Ascertaining variations in the activity of larval midgut enzymes of Helicoverpa armigera by dietary emamectin benzoate through biochemical and in silico docking study.

Helicoverpa armigera, a ubiquitous polyphagous pest, poses a significant threat to global agriculture, causing substantial economic losses and demonstrating resistance to synthetic pesticides. This study investigates the potential of emamectin benzoate (EMB), an avermectin derivative, as an effective control agent against H. armigera. The larvae of the NBII-MP-NOC-01 strain of H. armigera were reared on an artificial diet. The impact of dietary EMB was examined on four midgut enzymes; alanine aminotransferase (ALT), aspartate aminotransferase (AST), acid phosphatase (ACP), and alkaline phosphatase (ALP). Results showed a dose-dependent and time-dependent reduction in ALT and AST activity, while an initial increase and subsequent decline in ACP and ALP activity at higher EMB concentrations. Computational modelling of enzyme structures and molecular docking studies revealed differential binding of EMB with the midgut enzymes. The strongest interaction was observed between EMB and ALT residues, contrasting with weakest interactions observed with AST. The study also showed that decreased activity of transaminases in H. armigera caused by EMB may be because of stability-activity trade-off, while in phosphatases reverse may be the case. This research provides crucial insights into the biochemical responses and the intricate insecticide-enzyme interactions in H. armigera caused by EMB exposure. This study lays the foundation for further research aimed at developing environmentally friendly approaches for managing H. armigera, addressing the challenges associated with conventional pesticides.

Characterization of plant growth-promoting, antifungal, and enzymatic properties of beneficial bacterial strains associated with pulses rhizosphere from Bundelkhand region of India.

The present study was conducted to characterize the native plant growth-promoting rhizobacteria (PGPRs) from the pulse rhizosphere of the Bundelkhand region of India. Twenty-four bacterial isolates belonging to nineteen species (B. amyloliquefaciens, B. subtilis, B. tequilensis, B. safensis, B. haynesii, E. soli, E. cloacae, A. calcoaceticus, B. valezensis, S. macrescens, P. aeruginosa, P. fluorescens, P. guariconensis, B. megaterium, C. lapagei, P. putida, K. aerogenes, B. cereus, and B. altitudinis) were categorized and evaluated for their plant growth-promoting potential, antifungal properties, and enzymatic activities to identify the most potential strain for commercialization and wider application in pulse crops. Phylogenetic identification was done on the basis of 16 s rRNA analysis. Among the 24 isolates, 12 bacterial strains were gram positive, and 12 were gram negative. Among the tested 24 isolates, IIPRAJCP-6 (Bacillus amyloliquefaciens), IIPRDSCP-1 (Bacillus subtilis), IIPRDSCP-10 (Bacillus tequilensis), IIPRRLUCP-5 (Bacillus safensis), IIPRCDCP-2 (Bacillus subtilis), IIPRAMCP-1 (Bacillus safensis), IIPRMKCP-10 (Bacillus haynesii), IIPRANPP-3 (Bacillus amyloliquefaciens), IIPRKAPP-5 (Enterobacter soli), IIPRAJCP-2 (Enterobacter cloacae), IIPRDSCP-11 (Acinetobacter calcoaceticus), IIPRDSCP-9 (Bacillus valezensis), IIPRMKCP-3 (Seratia macrescens), IIPRMKCP-1 (Pseudomonas aeruginosa), IIPRCKPP-3 (Pseudomonas fluorescens), IIPRMKCP-9 (Pseudomonas guariconensis), IIPRMKCP-8 (Bacillus megatirium), IIPRMWCP-9 (Cedecea lapagei), IIPRKUCP-10 (Pseudomonas putida), IIPRAMCP-4 (Klebsiella aerogenes), IIPRCKPP-7 (Enterobacter cloacae), IIPRAMCP-5 (Bacillus cereus), IIPRSHEP-6 (Bacillus subtilis), IIPRRSBa89 (Bacillus altitudinis) bacterial isolates, IIPRMKCP-9, IIPRAJCP-6, IIPRMKCP-10, IIPRAMCP-5, IIPRSHEP-6, and IIPRMKCP-3 showed the maximum antagonistic activity against Fusarium oxysporum f. sp. ciceris (FOC), Fusarium oxysporum f. sp. lentis (FOL), and Fusarium udum (FU) causing wilt disease of chickpea, lentil, and pigeonpea, respectively, and maximum plant growth-promoting enzyme (phosphatase), plant growth hormone (IAA), and siderophore production show promising results under greenhouse conditions. This study is the first report of bacterial diversity in the pulse-growing region of India.

Deciphering the antibiofilm potential of 2-Phenylethyl methyl ether (PEME), a bioactive compound of Kewda essential oil against Staphylococcus aureus.

Opportunistic pathogenic bacteria and their pathogenicity linked with biofilm infections become a severe issue as they resist the actions of multiple antimicrobial drugs. Naturally derived drugs having antibiofilm properties are more effective than chemically synthesized drugs. The plant derived essential oils are a rich source of phytoconstituents with widespread pharmacological values. In the present investigation, a major phytoconstituent, 2-Phenyl Ethyl Methyl Ether (PEME) of Kewda essential oil extracted from the flowers of Pandanus odorifer was explored for its prospective antimicrobial and anti-biofilm properties against ESKAPE pathogenic bacterial strains, Staphylococcus aureus and MTCC 740. The minimum inhibitory concentration (MIC) of PEME was found to be 50 mM against the tested bacterial strains. A gradual decrease in biofilm production was observed when PEME was treated with the sub-MIC concentration. The reduction in biofilm formation was noticeable from qualitative assay i.e., Congo Red Agar Assay (CRA) and further quantified by crystal violet staining assay. The decline in exopolysaccharides production was quantified, with the highest inhibition against MTCC 740 with a decrease of 71.76 ± 4.56% compared to untreated control. From the microscopic analysis (light and fluorescence microscopic method), PEME exhibited inhibitory effect on biofilm formation on the polystyrene surface. The in silico studies stated that PEME could invariably bind to biofilm associated target proteins. Further, transcriptomic data analysis suggested the role of PEME in the down-regulation of specific genes, agrA, sarA, norA and mepR, which are critically associated with bacterial virulence, biofilm dynamics and drug resistance patterns in S. aureus. Further, qRT-PCR analysis validated the role of PEME on biofilm inhibition by relative downregulation of agrA, sarA, norA and mepR genes. Further, advanced in silico methodologies could be employed in future investigations to validate its candidature as promising anti-biofilm agent.

Morphological and physiological changes induced by Achyranthes aspera-mediated silver nanocomposites in Aedes aegypti larvae.

Aedes aegypti is responsible for the global spread of several ailments such as chikungunya, dengue, yellow fever, and Zika. The use of synthetic chemicals is the primary intervention in mosquito management. However, their excessive utilization resulting in the spread of toxic ingredients in the environment and posing threats to beneficial organisms has prompted the recommendation for the use of biologically synthesized nanocomposites as a promising approach for vector control. Silver nanocomposites were synthesized using leaf (AL-AgNCs) and stem (AS-AgNCs) extracts of Achyranthes aspera. The early fourth instars of A. aegypti were exposed to lethal doses of these nanocomposites to evaluate their effects on larval development, behavior, morphology, and mid-gut histoarchitecture. The cellular damage and deposition of nanocomposite residues in the mid-gut were studied using light and transmission electron microscopy. The A. aspera silver nanocomposite (AA-AgNC)-exposed larvae exhibited dose-dependent extended duration of development and diminished adult emergence, but did not exhibit modified behavior. Intense damage to the cuticle membrane and slight contraction in the internal membrane of anal papillae were noticed. Morphologically, the mid-gut appeared disorganized, darkly pigmented, and shrunk. Histological investigations of the mid-gut revealed significantly disordered internal architecture with lysed cells, damaged peritrophic membrane and microvilli, disintegrated epithelial layer, and a ruptured and displaced basement membrane. Visualization of the larval mid-gut through TEM showed severe cellular damage and aggregation of black spots, indicating the deposition of silver particles released by AA-AgNCs. The investigations revealed the bio-efficacy of A. aspera-mediated AgNCs against A. aegypti inducing stomach and contact toxicity in the larvae. The utilization of AA-AgNCs is recommended for A. aegypti management as a safe and effective intervention.

Very late stent thrombosis associated with COVID-19 infection: a case report and review of the literature.

Coronavirus disease 2019 (COVID-19), caused by SARS-CoV-2 has varied manifestation with multisystem involvement. Acute coronary syndrome in COVID-19 as a result of stent thrombosis is an uncommon entity and is often due to hypercoagulable state. A 40-year-old male was referred to us with acute onset chest pain. He also reported fever, sore throat and dry cough for six days which mandated testing for COVID-19 which turned out to be positive. He had a prior history of coronary artery disease with a drug eluting stent implanted two years back. An electrocardiogram was suggestive of acute anterior wall myocardial infarction while echocardiogram revealed hypokinesia of left anterior descending (LAD) artery territory. Coronary angiogram revealed non-occlusive thrombus in proximal LAD stent. A Thrombolysis in Myocardial Infarction (TIMI) III flow was restored following balloon angioplasty with a non-compliant balloon and use of glycoprotein (GP) IIb-IIIa receptor antagonist. A diagnosis of very late stent thrombosis subsequent to COVID-19 was made.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Response of Voltage-Gated Sodium and Calcium Channels Subtypes on Dehydroepiandrosterone Treatment in Iron-Induced Epilepsy.

Epilepsy is a neurological disorder characterized by the occurrence of spontaneous and recurrent seizures. In post-traumatic epilepsy (PTE), the mechanism of epileptogenesis is very complex and seems to be linked with voltage-gated ion channels. Dehydroepiandrosterone (DHEA), a neurosteroid have shown beneficial effect against various neurological disorders. We investigated antiepileptic effect of DHEA with respect to expression of voltage-gated ion channels subtypes in iron-induced epilepsy. Iron (FeCl3) solution was intracartically injected to induce epilepsy in rats and DHEA was intraperitoneally administered for 21 days. Results showed markedly increased epileptiform seizures activity along with up-regulation of Nav1.1 and Nav1.6, and down-regulation of Cav2.1α at the mRNA and protein level in the cortex and hippocampus of epileptic rats. Moreover, the study demonstrated that these channels subtypes were predominantly expressed in the neurons. DHEA treatment has countered the epileptic seizures, down-regulated Nav1.1 and Nav1.6, and up-regulated Cav2.1α without affecting their cellular localization. In conclusion, the present study demonstrates antiepileptic potential of DHEA, escorted by regulation of Nav1.1, Nav1.6, and Cav2.1α subtypes in the neurons of iron-induced epileptic rats.

Stereoselective Oxidative Rearrangement of Disubstituted Unactivated Alkenes Using Hypervalent Iodine(III) Reagent.

The stereoselective oxidative rearrangement of disubstituted unactivated olefins has been achieved using a hypervalent iodine(III) reagent. The aryl group undergoes 1,2-migration to give tert-α-arylated aldehydes (as acetals). The preparation of these aldehydes/acetals, especially containing a tert-benzylic stereocenter, has remained challenging. This migration-based method provides a complementary approach over the known α-substitution-based methods for accessing this class of molecules.

Global Access to 3/4-Phosphorylated Heterocycles via a Carbene-Catalyzed Stetter Reaction of Vinylphosphonates and Aldehydes.

The first global method for the preparation of 3-phosphorylated-pyrroles, -furans, -thiophenes, and 4-phosphorylated 2,5-dihydropyridazines is reported. To achieve this, the first protocol for the direct synthesis of α-phosphorylated 1,4-diketones has been developed through a carbene-catalyzed Stetter reaction of vinylphosphonates and aldehydes. This is the first synthetic method for accessing 4-phosphorylated 2,5-dihydropyridazines. This process is metal-free and produces multifunctionalized heterocycles.

Access to enantioenriched 4-phosphorylated δ-lactones from ß-phosphorylenones and enals via carbene organocatalysis.

N-heterocyclic carbene (NHC) catalyzed direct access to enantioenriched 4-phosphorylated δ-lactones from ß-phosphorylenones and enals has been achieved. The sterically demanding ß-phosphonate-substituted enones, having competing regiomeric reaction centres, have remained elusive so far in intermolecular cycloaddition reactions under NHC catalysis. All the products were obtained in excellent yield and enantioselectivity. These phosphorylated δ-lactones could be transformed into challenging multi-functionalized chiral esters and amides loaded with a ß-ketophosphonate functionality.

Dehydroepiandrosterone alleviates oxidative stress and apoptosis in iron-induced epilepsy via activation of Nrf2/ARE signal pathway.

Epilepsy is a neurological disorder characterized by the prevalence of spontaneous and recurrent seizures. Oxidative stress has been recognized as an intrinsic mechanism for the initiation and progression of epilepsy. In the present study, we investigated the neuroprotective effect of dehydroepiandrosterone (DHEA) against iron-induced epilepsy in rats. Animals were made epileptic by intracortical injection of FeCl3 (5 µl of 100 mM), and DHEA (30 mg/kg b. wt., for 7, 14, and 21 days) was administered intraperitoneally. The results showed electrophysiological alterations, excessive oxidative damage, diminished antioxidant defence and induction of apoptosis in the cortex and hippocampus of epileptic rats. Expression of nuclear factor erythroid 2-related factor 2 (Nrf2), heme oxygenase-1 (HO-1) and NAD(P)H: quinone oxidoreductase-1 (NQO-1) was downregulated in both brain regions. While, DHEA treatment for 14 and 21 days has counteracted oxidative stress, reduced neuronal apoptosis and improved electrophysiological changes along with upregulation of Nrf2, HO-1, and NQO-1. In conclusion, our findings demonstrate that neuroprotective effect of DHEA against iron-induced epilepsy might be escorted by the alleviation of oxidative stress through Nrf2-mediated signal pathway.

Recent Status and Advancements in the Development of Antifungal Agents: Highlights on Plant and Marine Based Antifungals.

The developing resistance in fungi has become a key challenge, which is being faced nowadays with the available antifungal agents in the market. Further search for novel compounds from different sources has been explored to meet this problem. The current review describes and highlights recent advancement in the antifungal drug aspects from plant and marine based sources. The current available antifungal agents act on specific targets on the fungal cell wall, like ergosterol synthesis, chitin biosynthesis, sphingolipid synthesis, glucan synthesis etc. We discuss some of the important anti-fungal agents like azole, polyene and allylamine classes that inhibit the ergosterol biosynthesis. Echinocandins inhibit ß-1, 3 glucan synthesis in the fungal cell wall. The antifungals poloxins and nikkomycins inhibit fungal cell wall component chitin. Apart from these classes of drugs, several combinatorial therapies have been carried out to treat diseases due to fungal resistance. Recently, many antifungal agents derived from plant and marine sources showed potent activity. The renewed interest in plant and marine derived compounds for the fungal diseases created a new way to treat these resistant strains which are evident from the numerous literature publications in the recent years. Moreover, the compounds derived from both plant and marine sources showed promising results against fungal diseases. Altogether, this review article discusses the current antifungal agents and highlights the plant and marine based compounds as a potential promising antifungal agents.

Pectin, beta-cyclodextrin, chitosan and albumin based gastroprotective systems for piroxicam maleate: Synthesis, characterization and biological evaluation.

In order to optimize drug action, new drug formulations have been developed based upon the prodrug approach. This study was inspired by the increasing interest in the field of macromolecular prodrugs and Piroxicam maleate was used as a model drug. A total of five prodrugs were synthesized using beta cyclodextrin, chitosan, pectin, egg albumin, bovine serum albumin. The synthesized conjugates were characterized on the basis of UV, IR and NMR techniques. In-vitro hydrolysis studies were carried out at pH 1.2, pH 7.4, pH 9.0 and in 80% human plasma followed by in-vivo evaluation of analgesic, anti-inflammatory and anti-ulcerogenic potential. The extent of hydrolysis was found to be proportional to increase in pH. Beta cyclodextrin conjugate was found to possess significant analgesic activity whereas chitosan conjugate was found to be the best anti-inflammatory. Pectin conjugate provided maximum protection against ulcers.

Impact of the Stem Extract of Thevetia neriifolia on the Feeding Potential and Histological Architecture of the Midgut Epithelial Tissue of Early Fourth Instars of Helicoverpa armigera Hübner.

Helicoverpa armigera Hübner is one of the most important agricultural crop pests in the world causing heavy crop yield losses. The continued and indiscriminate use of synthetic insecticides in agriculture for their control has received wide public apprehension because of multifarious problems, including insecticide resistance, resurgence of pest species, environmental pollution, and toxic hazards to humans and nontarget organisms. These problems have necessitated the need to explore and develop alternative strategies using eco-friendly and biodegradable plant products. In view of this, the efficacy of Thevetia neriifolia methanol stem extract was evaluated against the early fourth instars of H. armigera as an antifeedant and stomach poison agent. Feeding of larvae with the diet containing 0.005%-5.0% extract resulted in 2.06%-37.35% antifeedant index; the diet with 5.0% extract caused 54.3% reduced consumption. The negative impact of extract on larval feeding resulted in 37.5%-77.7% starvation, causing adverse effects on the larval weight. Choice between control and experimental diet resulted in feeding preference of larvae for the control diet, leading to 7.3%-42.9% reduced consumption of extract-containing diet. The only exception was the diet with 0.005% extract, which could not cause any deterrence. The midgut histological architecture of H. armigera larvae fed with 0.005%-0.05% extract-containing diet with negligible antifeedant potential showed significant damage, shrinkage, and distortion and vacuolization of gut tissues and peritrophic membrane, causing the disintegration of epithelial, goblet, and regenerative cells; the damage increased with the increase in concentration. These changes in the gut caused negative impact on the digestion and absorption of food and thus nutritional deficiency in the larvae, which could probably affect their growth and development. This study reveal the appreciable stomach poison potential of T. neriifolia stem methanol extract against H. armigera larvae, which can be explored as an eco-friendly pest control strategy.

Larvicidal, Repellent, and Irritant Potential of the Seed-Derived Essential oil of Apium graveolens Against Dengue Vector, Aedes aegypti L. (Diptera: Culicidae).

Aedes aegypti L. is one of the primary disease vectors spreading various dreadful diseases throughout the world, specifically over tropics and subtropics. Keeping in view the adverse effects of chemical insecticides-based intervention measures, the eco-friendly and bio-degradable essential oil extracted from the seeds of celery, Apium graveolens were investigated for its efficacy against Ae. aegypti. Larvicidal bioassay carried out with the seed oil against early fourth instars of Ae. aegypti caused an LC50 and LC90 values of 16.10 and 29.08 ppm, respectively, after an exposure to 24 h. The cidal effect of the celery seed oil augmented by 1.2-fold; after an exposure to 48 h; revealing an LC50 value of 13.22 ppm. Interestingly, the seed oil did not cause immediate larval mortality, suggesting a delayed toxicity against the larval stage. Present investigations also revealed remarkable effective repellency of the oil leading to 100% protection till 165 min as compared to control that did not result in any repellency against adult Ae. aegypti. Interestingly, only one bite was recorded in the 165th-min after which only two bites were scored until 180 min of exposure of the adult mosquitoes to the oil. An exciting observation was that the knocked-down effect in adults exposed to 10% oil-impregnated papers. The contact irritancy assays with paper impregnated with 1% celery seed oil caused first flight only after 4 s resulting in an average of 63.66 flights during 15 min of exposure revealing the relative irritability of 26.97. The qualitative phytochemical analysis of the seed oil showed the presence of flavonoids, lactones, and terpenoids as the major constituents suggesting their probable role in the toxicity. Our results confirmed that celery seed essential oil can be used as an efficient larvicide and repellent against Ae. aegypti. The identification of the bioactive components, their mode of action, and studying effects on non-target organisms and the environment would help in devising mosquito-management strategies.

Synthesis, structural investigation, DNA and protein binding study of some 3d-metal complexes with N'-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide.

The ligand, N'-(phenyl-pyridin-2-yl-methylene)-thiophene-2-carboxylic acid hydrazide (Hpmtc) derived from thiophene-2-carboxylic acid hydrazide and 2-benzoyl pyridine, and its metal complexes with Co(II), Ni(II), Cu(II) and Zn(II) have been synthesized. These compounds are characterized by elemental analyses, magnetic susceptibility measurements, IR, NMR and UV-Vis spectral studies. The molecular structures of Hpmtc and its Co(II) (1), Ni(II) (2), Cu(II) (3) and Zn(II) (4) complexes are finally determined by X-ray crystallography. Various spectral and single-crystal X-ray diffraction studies suggest that Hpmtc coordinates with metal ions as a monobasic tridentate ligand forming mononuclear distorted octahedral complexes of the type [M(pmtc)2]. The molecular structures of the complexes are stabilized by CH⋯N, CH⋯O intermolecular H-bonding, and CH⋯π and π⋯π interactions. The DNA binding experiment of the complexes 1, 3 and 4 by UV-Vis absorption, and EB-DNA displacement by fluorescence spectroscopy, reveal an intercalative mode of binding between CT-DNA (calf-thymus DNA) and the metal complexes. These complexes exhibit a moderate ability to cleave pBR322 plasmid DNA. A comparative bovine serum albumin (BSA) protein binding activity of the complexes 1, 3 and 4 has also been determined by UV-Vis absorption and fluorescence spectroscopy. The DNA binding and protein binding studies suggest that the complex 3 exhibits more effective binding activity (Kb=5.54×10(5) and Kq=1.26×10(6) M(-1), respectively) than complexes 1 and 4. However, the complex 1 shows better hydrolytic DNA cleavage activity compared to 3 and 4 complexes.

Mammalian cell-line based toxicological evaluation of paper mill black liquor treated in a soil microcosm by indigenous alkalo-tolerant Bacillus sp.

Organic pollutants present in the soil of a microcosm containing pulp and paper mill black liquor were extracted with hexane/acetone (1:1 v/v) to study the biodegradation and detoxification potential of a Bacillus sp. gas chromatography-mass spectroscopic (GC-MS) analysis performed after biodegradation showed formation of simpler compounds like p-hydroxyhydrocinnamic acid (retention time [RT] 19.3 min), homovanillic acid methyl ester (RT 21.6 min) and 3,5-dimethoxy-p-coumaric alcohol (RT 24.7 min). The methyltetrazolium (MTT) assay for cytotoxicity, 7-ethoxyresorufin-O-deethylase (EROD) assay for dioxin-like behavior and alkaline comet assay for genotoxicity were carried out in the human hepatocarcinoma cell line HuH-7 before and after bacterial treatment. Bioremediation for 15 days reduced toxicity, as shown by a 139-fold increase in black liquor's LC50 value, a 343-fold reduction in benzo(a)pyrene equivalent value and a 5-fold reduction in olive tail moment. The EROD assay positively correlated with both the MTT and comet assays in post biodegradation toxicity evaluation.

Dehydroepiandrosterone's antiepileptic action in FeCl3-induced epileptogenesis involves upregulation of glutamate transporters.

Dehydroepiandrosterone (DHEA), a neuroactive androgen steroid, has antiepileptic action in iron-induced experimental epilepsy (which models post-traumatic clinical epilepsy). In iron-induced epilepsy increased extracellular glutamate resulting from its reduced glial uptake due to the down-regulation (decreased expression) of transporters (glial and or neuronal) is active during epileptogenesis. The present study was aimed at determining whether the mechanism of antiepileptic action of DHEA involved upregulation (increased expression) of glutamate transporters. Iron-induced epileptogenesis was performed in rats by FeCl3 injection into the cerebral cortex. DHEA was administered intraperitoneally to the iron-induced epileptic rats for 7, 14 and 21 days. Levels of glutamate transporters mRNAs expression were measured using quantitative PCR in the hippocampus during the chronic phase of iron-induced epileptogenesis. There were significant reductions in the glutamate transporter mRNAs in epileptogenesis. DHEA treatment resulted in a significant elevation of glutamate transporters: GLT-1, GLAST and EACC-1 mRNA indicating that the DHEA treatment induced upregulation of these transporters. The results are of significance in respect of the mechanism of the antiepileptic action of neurosteroids and the glutamate transporters as therapeutic targets in glutamatergic epileptogenesis.

The blindside: impact of monocular occlusion on spatial attention.

Monocular occlusion has been posited to reduce activation of the contralateral hemisphere ("Sprague effect"), thus inducing a contralateral spatial bias (toward the viewing eye). Healthy right-handed participants bisected horizontal lines during monocular eye viewing. Although subjects tended to deviate away from the viewing eye, only left-eye viewing deviated significantly right of midline. These results suggest that eye patching may induce an attentional compensation similar to that in hemianopic patients. Alternatively, increased activation of higher cortical regions mediating spatial attention in contralateral hemispace may be an adaptive response to decreased activation of its ipsilateral superior colliculus induced by contralateral eye patching.

Effect of L-deprenyl treatment on electrical activity, Na+, K+ ATPase, and protein kinase C activities in hippocampal subfields (CA1 and CA3) of aged rat brain.

L-deprenyl is considered to protect against age-related cognitive deficits by improving long-term learning/memory in the aged brain. The CA1 and CA3 hippocampal areas are the sites at which initial learning and memory processes occur. Chronic deprenyl treatment significantly augmented the basal electrical firing rate (multiple-unit action potentials), and Na+, K(+)-ATPase and protein kinase C activities of both CA1 and CA3 indicating that the drug increased the excitability of CA1 and CA3. The increase, however, was much greater in CA1 than in CA3 suggesting that deprenyl can improve longer-term learning in aged animals by its excitability-enhancing action in CA1. The drug also countered the ageing-related loss of hippocampal protein kinase C activity.