risk of disease occurrence and to facilitate timely use of fungicides for disease management. The forecasting system, which combines information on known inoculum sources, long-distance atmospheric spore transport and spore deposition modules, was tested to determine its accuracy in predicting risk of disease outbreak. Rainwater samples at disease monitoring sites in Alabama, Georgia, Louisiana, New York, North Carolina, Ohio, Pennsylvania and South Carolina were collected weekly from planting to the first appearance of symptoms at the field sites during the 2013, 2014, and 2015 growing seasons. A conventional PCR assay with primers specific to P. cubensis was used to detect the presence of sporangia in rain water samples. Disease forecasts were monitored and recorded for each site after each rain event until initial disease symptoms appeared. The pathogen was detected in 38 of the 187 rainwater samples collected during the study period. The forecasting system correctly predicted the risk of disease outbreak based on the presence of sporangia or appearance of initial disease symptoms with an overall accuracy rate of 66 and 75%, respectively. In addition, the probability that the forecasting system correctly classified the presence or absence of disease was ≥ 73%. The true skill statistic calculated based on the appearance of disease symptoms in cucurbit field plantings ranged from 0.42 to 0.58, indicating that the disease forecasting system had an acceptable to good performance in predicting the risk of cucurbit downy mildew outbreak in the eastern United States.

Gene expression associated with suicide attempts in US veterans.

According to a recent report from the Office of Suicide Prevention in the US Department of Veterans Affairs, veterans represent 8.5% of the US population, but account for 18% of all deaths from suicide. The aim of this study of psychiatric patients (n=39; 87% male) was to compare blood gene expression data from veterans with a history of one or more suicide attempts to veterans who had never attempted suicide. The attempter and non-attempter groups were matched for age and race/ethnicity, and both groups included veterans with a diverse psychiatric history that included posttraumatic stress disorder (PTSD) and substance-use disorders. Veterans were interviewed for lifetime psychiatric history, including a detailed assessment of prior suicide attempts and provided a blood sample. Results of Ingenuity Pathway Analysis (IPA) identified several pathways associated with suicide attempts, including the mammalian target of rapamycin (mTOR) and WNT signaling pathways. These pathways are of particular interest, given their role in explaining pharmacological treatments for suicidal behavior, including the use of ketamine and lithium. These results suggest that findings observed in civilians are also relevant for veterans and provide a context for interpreting results observed in post-mortem samples. In conclusion, an emerging body of work that shows consistency in findings across blood and brain samples suggests that it might be possible to identify molecular predictors of suicide attempts.

Whole-genome DNA methylation status associated with clinical PTSD measures of OIF/OEF veterans.

Emerging knowledge suggests that post-traumatic stress disorder (PTSD) pathophysiology is linked to the patients' epigenetic changes, but comprehensive studies examining genome-wide methylation have not been performed. In this study, we examined genome-wide DNA methylation in peripheral whole blood in combat veterans with and without PTSD to ascertain differentially methylated probes. Discovery was initially made in a training sample comprising 48 male Operation Enduring Freedom (OEF)/Operation Iraqi Freedom (OIF) veterans with PTSD and 51 age/ethnicity/gender-matched combat-exposed PTSD-negative controls. Agilent whole-genome array detected ~5600 differentially methylated CpG islands (CpGI) annotated to ~2800 differently methylated genes (DMGs). The majority (84.5%) of these CpGIs were hypermethylated in the PTSD cases. Functional analysis was performed using the DMGs encoding the promoter-bound CpGIs to identify networks related to PTSD. The identified networks were further validated by an independent test set comprising 31 PTSD+/29 PTSD- veterans. Targeted bisulfite sequencing was also used to confirm the methylation status of 20 DMGs shown to be highly perturbed in the training set. To improve the statistical power and mitigate the assay bias and batch effects, a union set combining both training and test set was assayed using a different platform from Illumina. The pathways curated from this analysis confirmed 65% of the pool of pathways mined from training and test sets. The results highlight the importance of assay methodology and use of independent samples for discovery and validation of differentially methylated genes mined from whole blood. Nonetheless, the current study demonstrates that several important epigenetically altered networks may distinguish combat-exposed veterans with and without PTSD.

Neurokinin-1 receptor expression and antagonism by the NK-1R antagonist maropitant in canine melanoma cell lines and primary tumour tissues.

We interrogated the neurokinin-1 receptor (NK-1R)/substance P (SP) pathway in canine melanoma tumour tissues and cell lines. NK-1R messenger RNA (mRNA) and protein expression were observed in the majority of tumour tissues. Immunohistochemical assessment of archived tissue sections revealed NK-1R immunoreactivity in 11 of 15 tumours, which may have diagnostic, prognostic and therapeutic utility. However, we were unable to identify a preclinical in vitro cell line or in vivo xenograft model that recapitulates NK-1R mRNA and protein expression documented in primary tumours. While maropitant inhibited proliferation and enhanced apoptosis in cell lines, in the absence of documented NK-1R expression, this may represent off-target effects. Furthermore, maropitant failed to suppress tumour growth in a canine mouse xenograft model derived from a cell line expressing mRNA but not protein. While NK-1R represents a novel target, in the absence of preclinical models, in-species clinical trials will be necessary to investigate the therapeutic potential for antagonists such as maropitant.

First Report of Black Leaf Mold of Tomato Caused by Pseudocercospora fuligena in Ohio.

Diseased tomato (Solanum lycopersicum L. cvs. Geronimo, Rebelski, and Big Dena) plants were received for diagnosis from a home gardener in Wayne County, Ohio, in August 2013 and from a 0.14-ha greenhouse in Brown County, Ohio, in September 2013. Approximately 10 and 60% of leaf area was diseased in the home garden and greenhouse, respectively. One or more lesions, each with an indistinct border, were observed on the leaves. Black fungal growth was observed on both sides of the leaf in association with the lesions. Microscopic examination revealed Cercospora-like conidia (2). Three symptomatic leaves from each location were surface-sterilized with 0.5% NaClO for 1 min and cultured on V8 juice agar medium at room temperature under continuous fluorescent lighting. One isolate was selected from each of Wayne Co. (SAM33-13) and Brown Co. (SAM34-13). The fungus produced small, dark-brown colonies within 2 weeks of plating. Mycelium was olive brown and septate, producing fascicles of conidiophores. Conidia were cylindrical, 2 to 14 septate, and 25.8 to 109.7 × 6.5 µm. Genomic DNA was extracted from colonies of isolate SAM33-13 grown on V8 juice agar medium using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI). The internal transcribed spacer (ITS) region of rDNA was amplified by PCR using primer pair ITS1 and ITS4 (5), and the purified amplicon was sequenced (OARDC Molecular and Cellular Imaging Center, Wooster, OH). The ITS sequence was 99% identical to those of GenBank accessions of Pseudocercospora fuligena from Korea (JX290079) and Thailand (GU214675). The sequence was deposited in GenBank (KF931141). Based on morphology (4) and sequence analysis, the fungus was identified as P. fuligena (Roldan) Deighton (basionym Cercospora fuligena). To satisfy Koch's postulates, three 4-week-old tomato plants each of the cultivars L390 (AVRDC, Taiwan) and Mountain Spring (Siegers Seed Co., Holland, MI) were sprayed with a suspension of 1 × 103 conidia/ml of isolates SAM33-13 or SAM34-13 prepared from 3-week-old cultures growing on V8 juice agar medium. Three non-inoculated control plants were sprayed with sterilized water. Plants were maintained in a growth chamber at 25 to 30°C, 80% RH, and a 12 h/12 h day/night cycle. The first symptoms appeared 3 weeks after inoculation as light yellow foliar lesions. The lesions enlarged and turned black due to fungal growth, and the infected leaves dried. Disease severity was 70 and 10% of leaf area for cvs. L390 and Mountain Spring, respectively, for each isolate. Non-inoculated control plants were symptomless, and no fungus was re-isolated from the leaves. P. fuligena was isolated from symptomatic leaves of inoculated plants as described above, and the identity was confirmed based on morphology. In the United States, C. fuligena has not been reported infecting tomato since the first report in Florida in 1974 (1). To our knowledge, this is the first report of black leaf mold of tomato caused by P. fuligena in Ohio. Resistant cultivars, crop sanitation, and fungicides are recommended to manage the disease (3). References: (1) C. H. Blazquez and S. A. Alfieri. Phytopathology 64:443, 1974. (2) U. Braun. IMA Fungus 4:265, 2013. (3) R. Cerkauskas. AVRDC Publication 04-606, 2004. (4) B. Halfeld-Vieira et al. Fitopatol. Bras. 31:3, 2006. (5) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

First Report of Tomato chlorotic spot virus Infecting Tomatoes in Ohio.

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5'-CTCGGTTTTCTGCTTTTC-3' and JAP886, 5'CGGACAGGCTGGAGAAATCG3') (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5'-CGTATCTGAGGATGTTGAGT-3' and JAP888, 5'-GCTAACTCCTTGTTCTTTTG-3'). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5'-AGTATTATGCATCTATAGATTAGCACA-3' and TCSV-R1, 5'-ACAAATCATCACATTGCCAGGA-') were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.

Quantification and genotyping of lipoprotein lipase in patients with diabetic lipaemia.

AIMS: To determine if diabetic lipaemia is caused by loss of function mutations in the lipoprotein lipase gene, LPL. METHODS: We conducted a case-control study over 2 years in two tertiary care hospitals in South Australia. Six patients with a history of diabetic lipaemia and 12 control subjects, with previous diabetic ketoacidosis and peak triglyceride concentrations < 2.4 mmol/l were included. Participants were well at the time of study investigations. RESULTS: Only one patient with lipaemia had a loss of function mutation in LPL and no functional mutations in APOC2 or GPIHBP1 were identified. The mean lipoprotein lipase concentration was lower in patients with diabetic lipaemia than in control subjects (306 vs. 484 µg/l, P = 0.04). The mean fasting C-peptide concentration was higher in patients with diabetic lipaemia than in control subjects (771 vs. 50 pmol/l; P = 0.001). CONCLUSIONS: Lipoprotein lipase deficiency in patients with a history of diabetic lipaemia was predominantly quantitative, rather than secondary to mutations in LPL, APOC2 or GPIHBP1. The majority of patients with severe hypertriglyceridaemia in diabetic ketoacidosis may have ketosis-prone Type 2, rather than Type 1, diabetes.

Photoassociation of long-range nD Rydberg molecules.

We observe long-range homonuclear diatomic nD Rydberg molecules photoassociated out of an ultracold gas of Rb87 atoms for 34≤n≤40. The measured ground-state binding energies of Rb87(nD+5S1/2) molecular states are larger than those of their Rb87(nS+5S1/2) counterparts, which shows the dependence of the molecular bond on the angular momentum of the Rydberg atom. We exhibit the transition of Rb87(nD+5S1/2) molecules from a molecular-binding-dominant regime at low n to a fine-structure-dominant regime at high n [akin to Hund's cases (a) and (c), respectively]. In the analysis, the fine structure of the nD Rydberg atom and the hyperfine structure of the 5S1/2 atom are included.

Syntaxin 6-mediated Golgi translocation plays an important role in nuclear functions of EGFR through microtubule-dependent trafficking.

Receptor tyrosine kinases (RTKs) are cell surface receptors that initiate signal cascades in response to ligand stimulation. Abnormal expression and dysregulated intracellular trafficking of RTKs have been shown to be involved in tumorigenesis. Recent evidence shows that these cell surface receptors translocate from cell surface to different cellular compartments, including the Golgi, mitochondria, endoplasmic reticulum (ER) and the nucleus, to regulate physiological and pathological functions. Although some trafficking mechanisms have been resolved, the mechanism of intracellular trafficking from cell surface to the Golgi is not yet completely understood. Here we report a mechanism of Golgi translocation of epidermal growth factor receptor (EGFR) in which EGF-induced EGFR travels to the Golgi via microtubule-dependent movement by interacting with dynein and fuses with the Golgi through syntaxin 6-mediated membrane fusion. We also demonstrate that the microtubule- and syntaxin 6-mediated Golgi translocation of EGFR is necessary for its consequent nuclear translocation and nuclear functions. Thus, together with previous studies, the microtubule- and syntaxin 6-mediated trafficking pathway from cell surface to the Golgi, ER and the nucleus defines a comprehensive trafficking route for EGFR to travel from cell surface to the Golgi and the nucleus.

Comparison of Illumigene, Simplexa, and AmpliVue Clostridium difficile molecular assays for diagnosis of C. difficile infection.

We compared the performance of the Simplexa Universal Direct (Focus Diagnostics) and AmpliVue (Quidel Corporation) assays to that of the Illumigene assay (Meridian Bioscience, Inc.) for the diagnosis of Clostridium difficile infection. Two hundred deidentified remnant diarrheal stool specimens were tested by the Simplexa, AmpliVue, and Illumigene methods. Specimens with discrepant results among the three assays and a representative number of concordant specimens were further evaluated by toxigenic culture. The sensitivity and specificity were 98 and 100% and 96 and 100% for the Simplexa Universal Direct and AmpliVue assays, respectively. Both assays are easy to perform, with rapid turn-around-times, supporting their utility in the clinical laboratory as routine diagnostic platforms.

First Report of Anthracnose of Onion Caused by Colletotrichum coccodes in Ohio.

Dry bulb onion (Allium cepa L. cvs. Pulsar, Bradley, and Livingston) plants with symptoms of anthracnose were observed in three commercial fields totaling 76.5 ha in Huron Co., Ohio, in July 2013. Symptoms were oval leaf lesions and yellowing, curling, twisting, chlorosis, and death of leaves. Nearly half of the plants in a 32.8-ha field of the cv. Pulsar were symptomatic. Concentric rings of acervuli with salmon-colored conidial masses were observed in the lesions. Conidia were straight with tapered ends and 16 to 23 × 3 to 6 µm (2). Colletotrichum coccodes (Wallr.) S. Hughes was regularly isolated from infected plants (2). Culturing diseased leaf tissue on potato dextrose agar (PDA) amended with 30 ppm rifampicin and 100 ppm ampicillin at room temperature yielded white aerial mycelia and salmon-colored conidial masses in acervuli. Numerous spherical, black microsclerotia were produced on the surface of colonies after 10 to 14 days. To confirm pathogen identity, total DNA was extracted directly from a 7-day-old culture of isolate SAM30-13 grown on PDA, using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI) following the manufacturer's instructions. The ribosomal DNA internal transcribed spacer (ITS) region was amplified by PCR using the primer pair ITS1 and ITS4 (2), and sequenced. The sequence, deposited in GenBank (KF894404), was 99% identical to that of a C. coccodes isolate from Michigan (JQ682644) (1). Ten onion seedlings cv. Ebenezer White at the two- to three-leaf stage of growth were spray-inoculated with a conidial suspension (1 × 105 conidia/ml containing 0.01% Tween 20, with 10 ml applied/plant). Plants were maintained in a greenhouse (21 to 23°C) until symptoms appeared. Control plants were sprayed with sterilized water containing 0.01% Tween 20, and maintained in the same environment. After 30 days, sunken, oval lesions each with a salmon-colored center developed on the inoculated plants, and microscopic examination revealed the same pathogen morphology as the original isolates. C. coccodes was re-isolated consistently from leaf lesions. All non-inoculated control plants remained disease-free, and C. coccodes was not re-isolated from leaves of control plants. C. coccodes was reported infecting onions in the United States for the first time in Michigan in 2012 (1). This is the first report of anthracnose of onion caused by C. coccodes in Ohio. Unusually wet, warm conditions in Ohio in 2013 likely contributed to the outbreak of this disease. Timely fungicide applications will be necessary to manage this disease in affected areas. References: (1) A. K. Lees and A. J. Hilton. Plant Pathol. 52:3. 2003. (2) L. M. Rodriguez-Salamanca et al. Plant Dis. 96:769. 2012. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

First Report of Bacterial Wilt Caused by Ralstonia solanacearum in Ghana, West Africa.

Tomato and pepper plants exhibiting wilt symptoms were collected from fields in seven villages in Northern (Vea, Tono, Pwalugu), Ashanti (Agogo, Akumadan), and Brong Ahafo (Tanoso, Tuobodom) regions of western Ghana in November 2012. The plants were wilted without leaf yellowing or necrosis. Disease incidence was generally low, with less than 20% symptomatic plants observed. Most of the plants collected produced visible bacterial ooze in water in the field. Ooze was plated on 2,3,5-triphenyltetrazolium chloride-amended (TZC) medium. Isolated colonies were fluidal, irregularly round, white with pink centers, gram-negative, and oxidase positive. One strain from each of seven fields was selected for further study. All strains induced a hypersensitive reaction on tobacco. Randomly selected strains SM855-12 and SM857-12 tested positive in R. solanacearum ImmunoStrip assays (Agdia Inc., IN). An end-point PCR assay with primer set 759/760 (3) generated an R. solanacearum-specific 280-bp amplicon for all seven strains. Two of these strains were biovar I and the remaining five were biovar III based on utilization of cellobiose, lactose, maltose, dulcitol, mannitol, and sorbitol. A phylotype-specific multiplex PCR assay that recognizes four geographically linked monophyletic groups within R. solanacearum (1) indicated that one strain (SM855-12) was phylotype III (African origin), whereas the other six were phylotype I (Asian origin). All strains were subjected to repetitive sequence-based PCR (Rep-PCR) with BOXA1R and REP1R/REP2 primers (4). Strain SM855-12 was grouped with the phylotype III reference strain UW 368 and the remaining six strains were grouped with the phylotype I reference strain GMI 1000. A pathogenicity test was performed with bacterial wilt-susceptible tomato line OH7814. Inoculum was prepared from 48-h cultures of strains SM855-12, SM856-12, and SM858-12 grown on casamino acid peptone glucose (CPG) medium at 30°C. Roots of ten 4-week-old tomato plants per strain were drench-inoculated with 5 ml of a 108 CFU/ml bacterial suspension after wounding with a sterile scalpel. Non-inoculated control plants were drenched with 5 ml distilled water after root wounding. Plants were kept in a greenhouse at 25 to 30°C. By 12 days after inoculation, 80 to 100% of inoculated plants were wilted, whereas no symptoms appeared in non-inoculated plants. Bacteria re-isolated from wilted plants were confirmed to be R. solanacearum using techniques mentioned above. Although an association of bacterial wilt with tomato/pepper was mentioned previously (2), to our knowledge, this is the first documented report of bacterial wilt caused by R. solanacearum in Ghana. The presence of Asian strains (phylotype I) may be the result of one or more accidental introductions. Awareness of this disease in Ghana will lead to deployment of management strategies including use of resistant varieties and grafting desirable varieties onto disease-resistant rootstocks. References: (1) M. Fegan and P. Prior. Page 449 in Bacterial Wilt Disease and the Ralstonia solanacearum Species Complex. C. Allen et al., eds. American Phytopathological Society, St. Paul, MN, 2005. (2) K. A. Oduro. Plant Protection and Regulatory Services Directorate of MOFA, Accra, Ghana, 2000. (3) N. Opina et al. Asia Pac. J. Mol. Biol. Biotechnol. 5:19, 1977. (4) J. Versalovic et al. Methods Mol. Cell Biol. 5:25, 1994.

First Report of Bloat Nematode (Ditylenchus dipsaci) Infecting Garlic in Ohio.

Bloat nematode, Ditylenchus dipsaci (Kühn) Filipjev (also known as stem and bulb nematode), is a key pest of garlic (Allium sativum) globally (1) as heavy infestations can lead to complete crop loss. Although not a major crop in Ohio, garlic is grown in diversified vegetable production systems. In July 2013, diseased garlic bulbs were received from a grower in Lorain County, OH, from a field with wide symptom distribution. Bulbs were discolored, exhibited splitting, and had basal plate damage including reduced roots. Nematodes were extracted for examination by placing bulb slices in water. Recovered nematodes had morphological characteristics of D. dipsaci, including a short stylet with prominent knobs, a distinct median esophageal bulb, a basal bulb slightly overlapping the intestine, a conical and pointed tail, and males with distinct bursa (1). To confirm the identity of the nematode, further morphological and molecular studies were performed. Nematode images were captured on a DM IRB inverted microscope (Leica Microsystems, Wetzlar, Germany) using a Retiga 2000 camera (Q Imaging, Surrey, Canada). Images were analyzed using Image J (NIH). For females (n = 16), means and ranges were: L = 1,080.1 (972.2 to 1,229.5) µm, a = 36.6 (33.5 to 41.9), b = 6.2 (5.3 to 6.8), c = 11.1 (9.1 to 12.8), and stylet 10.1 (8.9 to 11.2) µm. For males (n = 6), L = 1,589.2 (1,494 to 1,702.7) µm, a = 43.0 (40.7 to 46.0), b = 6.9 (6.4 to 7.3), c = 11.7 (9.2 to 13), with stylet 10.8 (10 to 12.2) µm and spicules 25.2 (23.8 to 26.8) µm. The measurements were highly similar to those of D. dipsaci (1). DNA was extracted from 50 to 100 nematodes using a PowerSoil DNA Isolation Kit (Mo-Bio Laboratories, Inc., Carlsbad, CA) as well as from individual females, and partial ITS sequences were amplified using primer set TW81/AB28 (3). The partial ITS sequences shared 99 to 100% sequence identity with GenBank accessions of D. dipsaci from garlic (DQ452956, JX123258). Expansion segments D2-D3 were sequenced following amplification of DNA from individual females using primer set D2A/D3B (4) and shared 99% sequence identity with D. dipsaci from garlic (FJ707362, JX123259). In this case, the grower noted bloat nematode symptoms following the introduction of new planting material into the field. Therefore, the availability of bloat nematode-free planting material or treated bulbs (2) is essential for preventing introduction of this pathogen. Once established, management options are limited as this nematode is difficult to eliminate. With this first report of D. dipsaci on garlic in Ohio, we have identified a new pest that can greatly reduce garlic yields in this state. References: (1) W. Nickle, ed. Ditylenchus. In: Manual of Agricultural Nematology, 1991. (2) P. Roberts et al. J. Nematol. 27:448, 1995. (3) S. Subbotin et al. Phytopathology 95:1308, 2005. (4) G. Tenente et al. Nematropica 34:1, 2004.

First Report of Leek yellow stripe virus in Garlic in Ohio.

Leek yellow stripe virus (LYSV), genus Potyvirus, family Potyviridae, infects a wide range of Allium species worldwide. LYSV is one of several viruses that chronically infect garlic, Allium sativum L. The garlic virus complex, which includes LYSV, Onion yellow dwarf virus, and Garlic common latent virus, is perpetuated by asexual propagation (4) and is transmitted to clean planting material by aphids (3). This virus complex can reduce garlic bulb weight by nearly three quarters (2), and LYSV-only infections can result in approximately a one-quarter reduction in bulb weight (2). Garlic is grown as a small-scale, specialty crop in Ohio. During late May and early June 2013, garlic plants with virus-like symptoms were collected from Medina, Holmes, and Wayne counties, Ohio. Plants exhibited chlorotic streaking, foliar dieback, dwarfing, small bulbs, and cylindrical bulbs that failed to differentiate into cloves. Incidence of affected plants in the fields was up to 5% and all fields had early season aphid infestations. Flexuous rods were observed in TEM micrographs of plant sap from symptomatic leaves. Five symptomatic plants and six asymptomatic plants (from fields with symptomatic plants) were evaluated for LYSV by DAS-ELISA (Agdia, Inc., Elkhart, IN). Reverse transcriptase (RT)-PCR with LYSV-specific primers LYSV-WA and LYSV-WAR (3) was performed with cDNA generated by the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA). Both foliar and bulb tissues were tested using both detection methods. Forty percent of symptomatic plants and 67% of asymptomatic plants tested positive for LYSV with both ELISA and RT-PCR. LYSV was detected in both foliar and bulb tissues, including both tissues from asymptomatic plants. Five PCR amplicons generated from both foliar and bulb tissue were sequenced and shown to share 96 to 98% maximum identity with an LYSV polyprotein gene accession in GenBank (AY842136). This provided additional support that the detected virus was LYSV. LYSV was initially difficult to detect in Ohio fields due to low disease incidence and subtle symptom development. Use of virus-tested garlic bulbs can improve yield for several years, even following viral reinfection by aphids, compared to growing garlic from chronically infected bulbs (1). However, many growers routinely save bulbs from year to year and lack access to or knowledge of virus-tested sources of garlic bulbs. Conducive conditions, chronic infections, or co-infections with other viruses enhance the severity of symptoms and yield loss (2). LYSV has previously been reported in garlic producing regions of the northwestern United States (3), and to our knowledge, this is the first report of LYSV in garlic in Ohio. References: (1) V. Conci et al. Plant Dis. 87:1411, 2003. (2) P. Lunello et al. Plant Dis. 91:153, 2008. (3) H. Pappu et al. Plant Health Progress 10, 2008. (4) L. Parrano et al. Phytopathol. Mediterr. 51:549, 2012.

Assessing the efficacy of pre-harvest, chlorine-based sanitizers against human pathogen indicator microorganisms and Phytophthora capsici in non-recycled surface irrigation water.

Many factors must be considered in order to develop and implement treatment systems to improve the microbial quality of surface water and prevent the accidental introduction of plant and human pathogens into vegetable crops. The efficacy of chlorine gas (Cl2(g)) and chlorine dioxide (ClO2) injection systems in combination with rapid sand filtration (RSF) was evaluated in killing fecal indicator microorganisms in irrigation water in a vegetable-intensive production area. The efficacy of ClO2 and Cl2(g) was variable throughout the distribution systems and coliform bacteria never dropped below levels required by the United States Environmental Protection Agency for recreational waters. Sampling date and sampling point had a significant effect on the abundance of coliforms in Cl2(g)- and ClO2-treated water. Sampling date and sampling point also had a significant effect on the abundance of generic Escherichia coli in Cl2(g) treated water but only sampling point was significant in ClO2 treated water. Although the waterborne plant pathogen Phytophthora capsici was detected in five different sources of surface irrigation water using baiting and P. capsici-specific PCR, in vitro studies indicated that ClO2 at concentrations similar to those used to treat irrigation water did not reduce mycelial growth or direct germination of P. capsici sporangia and reduced zoospore populations by less than 50%. This study concludes that injection of ClO2 and Cl2(g) into surface water prior to rapid sand filtration is inadequate in reducing fecal indicator microorganism populations and ClO2 ineffectively kills infectious propagules of P. capsici. Additional research is needed to design a system that effectively targets and significantly reduces both plant and human pathogens that are present in surface irrigation water. A model for a multiple barrier approach to treating surface water for irrigation is proposed.

Successful heart transplantation from a donor with Ullrich congenital muscular dystrophy.

Heart transplantation is the most effective therapy for children with end-stage heart disease; however, its use is limited by the number of donor organs available. This shortage may be further compounded by concerns about organ quality, leading to refusal of potential donor organ offers. We report on the successful transplantation and 5-year follow-up of a heart from a donor with Ullrich congenital muscular dystrophy (UCMD). The candidate was critically ill at the time of the transplant and the donor organ was declined repeatedly on the match run list due to concerns about organ quality, despite having normal cardiac function by echocardiography on minimal inotropic support. We believe the diagnosis of "muscular dystrophy" in the donor combined with a lack of understanding about the specifics of the diagnosis of UCMD enabled our candidate to receive a primary offer for this organ. We are unaware of any previous reports of the use of a heart from a donor with UCMD for orthotopic heart transplantation in adults or children.