Cotton leafroll dwarf disease: An enigmatic viral disease in cotton.

TAXONOMY: Cotton leafroll dwarf virus (CLRDV) is a member of the genus Polerovirus, family Solemoviridae. Geographical Distribution: CLRDV is present in most cotton-producing regions worldwide, prominently in North and South America. PHYSICAL PROPERTIES: The virion is a nonenveloped icosahedron with T = 3 icosahedral lattice symmetry that has a diameter of 26-34 nm and comprises 180 molecules of the capsid protein. The CsCl buoyant density of the virion is 1.39-1.42 g/cm3 and S20w is 115-127S. Genome: CLRDV shares genomic features with other poleroviruses; its genome consists of monopartite, single-stranded, positive-sense RNA, is approximately 5.7-5.8 kb in length, and is composed of seven open reading frames (ORFs) with an intergenic region between ORF2 and ORF3a. TRANSMISSION: CLRDV is transmitted efficiently by the cotton aphid (Aphis gossypii Glover) in a circulative and nonpropagative manner. Host: CLRDV has a limited host range. Cotton is the primary host, and it has also been detected in different weeds in and around commercial cotton fields in Georgia, USA. SYMPTOMS: Cotton plants infected early in the growth stage exhibit reddening or bronzing of foliage, maroon stems and petioles, and drooping. Plants infected in later growth stages exhibit intense green foliage with leaf rugosity, moderate to severe stunting, shortened internodes, and increased boll shedding/abortion, resulting in poor boll retention. These symptoms are variable and are probably influenced by the time of infection, plant growth stage, varieties, soil health, and geographical location. CLRDV is also often detected in symptomless plants. CONTROL: Vector management with the application of chemical insecticides is ineffective. Some host plant varieties grown in South America are resistant, but all varieties grown in the United States are susceptible. Integrated disease management strategies, including weed management and removal of volunteer stalks, could reduce the abundance of virus inoculum in the field.

First report of turnip yellows virus infecting cabbage (Brassica oleracea var. capitata) in the USA.

During the spring of 2021, cabbage (Brassica oleracea var. capitata) planted in the research farm at the University of Georgia, Tifton, exhibited leaf distortion, yellow and purple discoloration at the leaf margin of older leaves, and severe stunting. Symptoms were present on nearly 30% of the plants in the field. To identify the potential agents associated, leaf tissues from two symptomatic plants were sent for high throughput sequencing (HTS) of small RNA (sRNA; DNB sequencing, SE read 1x75bp) to Beijing Genomics Institute, China. From each sample, ~ 18 million raw reads were generated. The reads with poor quality and adapter sequences were removed using CLC Genomics Workbench 21.2 (Qiagen, Germantown, MD). Of the total reads, 2,093 and 3,889 reads aligned to the genome of turnip yellows virus (TuYV) in samples one and two, respectively. Reads of turnip mosaic virus (TuMV) were also detected (data not shown). Partial sequences of TuYV assembled from samples one and two showed 89.5% and 89.9% match and 86% and 93% coverage, respectively, with the genome of the type isolate of TuYV (NC_003743) from the United Kingdom. To confirm the presence of TuYV in the samples collected from the same location, specific primers were designed targeting the P0 region (FP- 5'ACAAAAGAAACCAG- GAGGGAATCC3'; RP-5'GCCTTTTCATACAAACATTTCGGTG3') and coat protein (CP) region (FP-5'GTTAATGAATACGGTCGTGGGTAG3'; RP-5'ATTCTGAAAGAACCAGCT- ATCGATG3') of the virus. Eight of 20 (40%) symptomatic samples were determined to be infected with TuYV based on the amplification of expected size products of the P0 (786 nt) and the CP gene (581 nt) in reverse transcription-PCR (RT-PCR). All samples were also tested for the presence of TuMV by RT-PCR as in Sanchez et al. (2003), but none tested positive despite being identified in HTS. Symptoms on samples from which eithervirus could not be detected indicates the involvement of other factors and would require further studies. The partial P0 and CP gene amplicons of TuYV from two samples each were Sanger sequenced bi-directionally at Genewiz (South Plainfield, NJ) and confirmed as TuYV using BLASTn. The partial CP gene sequences from two samples shared 98.7% nucleotide sequence identity with each other and 88.0% (OK349421) and 87.1% (OK349422) identity with the type isolate. The partial P0 gene sequences (OK349423 and OK349424) shared 99.6% nucleotide sequence identity with each other and 92.2% identity with the type isolate. TuYV, formerly known as beet western yellows virus (BWYV) (Mayo, 2002), genus Palerovirus, family Solemoviridae (Walker et al., 2021), is transmitted persistently by aphids (Stevens et al., 2008), and is distributed throughout temperate regions of the world (Kawakubo et al., 2021). TuYV has a wide host range, including brassica, vegetables and weeds (Stevens et al., 2008). However, losses have been reported primarily on canola (B. napus) in Australia (Jones, 2007) and Europe (Stevens et al., 2008). On cabbage, TuYV infections have been reported from China (Zhang et al., 2016), Serbia (Milosevic et al., 2020) and the Philippines (Buxton-Kirk et al, 2020). TuYV (BWYV) has been found infecting shepherd's purse (Capsella bursa-pastoris) in California (Falk and Duffus, 1984), but there are no reports of the virus from any cultivated crops in the USA. To our knowledge, this is the first report of TuYV in cabbage in the USA. More studies are needed to understand its occurrence and impact on cabbage crops in Georgia as well as other regions in the USA.

High Throughput Sequencing-Aided Survey Reveals Widespread Mixed Infections of Whitefly-Transmitted Viruses in Cucurbits in Georgia, USA.

Viruses transmitted by the sweet potato whitefly (Bemisia tabaci) have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state of the USA, to identify the viruses infecting cucurbits and their distribution. Symptomatic samples were collected and small RNA libraries were prepared and sequenced from three cantaloupes, four cucumbers, and two yellow squash samples. An analysis of the sequences revealed the presence of the criniviruses cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and the begomovirus cucurbit leaf crumple virus (CuLCrV). CuLCrV was detected in 76%, CCYV in 60%, and CYSDV in 43% of the total samples (n = 820) tested. The level of mixed infections was high in all the cucurbits, with most plants tested being infected with at least two of these viruses. Near-complete genome sequences of two criniviruses, CCYV and CYSDV, were assembled from the small RNA sequences. An analysis of the coding regions showed low genetic variability among isolates from different hosts. In phylogenetic analysis, the CCYV isolates from Georgia clustered with Asian isolates, while CYSDV isolates clustered with European and USA isolates. This work enhances our understanding of the distribution of viruses on cucurbits in South Georgia and will be useful to develop strategies for managing the complex of whitefly-transmitted viruses in the region.

First report of cucurbit chlorotic yellows virus in association with other whitefly-transmitted viruses in squash (Cucurbita pepo) in Georgia.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.

Akirin is critical for early tinman induction and subsequent formation of the heart in Drosophila melanogaster.

The regulation of formation of the Drosophila heart by the Nkx 2.5 homologue Tinman is a key event during embryonic development. In this study, we identify the highly conserved transcription cofactor Akirin as a key factor in the earliest induction of tinman by the Twist transcription cofactor. akirin mutant embryos display a variety of morphological defects in the heart, including abnormal spacing between rows of aortic cells and abnormal patterning of the aortic outflow tract. akirin mutant embryos have a greatly reduced level of tinman transcripts, together with a reduction of Tinman protein in the earliest stages of cardiac patterning. Further, akirin mutants have reduced numbers of Tinman-positive cardiomyoblasts, concomitant with disrupted patterning and organization of the heart. Finally, despite the apparent formation of the heart in akirin mutants, these mutant hearts exhibit fewer coordinated contractions in akirin mutants compared with wild-type hearts. These results indicate that Akirin is crucial for the first induction of tinman by the Twist transcription factor, and that the success of the cardiac patterning program is highly dependent upon establishing the proper level of tinman at the earliest steps of the cardiac developmental pathway.

Improved cardiac contraction imaging in live Drosophila embryos.

Drosophila melanogaster is a powerful model organism in which to address the genetics of cardiac patterning and heart development. This system allows the pairing of live imaging with the myriad available genetic and transgenic techniques to not only identify the genes that are critical for heart development, but to assess their impact on heart function in living organisms. There are several described methods to assess cardiac function in Drosophila. However, these approaches are restricted to imaging of mid- to late-instar larval and adult hearts. This technical hurdle therefore does not allow for the recording and analysis of cardiac function in embryos bearing strong mutations that do not hatch into larvae. Our technical innovation lies in transgenically labeling the cells of the Drosophila heart and using line scan-based confocal imaging to repeatedly image the walls of the heart. By plotting this line scan as a kymograph, heart contractions can be visualized and assayed, thereby allowing for quantification of physiological defects. This method can be used to obtain physiological data from known mutations that affect cardiac development yet are incapable of hatching into larvae for conventional analysis.•Use transgenic methods to label heart proper walls•Use high-speed line scanning to capture position of heart proper walls•Create X vs. time plot to visualize and quantify contractions over imaging period.