Anticancer Effect of Fluorouracil and Gum-Based Cerium Oxide Nanoparticles on Human Malignant Colon Carcinoma Cell Line (Caco2).

OBJECTIVE: We investigated whether co-incubation of 5-FU and gum-based cerium oxide nanoparticles (CeO2 NPs) would improve half-maximal inhibitory concentration (IC50) and apoptosis in the Caco-2 cancer cell line Materials and Methods: In this experimental study, we synthesized Ceo-2-XG by the nano perception method. X-ray diffraction (XRD), field emission scanning electron microscopy (FESEM), transmission electron microscopy (TEM), dynamic light scattering (DLS) and vibrating sample magnetometer (VSM) techniques were employed to characterize the synthesized nanoparticles. The Caco-2 cancer cells were cultured and treated with Ceo-2- XG and 5-FU. Cytotoxicity analysis was carried out using MTT assay on Caco-2 cancer cells. CXCR1, CXCR2, CXCL8, BAX, BCL-2, P53, CASPASE-3, CASPASE-8 and CASPASE-9 gene expression changes were assessed by quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR). The Caco-2 cancer cell mortality mechanism was analyzed using Annexin V-FITC/PI flow cytometry. Using the inverted microscope morphology changes of the Caco-2 cancer cells was observed. RESULTS: With a sample size of roughly 11 nm, TEM analysis revealed spherical structures. Interestingly, after 72 hours, 400 µg/ml nanoparticles significantly lowered the 50 of 5-FU from 101 to 71 µg/ml (P<000.1). Furthermore, qRT-PCR analysis showed that BCL-2, CXCR1, CXCR2 and CXCR8 expressions were significantly decreased in the 5-FU and Ceo-2-XG nanoparticles co-incubated group, compared to the 5-FU alone (P<0.001). Notably, gene expressions of BAX, P53, CASPASE-3, CASPASE-8 and CASPASE-9 were significantly higher in the 5-FU and Ceo- 2-XG nanoparticles co-incubated group, compared to the 5-FU alone (P<0.001). The findings revealed that dead cells owing to apoptosis were more than two times higher in 5-FU and Ceo-2-XG nanoparticles cancer cells than in 5-FU alone treated cancer cells. CONCLUSION: Co-incubation of 5-FU and Ceo-2-XG nanoparticles significantly increased apoptosis in the Caco-2 cancer cells. The antiproliferative activity of co-incubated 5-FU and Ceo-2-XG nanoparticles on Caco-2 cancer cells was substantially higher than that of 5-FU alone.

Association Between ACOX1 and NRF1 Gene Expression and Hepatitis B and C Virus Infections and Hepatocellular Carcinoma in Liver Transplant Patients (Shiraz, Iran).

OBJECTIVES: Liver transplantation is used to treat both patients with end-stage liver diseases and those with hepatocellular carcinoma; in Iran, these patients are commonly infected with hepatitis B and C viruses. In the present study, for the first time, we investigated the association between ACOX1 and NRF1 gene and protein expression and presence of hepatitis B virus, hepatitis C virus, and hepatocellular carcinoma in liver transplant patients in South-Central Iran. MATERIALS AND METHODS: In this cross-sectional study, we included 200 patients who were seen between 2008 and 2017 for liver transplant at the Namazi Hospital, Shiraz University of Medical Sciences (Shiraz, Iran). All patients received liver grafts from brain dead donors. Donors and recipients were unrelated. ABO compatibility blood group analyses for donor-recipient pairs were conducted. Liver transplant recipients were divided into 3 different groups: hepatitis B virus infected, hepatitis C virus infected, and presence of hepatocellular carcinoma. We also had a control group that included 30 healthy individuals. NRF1 and ACOX1 gene expression levels were evaluated using the SYBER green real-time polymerase chain reaction method. NRF1 and ACOX1 protein expression levels were evaluated using enzymelinked immunosorbent analyses. We used SPSS software for statistical analyses (version 19.0). RESULTS: NRF1 gene expression was increased in all 3 liver transplant recipient groups compared with the control group (not significant, P > .05). Furthermore, ACOX1 gene expression was decreased in all patients compared with control (P > .05). However, we found ACOX1 and NRF1 protein expression to be significantly decreased in all 3 liver transplant recipients groups compared with the control group (P < .05). CONCLUSIONS: NRF1 and ACOX1 genes and their protein expressions could affect the development of chronic liver disease.

Evaluation of frequency magnetic field, static field, and Temozolomide on viability, free radical production and gene expression (p53) in the human glioblastoma cell line (A172).

Thirteen million cancer deaths and 21.7 million new cancer cases are expected in the world by 2030. Glioblastoma is the most common primary malignant tumor of the central nervous system which is the most lethal type of primary brain tumor in adults with the survival time of 12-15 months after the initial diagnosis. Glioblastoma is the most common and most malignant type of brain tumor, and despite surgery, chemotherapy and radiation treatment, the average survival of patients is about 14 months. The current research showed that the frequency magnetic field (FMF) and static magnetic field (SMF) can influence cancer cell proliferation and coupled with anticancer drugs may provide a new strategy for cancer therapy. At the present study, we investigated the effects of FMF (10 Hz, 50 G), SMF (50 G) and Temozolomide (200 µm) on viability, free radical production, and p53 followed by p53 protein expression in the human glioblastoma cell line (A172) by MTT, NBT, RT-PCR and Western blot. Results showed that the effect of Temozolomide (TMZ) with SMF and FMF together increased the cytotoxicity, free radical production, and p53 followed by p53 protein expression in the human glioblastoma cell line (A172).

Mutational screening of the negative regulatory region of astrocyte elevated gene-1 promoter in hepatocellular carcinoma patients / Triagem mutacional da região reguladora negativa do promotor do gene-1 elevado em astrocito em pacientes com carcinoma hepatocelular

Astrocyte elevated gene-1 (AEG-1) is a positive regulator of tumorigenesis in human cancer cells. Human AEG-1 gene is located in chromosome 8q22 having 12 exons/11 introns. Chromosome 8q22 is known to be a hot spot for genomic alterations in several cancerous cells involving HCC. The aim of the study was assess association between the negative regulatory region of AEG-1 promoter mutations and genetic susceptibility to hepatocellular carcinoma. The negative regulatory region of the human AEG-1 promoter was evaluated in a total of 50 Iranian hepatocellular carcinomas (HCC) patients. For investigating AEG-1 promoter polymorphisms the PCR-sequencing method was used. In this study was found two new mutation C>T (-633) and G>C (-660) in the patient group. But it was not revealed the statistically significant association between any mutations in this region of the AEG-1 promoter with HCC susceptibility. According to presented data, we can say that the negative regulatory region of the AEG-1 promoter mutations did not exihibit significant relevance with hepatocellular carcinoma. We recommend further studies on the efficacy of the AEG-1 promoter in therapeutic targeting of the HCC.

Resumo: O gene AEG-1 é um regulador positivo da tumorigênese em células cancerígenas humanas. O gene humano AEG-1 está localizado no cromossomo 8q22 com 12 exons/11 introns. O cromossomo 8q22 é conhecido por ser um hotspot para alterações genômicas em várias células cancerígenas que envolvem o CHC. O objetivo do estudo foi avaliar a associação entre a região reguladora negativa das mutações do promotor AEG-1 e a suscetibilidade genética ao carcinoma hepatocelular. A região reguladora negativa do promotor humano AEG-1 foi avaliada em um total de 50 pacientes iranianos com carcinomas hepatocelulares (CHC). Para investigar os polimorfismos do promotor AEG-1, utilizou-se o método de sequenciação por PCR. Neste estudo foram encontradas duas novas mutações C>T (-633) e G>C (-660) no grupo de pacientes. Mas não foi revelada a associação estatisticamente significante entre quaisquer mutações nessa região do promotor AEG-1 com suscetibilidade ao CHC. De acordo com os dados apresentados, podemos dizer que a região reguladora negativa das mutações do promotor AEG-1 não demonstrou relevância significativa com o carcinoma hepatocelular. Recomendamos estudos adicionais sobre a eficácia do promotor AEG-1 no direcionamento terapêutico do CHC.

Cytochrome b and Molecular Typing of Leishmania spp. in a Passive Sampling of Suspected Patients with Cutaneous Leishmaniasis in Sistan and Baluchestan Province, Eastern Iran.

BACKGROUND: Despite the high prevalence and drug resistance of disease in Sistan and Baluchestan Province of Iran, the species of cutaneous leishmaniasis (CL) has not been identified. In the present study, cytochrome b (Cyt b) was used in Sistan and Baluchestan to find species of Leishmania in suspected patients of CL using PCR-RFLP and DNA sequencing. METHODS: This study was conducted from Oct 2015 to Oct 2016. The samples were collected from the individuals clinically suspected to CL and referred to Iran Shahr, Chabahar, Khash, Zabol, Zahedan, Mirjaveh, and Nikshahr health centers. Overall, 700 Giemsa-Stained slides from the wound of patients suspected of CL were passive collected and examined under a light microscope at ×1000. After DNA extraction, positive samples were used for Cyt b detection by PCR-RFLP to determine the parasite species. One hundred positive slides were selected for molecular studies. Among positive samples, 20% were sequenced. To compare the results of sequences, molecular evolutionary genetic analysis (MEGA6) was used. RESULTS: Overall, 53 samples were identified as L. major and 47 samples (47%) L. tropica. Cyt b in L. major and L. tropica is converted to 400 and 480 bp and 130, 215 and 535 bp pieces respectively. In the isolated L. tropica and L. major, nucleotide changes were 3-5 (mainly in wobble site). CONCLUSION: Infection was more related to L. major. PCR-RFLP method has a high sensitivity for diagnosis of Leishmania species.

Evaluation of iNOS Expression in Esophageal Cancer Patients.

BACKGROUND: Esophageal cancer is a public health concern around the world; this cancer is the sixth leading cause of death of cancer in the world with about 386,000 deaths per year. Its risk factors include environmental factors such as tobacco smoke, gastroesophageal reflux and genetic changes. iNOS is stated by the effect of various inflammatory factors and is thus called inducible NOS. Investigating iNOS expression is a powerful tool for understanding effective molecular parameters at tissue and cellular responses to external factors. In this research work, iNOS expression in patients with esophageal cancer was studied in Iran. MATERIALS AND METHODS: 15 formalin-fixed and paraffin-embedded (FFPE) esophageal cancer tissue samples and 15 normal FFPE samples were collected from various medical centers (Zabol, Zahedan, Kashan) to measure iNOS expression by real-time reverse transcriptase polymerase chain reaction (real-time RT-PCR). All PCR reactions were conducted by three replicates for iNOS and internal control (ß-actin) by 2-ΔΔCT (Livak) method. Differences were measured in target gene expression in patients and control group using the t test. All statistical analyses were done using the SPSS software. RESULTS: The results showed that there was no significant difference between iNOS expression in the case and control groups (p > 0.05); however, there was an increase in iNOS expression in the case group. On the other hand, there was a significant difference between iNOS expression in males and females in the two groups of healthy subjects and patients, and it was higher in women than in men. CONCLUSION: Further studies need to be conducted with larger sample sizes and in other populations to validate these findings.

Study the effect of F17S mutation on the chimeric Bacillus thermocatenulatus lipase.

Lipases (triacylglycerol acylhydrolase, EC 3.1.1.3) are one of the highest value commercial enzymes as they have potential applications in biotechnology for detergents, food, pharmaceuticals, leather, textiles, cosmetics, and paper industries; and are currently receiving considerable attention because of their potential applications in biotechnology. Bacillus thermocatenulatus Lipase 2 (BTL2) is one of the most important research targets, because of its potential industrial applications. In this study, the effect of substitution Phe17 with Ser in mutated BTL2 lipase, which conserved pentapeptide (112Ala-His-Ser-Gln-Gly116) was replaced with similar sequences (207Gly-Glu-Ser-Ala-Gly211) of Candida rugosa lipase (CLR) at the nucleophilic elbow region. Docking results confirmed the mutated lipase to be better than the chimeric lipase. So, cloning was conducted, and the mutated and chimeric btl2 genes were expressed in Escherichia coli, and then the enzymes were purified by anion exchange chromatography. The mutation increased lipase lipolytic activity against most of the applied substrates, with the exception of tributyrin when compared with chimeric lipase. Further, the mutated lipase exhibited higher activity than the chimeric lipase at all temperatures. Optimum pH of the mutated lipase was obtained at pH 9.5, which was more than the chimeric one. Enzyme activity of the mutated lipase in the presence of organic solvents, detergents, and metal ions was also improved than the chimeric lipase.

Promyelocytic Leukemia (PML) Gene Mutations may not Contribute to Gastric Adenocarcinoma Development.

Gastric cancer is the second most common cause of cancer death worldwide. Environmental as well as genetic factors have been shown to be involved in its genesis. Among genetic factors, loss of function of a tumor suppressive gene named promyelocytic leukemia (PML) has been demonstrated in gastric cancer. In order to cast light in the mechanism by which PML protein is under-expressed in gastric cancer cells, we analyzed all exons and intron-exon boundaries of PML gene in 50 formalin-fixed paraffin-embedded tissue blocks from gastric carcinoma tumors by means of PCR-SSCP and CSGE, with direct sequencing of abnormally shifted bands. We found a novel sequence variant of unknown significance localized in intron 5 in 3 samples (c.1398+84delA). We did not detect any deleterious mutations of the PML gene. This study shows that PML mutations may not contribute to gastric adenocarcinoma development. Post-translational modifications or protein degradation might be mechanisms by which PML is not expressed in gastric tumors.

The effect of nicotine on the expressions of the α7 nicotinic receptor gene and Bax and Bcl-2 proteins in the mammary gland epithelial-7 breast cancer cell line and its relationship to drug resistance.

The binding of nicotine with nicotinic acetylcholine receptors (nAChRs) stimulates cell division and increases drug resistance in cancer. Experiments with specific inhibitors such as RNAi, hexamethonium, and α-bungarotoxin showed that α7 nicotinic receptor plays a key role in the pro-proliferation activity of nicotine. However, the mechanism of nicotine in the progress of breast cancer, the commonest malignancy in women, remains unknown. This study focuses on the effect of nicotine on the expressions of the α7 nicotinic receptor gene and Bax and Bcl-2 proteins in mammary gland epithelial-7 (MCF-7) breast cancer cells and its relationship to drug resistance. To evaluate the effect on drug resistance, human mammary gland epithelial adenocarcinomas from the MCF-7 line were exposed to 100 µl of nicotine at a concentration of 9.2 mg/ml for varying periods of time. Then, the cells were treated with 1, 2, 3 or 5 µl/ml of doxorubicin, either with or without the continued presence of nicotine. Cell viability was determined using the MTT assay. The biochemical parameters of apoptosis, including the expressions of Bax, Bcl-2 and α7 nicotinic receptor proteins were determined via western blotting, and the α7 nicotinic receptor gene expression level was assessed via real-time qPCR using the 2(-ΔΔCt) method. Differences in the target gene expression levels were evaluated with ANOVA with p ≤ 0.05 considered significant. We found a novel and effective signaling pathway of nicotine in the MCF-7 breast cancer cell line. The levels of α7 nicotinic receptor and Bcl-2 protein increased but the Bax protein levels decreased, while the α7 nicotinic receptor gene expression level was not significantly different compared with the control.

Association of the human astrocyte elevated gene-1 promoter variants with susceptibility to hepatocellular carcinoma.

Central role of astrocyte elevated gene-1 (AEG-1) in regulating diverse aspects of hepatocellular carcinoma (HCC) pathogenesis and association of its overexpression with HCC progression has been demonstrated. The positive regulatory regions of AEG-1 promoter contain several putative transcription factor binding sites critical for basal promoter activity. In this study, the aim was to explore the association of AEG-1 promoter variant with HCC. In this study, the human AEG-1 promoter including the region -538 to -42 was explored in 53 HCC patients and 108 healthy controls. The polymerase chain reaction-sequencing method was used for investigating AEG-1 promoter polymorphisms. A novel mutation in AEG-1 promoter in human HCC patients at a potential AP-2 binding site was explored. An A>C mutation was observed in -483 of AEG-1 promoter in 4 out of 53 HCC patients but not in 108 control individuals. Sequencing data showed genetic variations in 11 HCC patients and 3 healthy controls. Among them, one novel SNP was found in activator protein-1 (AP2), a transcription factor binding site (-483 A to C) that may be associated with the susceptibility to HCC (P = 0.012) but no associations were found for other observed variations. This mutation could be tumor-specific. AEG-1 promoter variant -483 A>C may be associated with the susceptibility to HCC in Iranian population. To our knowledge, this is the first study that has reported this association with the susceptibility to HCC. Therefore, further studies need to be conducted in larger sample sizes and other populations to validate these findings.

Listeria Monocytogenes La111 and Klebsiella Pneumoniae KCTC 2242: Shine-Dalgarno Sequences.

Listeria monocytogenes can cause serious infection and recently, relapse of listeriosis has been reported in leukemia and colorectal cancer, and the patients with Klebsiella pneumoniae are at increased risk of colorectal cancer. Translation initiation codon recognition is basically mediated by Shine-Dalgarno (SD) and the anti-SD sequences at the small ribosomal RNA (ssu rRNA). In this research, Shine-Dalgarno sequences prediction in Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 was investigated. The whole genomic sequence of Listeria monocytogenes La111 and Klebsiella pneumoniae KCTC 2242 were retrieved from http://www.ncbi.nlm.nih.gov/ (Listeria monocytogenes La111 NCBI Reference sequence: NC_020557; Klebsiella pneumoniae KCTC 2242 NCBI Reference sequence: CP002910) in order to be analyzed with DAMBE software and BLAST. The results showed that the consensus sequence for Klebsiella pneumoniae KCTC 2242 was CCCCCCCUCCCCCUCCCCCUCCUCCUCCUUUUUAAAAAAGGGGAAAAACC and for Listeria monocytogenes La111 was CCCCCCCUCCCCCUUUCCCUCCUAUUCUUAUAAAAGGGGG-GGGGUUCAC. The PSD was higher in Listeria monocytogenes La111 compared to Klebsiella pneumoniae KCTC 2242 (0.9090> 0.8618). The results showed that Nm in Listeria monocytogenes La111 was higher than Klebsiella pneumoniae KCTC 2242 (4.5846> 4.4862). Accurate characterization of SD sequences may increase our knowledge on how an organism's transcriptome is related to its cellular proteome.

Artificial neural network analysis in preclinical breast cancer.

OBJECTIVE: In this study, artificial neural network (ANN) analysis of virotherapy in preclinical breast cancer was investigated. MATERIALS AND METHODS: In this research article, a multilayer feed-forward neural network trained with an error back-propagation algorithm was incorporated in order to develop a predictive model. The input parameters of the model were virus dose, week and tamoxifen citrate, while tumor weight was included in the output parameter. Two different training algorithms, namely quick propagation (QP) and Levenberg-Marquardt (LM), were used to train ANN. RESULTS: The results showed that the LM algorithm, with 3-9-1 arrangement is more efficient compared to QP. Using LM algorithm, the coefficient of determination (R(2)) between the actual and predicted values was determined as 0.897118 for all data. CONCLUSION: It can be concluded that this ANN model may provide good ability to predict the biometry information of tumor in preclinical breast cancer virotherapy. The results showed that the LM algorithm employed by Neural Power software gave the better performance compared with the QP and virus dose, and it is more important factor compared to tamoxifen and time (week).

Hepatitis C virus and vaccine development.

The prevalence of Hepatitis C virus (HCV) is approximately 3% around the world. This virus causes chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. The effectiveness of interferon-α and ribavirin therapy is about 50% and is associated with significant toxicity and cost. Hence, generating new vaccines or drugs is an obligation. However, there is no vaccine available for clinical use. DNA vaccines have some advantages such as producing feasibility and generating intensive cellular and humoral immune responses. Activation and improvement of natural immune defense mechanisms is a necessity for the development of an effective HCV vaccine. This article discusses the current status of therapies for hepatitis C, the promising new therapies and the experimental strategies to develop an HCV vaccine.

Functional motifs in Escherichia coli NC101.

Escherichia coli (E. coli) bacteria can damage DNA of the gut lining cells and may encourage the development of colon cancer according to recent reports. Genetic switches are specific sequence motifs and many of them are drug targets. It is interesting to know motifs and their location in sequences. At the present study, Gibbs sampler algorithm was used in order to predict and find functional motifs in E. coli NC101 contig 1. The whole genomic sequence of Escherichia coli NC101 contig 1 were retrieved from http://www.ncbi.nlm.nih.gov (NCBI Reference sequence: NZ_AEFA01000001.1) in order to be analyzed with DAMBE software and BLAST. The results showed that the 6-mer motif is CUGGAA in most sequences (genes1-3, 8, 9, 12, 14-18, 20-23, 25, 27, 29, 31-34), CUUGUA for gene 4 , CUGUAA for gene 5, CUGAUG for gene 6, CUGAUA for gene7, CUGAAA for genes 10, 11, 13, 26, 28, and CUGGAG for gene 19, and CUGGUA for gene30 in E. coli NC101 contig 1. It is concluded that the 6-mer motif is CUGGAA in most sequences in E. coli NC101 contig1. The present study may help experimental studies on elucidating the pharmacological and phylogenic functions of the motifs in E. coli.

Virotherapy in cancer.

New cancer therapies with novel mechanisms and functions are needed to treatpatients with different cancers. Virotherapy is a good scenario for such treatment. The advantages of virotherapy include the potential lack of cross resistance with standard therapies and the ability to cause tumor destruction by numerous mechanisms. Oncolytic virus not only possesses unique mechanisms of action that are distinct from other treatment modalities, its self-perpetuating nature provides an ideal platform for therapeutic transgenic insertion. In this review article, a variety of oncolytic viruses in cancer gene therapy will be described.

Translation Elongation Rate Measurement of Epstein-Barr Virus Strain GD1.

BACKGROUND: Epstein-Barr Virus (EBV) has a great co relationship with human malignancies such as gastric carcinoma. Synonymous codon investigations in viruses could help designing vaccine, to generate immunity. Codon Adaptation Index (CAI) has measured translation elongation rate, among the highly expressed genes. The aim of this study was: usage of "CAI" to measure translation efficiency to know how fast EBV-GD1 could produce its proteins. METHODS: The complete genomic sequences of human herpes virus 4 strain GD1 have retrieved from (GenBank accession no. AY961628) to extract all protein-coding genes. The sequences have analyzed with DAMBE software. RESULTS: The results have shown that CAI values for the EBV-GD1 genes were 0.76356 ± 0.02957. The highest and lowest CAI values were 0.82233 and 0.68321 respectively. The results have shown that highly expressed genes mostly had more codon usage bias than low expressed genes. CONCLUSION: The results provide and introduce not only a system, but also the principles in order to understand the pathogenesis and evolution of EBV-GD1, to open a window, in order to make a better product or vaccine to challenge with the virus.

Effect of Neem Leaf Extract (Azadirachta indica) on c-Myc Oncogene Expression in 4T1 Breast Cancer Cells of BALB/c Mice.

OBJECTIVE: Breast cancer is the most common cause of cancer-related deaths in women both worldwide and in Malaysia. Azadirachta indica (A. Juss), commonly known as neem, is one of the most versatile medicinal plants that has gained worldwide prominence due to its medicinal properties. However, the anticancer effect of ethanolic neem leaf extract against breast cancer has not been documented. The purpose of the present study is to investigate the effect of neem leaf extract on c-Myc oncogene expression in 4T1 breast cancer BALB/c mice. MATERIALS AND METHODS: In this experimental study, A total of 48 female BALB/c mice were divided randomly into four groups of 12 mice per group: i.cancer control (CC) treated with 0.5% Tween 20 in PBS, ii. 0.5 µg/mL tamoxifen citrate (CT), iii. 250 mg/kg neem leaf extract (C250), and iv. 500 mg/kg neem leaf extract (C500). in situ reverse transcription polymerase chain reaction (in situ RT-PCR) was applied to evaluate suppression of c-Myc oncogene expression in breast cancer tissue. RESULTS: The C500 group showed significant (p<0.05) suppression of c-Myc oncogene expression compared to the CC group. CONCLUSION: c-Myc was found to be down regulated under the effect of 500 mg/kg ethanolic neem leaf extract.

Extract of Azadirachta indica (Neem) Leaf Induces Apoptosis in 4T1 Breast Cancer BALB/c Mice.

OBJECTIVE: Azadirachta indica (Neem) has been used traditionally for many centuries. Some impressive therapeutic qualities have been discovered. However, the therapeutic effect of neem leaf extract in 4T1 breast cancer has not been documented. The purpose of the present study is to investigate the therapeutic effect of ethanolic Neem leaf extract in an in vivo 4T1 breast cancer model in mice. MATERIALS AND METHODS: A total of 84 female BALB/c mice were divided randomly into 7 groups (3 non-cancerous groups and 4 cancerous groups) consisting of 12 mice per group. The 3 non-cancerous groups were normal mice treated with 0.5% of Tween 20 in phosphate buffer saline (PBS) (NC), 250 mg/kg Neem (N250) or 500 mg/kg Neem (N500). The 4 cancerous groups were; cancer controls treated with 0.5% of Tween 20 in PBS (CC), and cancerous mice treated with 0.5 µg/mL tamoxifen citrate (CT), 250 mg/kg Neem leaf extract (CN 250) or 500 mg/kg Neem leaf extract (CN 500). Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assays were used to evaluate apoptosis (cell death) in the breast cancer tissues. SPSS software, version 14 was used for statistical analysis. Statistical significance was defined as p≤0.05. Non parametric analysis of variance (ANOVA) was performed with the Kruskal Wallis test for the TUNEL assays. Parametric data among the groups was compared using ANOVA. RESULTS: TUNEL assays showed that the CN 250 and CN 500 groups had a higher incidence of apoptosis compared with the cancer controls. CONCLUSION: The findings showed that neem leaf extract induces apoptosis in 4T1 breast cancer BALB/c mice.