A New Leaf Blight of Rice Caused by Pantoea ananatis in India.

In September 2008, a new blight disease appeared on basmati rice (Oryza sativa L.) in fields in the northern states of India, including Uttar Pradesh, Haryana, and Punjab. First symptoms were water-soaked lesions at the tip of rice leaves. Lesions eventually spread down the leaf blades. Infected leaves turned light brown, exhibiting a blighted appearance. The disease was severe during the post-flowering stage. From 2008 to 2011, yellow-pigmented bacteria were consistently recovered on nutrient agar (beef extract 5 g, peptone 10 g, NaCl 5 g, and agar 20 g) from symptomatic rice leaves. The disease was thought to be caused by Xanthomonas oryzae pv. oryzae, the rice bacterial blight pathogen. However, physiological and molecular analysis of two strains (ITCC B0050 and ITCC B0055) isolated in 2008 revealed that the causal agent was the bacterium Pantoea ananatis. Colonies, raised and translucent with smooth margins, grew well within 24 h at 37°C. The bacteria are gram-negative facultative anaerobes with small rods arranged singly or in a chain of two to five cells. The bacteria are positive for catalase and indole production while negative for oxidase and alkaline reaction in malonate broth. Electron microscopy shows that the bacterial cells were 1.1 to 2.3 × 0.4 to 0.7 µm and have three to six peritrichous flagella. 16S rRNA gene sequence (1,535 nt generated by PCR with primers 5'AGAGTTTGATCATGGCTCAG3' and 5'AAGGAGGTGATCCAACCGCA3') of ITCC B0050 and ITCC B0055 (GenBank Nos. JF756690 and JF756691, respectively) share 99%-nt identity with P. ananatis (GenBank No. DQ512490.1). Biolog microbial identification analysis (version 4.2) of both strains showed similarity indices of 0.842 with P. ananatis (Biolog Inc., Hayward, CA). Pathogenicity was confirmed by employing the leaf tip clipping method to inoculate susceptible basmati rice (cv. Pusa basmati 1). Leaves were inoculated in triplicate with sterile water or a 1 × 108 CFU ml-1 suspension of each isolate in water. The artificially inoculated rice leaves produced water-soaked lesions similar to that observed during natural rice infection in the field. At 10 to 15 days postinoculation, the lesions on the inoculated leaves dried and turned from straw color to light brown. Yellow-pigmented bacteria were reisolated from the infected rice leaves and their identity was confirmed to be identical to the original strain by 16S rRNA sequence analysis and Biolog analysis. Both pathogen isolates elicited hypersensitive reaction in tobacco (Nicotiana tabacum cv. Xanthi) leaves 24 to 48 h postinoculation (1 × 108 CFU ml-1). These studies indicate that the causal agent of the newly emerged rice leaf blight disease in northern India is P. ananatis. Pantoea spp. are opportunistic pathogens documented to cause different diseases in economically important crop plants including grain discoloration of rice in China (1), leaf blight and bulb decay of onion in the United States (2), and leaf blight of rice in Korea (3). To our knowledge, this is the first report of rice leaf blight caused by P. ananatis in India. The significance of this pathogen to basmati rice production in India was not known until this report. The predominance of the disease in the major basmati-growing belts of northern India would certainly have great impact in reducing the yield potential of basmati rice. References: (1) H. Yan et al. Plant Dis. 94:482, 2010. (2) H. F. Schwartz and K. Otto. Plant Dis. 84:808, 2000. (3) H. B. Lee et al. Plant Dis. 94:1,372, 2010.

Importance of opgHXcv of Xanthomonas campestris pv. vesicatoria in host-parasite interactions.

Tn5 insertion mutants of Xanthomonas campestris pv. vesicatoria were inoculated into tomato and screened for reduced virulence. One mutant exhibited reduced aggressiveness and attenuated growth in planta. Southern blot analyses indicated that the mutant carried a single Tn5 insertion not associated with previously cloned pathogenicity-related genes of X. campestris pv. vesicatoria. The wild-type phenotype of this mutant was restored by one recombinant plasmid (pOPG361) selected from a genomic library of X. campestris pv. vesicatoria 91-118. Tn3-gus insertion mutagenesis and sequence analyses of a subclone of pOPG361 identified a 1,929-bp open reading frame (ORF) essential for complementation of the mutants. The predicted protein encoded by this ORF was highly homologous to the previously reported pathogenicity-related HrpM protein of Pseudomonas syringae pv. syringae and OpgH of Erwinia chrysanthemi. Based on homology, the new locus was designated opgHXcv. Manipulation of the osmotic potential in the intercellular spaces of tomato leaves by addition of mannitol at low concentrations (25 to 50 mM) compensates for the opgHXcv mutation.

Common and contrasting themes of plant and animal diseases.

Recent studies in bacterial pathogenesis reveal common and contrasting mechanisms of pathogen virulence and host resistance in plant and animal diseases. This review presents recent developments in the study of plant and animal pathogenesis, with respect to bacterial colonization and the delivery of effector proteins to the host. Furthermore, host defense responses in both plants and animals are discussed in relation to mechanisms of pathogen recognition and defense signaling. Future studies will greatly add to our understanding of the molecular events defining host-pathogen interactions.

Mutational analysis of the Arabidopsis RPS2 disease resistance gene and the corresponding pseudomonas syringae avrRpt2 avirulence gene.

Plants have evolved a large number of disease resistance genes that encode proteins containing conserved structural motifs that function to recognize pathogen signals and to initiate defense responses. The Arabidopsis RPS2 gene encodes a protein representative of the nucleotide-binding site-leucine-rich repeat (NBS-LRR) class of plant resistance proteins. RPS2 specifically recognizes Pseudomonas syringae pv. tomato strains expressing the avrRpt2 gene and initiates defense responses to bacteria carrying avrRpt2, including a hypersensitive cell death response (HR). We present an in planta mutagenesis experiment that resulted in the isolation of a series of rps2 and avrRpt2 alleles that disrupt the RPS2-avrRpt2 gene-for-gene interaction. Seven novel avrRpt2 alleles incapable of eliciting an RPS2-dependent HR all encode proteins with lesions in the C-terminal portion of AvrRpt2 previously shown to be sufficient for RPS2 recognition. Ten novel rps2 alleles were characterized with mutations in the NBS and the LRR. Several of these alleles code for point mutations in motifs that are conserved among NBS-LRR resistance genes, including the third LRR, which suggests the importance of these motifs for resistance gene function.

Disruption of signaling by Yersinia effector YopJ, a ubiquitin-like protein protease.

Homologs of the Yersinia virulence effector YopJ are found in both plant and animal bacterial pathogens, as well as plant symbionts. These YopJ family members were shown to act as cysteine proteases. The catalytic triad of the protease was required for inhibition of the mitogen-activated protein kinase (MAPK) and nuclear factor kappaB (NF-kappaB) signaling in animal cells and for induction of localized cell death in plants. The substrates for YopJ were shown to be highly conserved ubiquitin-like molecules, which are covalently added to numerous regulatory proteins. YopJ family members exert their pathogenic effect on cells by disrupting this posttranslational modification.

Molecular signals required for type III secretion and translocation of the Xanthomonas campestris AvrBs2 protein to pepper plants.

Strains of Xanthomonas campestris pv. vesicatoria (Xcv) carrying avrBs2 are specifically recognized by Bs2 pepper plants, resulting in localized cell death and plant resistance. Agrobacterium-mediated transient expression of the Xcv avrBs2 gene in plant cells results in Bs2-dependent cell death, indicating that the AvrBs2 protein alone is sufficient for the activation of disease resistance-mediated cell death in planta. We now provide evidence that AvrBs2 is secreted from Xcv and that secretion is type III (hrp) dependent. N- and C-terminal deletion analysis of AvrBs2 has identified the effector domain of AvrBs2 recognized by Bs2 pepper plants. By using a truncated Pseudomonas syringae AvrRpt2 effector reporter devoid of type III signal sequences, we have localized the minimal region of AvrBs2 required for type III secretion in Xcv. Furthermore, we have identified the region of AvrBs2 required for both type III secretion and translocation to host plants. The mapping of AvrBs2 sequences sufficient for type III delivery also revealed the presence of a potential mRNA secretion signal.

Characterization of the Pseudomonas syringae pv. tomato AvrRpt2 protein: demonstration of secretion and processing during bacterial pathogenesis.

Pseudomonas syringae pv. tomato strain DC3000 (Pst DC3000) expressing avrRpt2 is specifically recognized by plant cells expressing RPS2 activity, resulting in localized cell death and plant resistance. Furthermore, transient expression of this bacterial avrRpt2 gene in plant cells results in RPS2-dependent cell death. This indicates that the AvrRpt2 protein is recognized inside RPS2 plant cells and is sufficient for the activation of disease resistance-mediated cell death in planta. We explored the possibility that Pst DC3000 delivers AvrRpt2 protein to plant cells via the hrp (type III) secretion pathway. We now provide direct evidence that mature AvrRpt2 protein is secreted from Pst DC3000 and that secretion is hrp dependent. We also show that AvrRpt2 is N-terminally processed when Arabidopsis thaliana plants are infected with Pst DC3000 expressing avrRpt2. Similar N-terminal processing of AvrRpt2 occurred when avrRpt2 was stably expressed in A. thaliana. No cleavage of AvrRpt2 was detected in bacteria expressing avrRpt2 in culture or in the plant extracellular fluids. The N-terminus of AvrRpt2 was not required for RPS2 recognition in planta. However, this region of AvrRpt2 was essential for Pst DC3000-mediated elicitation of RPS2-dependent cell death in A. thaliana leaves.

Glucocorticoid-inducible expression of a bacterial avirulence gene in transgenic Arabidopsis induces hypersensitive cell death.

Pathogenic strains of Pseudomonas syringae pv. tomato carrying the avrRpt2 avirulence gene specifically induce a hypersensitive cell death response in Arabidopsis plants that contain the complementary RPS2 disease resistance gene. Transient expression of avrRpt2 in Arabidopsis plants having the RPS2 gene has been shown to induce hypersensitive cell death. In order to analyze the effects of conditional expression of avrRpt2 in Arabidopsis plants, transgenic lines were constructed that contained the avrRpt2 gene under the control of a tightly regulated, glucocorticoid-inducible promoter. Dexamethasone-induced expression of avrRpt2 in transgenic lines having the RPS2 gene resulted in a specific hypersensitive cell death response that resembled a Pseudomonas syringae-induced hypersensitive response and also induced the expression of a pathogenesis-related gene (PR1). Interestingly, high level expression of avrRpt2 in a mutant rps2-101C background resulted in plant stress and ultimately cell death, suggesting a possible role for avrRpt2 in Pseudomonas syringae virulence. Transgenic RPS2 and rps2 plants that contain the glucocorticoid-inducible avrRpt2 gene will provide a powerful new tool for the genetic, physiological, biochemical, and molecular dissection of an avirulence gene-specified cell death response in both resistant and susceptible plants.

Protein signaling via type III secretion pathways in phytopathogenic bacteria.

Progress in the genetic and biochemical dissection of the hrp-encoded type III secretion pathway has revealed new mechanisms by which phytopathogenic bacteria infect plants. The suggestion that bacterial gene products are 'delivered to' and 'perceived by' plants cells has fundamentally changed the way in which plant-bacterial interactions are now being viewed.

Protein repair L-isoaspartyl methyltransferase in plants. Phylogenetic distribution and the accumulation of substrate proteins in aged barley seeds.

Protein L-isoaspartate (D-aspartate) O-methyltransferases (MTs; EC 2.1.1.77) can initiate the conversion of detrimental L-isoaspartyl residues in spontaneously damaged proteins to normal L-aspartyl residues. We detected this enzyme in 45 species from 23 families representing most of the divisions of the plant kingdom. MT activity is often localized in seeds, suggesting that it has a role in their maturation, quiescence, and germination. The relationship among MT activity, the accumulation of abnormal protein L-isoaspartyl residues, and seed viability was explored in barley (Hordeum vulgare cultivar Himalaya) seeds, which contain high levels of MT. Natural aging of barley seeds for 17 years resulted in a significant reduction in MT activity and in seed viability, coupled with increased levels of "unrepaired" L-isoaspartyl residues. In seeds heated to accelerate aging, we found no reduction of MT activity, but we did observe decreased seed viability and the accumulation of isoaspartyl residues. Among populations of accelerated aged seed, those possessing the highest levels of L-isoaspartyl-containing proteins had the lowest germination percentages. These results suggest that the MT present in seeds cannot efficiently repair all spontaneously damaged proteins containing altered aspartyl residues, and their accumulation during aging may contribute to the loss of seed viability.

A distinctly regulated protein repair L-isoaspartylmethyltransferase from Arabidopsis thaliana.

Protein-L-isoaspartate (D-aspartate) O-methyltransferases (EC 2.1.1.77) that catalyze the transfer of methyl groups from S-adenosylmethionine to abnormal L-isoaspartyl and D-aspartyl residues in a variety of peptides and proteins are widely distributed in procaryotes and eucaryotes. These enzymes participate in the repair of spontaneous protein damage by facilitating the conversion of L-isoaspartyl and D-aspartyl residues to normal L-aspartyl residues. In this work, we have identified an L-isoaspartyl methyltransferase activity in Arabidopsis thaliana, a dicotyledonous plant of the mustard family. The highest levels of activity were detected in seeds. Using degenerate oligonucleotides corresponding to two highly conserved amino acid regions shared among the Escherichia coli, wheat, and human enzymes, we isolated and sequenced a full-length genomic clone encoding the A. thaliana methyltransferase. Several methyltransferase cDNAs were also characterized, including ones that would encode full-length polypeptides of 230 amino acid residues. Messenger RNAs for the A. thaliana enzyme were found in a variety of tissues that did not contain significant amounts of active enzyme suggesting the possibility of translational or posttranslational controls on methyltransferase levels. We have identified a putative abscisic acid-response element (ABRE) in the 5'-untranslated region of the A. thaliana L-isoaspartyl methyltransferase gene and have shown that the expression of the mRNA is responsive to exogenous abscisic acid (ABA), but not to the environmental stresses of salt or drought. The expression of the A. thaliana enzyme appears to be regulated in a distinct fashion from that seen in wheat or in animal tissues.

Hormonal and environmental responsiveness of a developmentally regulated protein repair L-isoaspartyl methyltransferase in wheat.

The L-isoaspartyl protein methyltransferase (EC 2.1.1.77) has been proposed to be involved in the repair of spontaneously damaged proteins by facilitating the conversion of abnormal L-isoaspartyl residues to normal L-aspartyl residues. Based on the abundance of this enzyme in the seeds of a variety of plants and its unique substrate specificity, it has been hypothesized that it functions to prevent the accumulation of abnormal aspartyl residues in the proteins of aging seeds that can limit the viability of the embryo or its chances for germination. In this work, we show that the expression of the L-isoaspartyl methyltransferase is under developmental regulation in the winter wheat, Triticum aestivum. Methyltransferase mRNA and active enzyme are first detected in seeds during the late stages (III-IV) of caryopsis development. As mature seeds germinate, methyltransferase mRNA levels decline and are nearly undetectable by 72 h post-imbibition. Enzyme activity remains constant for 24 h post-imbibition and then decreases rapidly following the reduction of its corresponding mRNA. Methyltransferase activity is very low or undetectable in wheat seedlings, including leaf and root tissues. We show, however, that the L-isoaspartyl methyltransferase can be induced in vegetative tissues in response to hormone treatment and environmental stress. Abscisic acid, a phytohormone involved in seed development and desiccation tolerance, induces both methyltransferase mRNA and enzyme activity in 4-day-old wheat seedlings. Dehydration and salt stress also induce its transcription and enzymatic activity in seedlings. The ability of a plant to regulate methyltransferase activity in its seeds and vegetative tissues in response to desiccation, aging, and environmental stress may allow the plant to efficiently repair protein damage associated with these physiological changes.

Characterization of plant L-isoaspartyl methyltransferases that may be involved in seed survival: purification, cloning, and sequence analysis of the wheat germ enzyme.

Protein carboxyl methyltransferases (EC 2.1.1.77) that catalyze the transfer of a methyl group from S-adenosylmethionine to L-isoaspartyl and D-aspartyl residues in a variety of peptides and proteins are widely, but not universally, distributed in nature. These enzymes can participate in the repair of damaged proteins by facilitating the conversion of abnormal L-isoaspartyl residues to normal L-aspartyl residues. In this work, we have identified L-isoaspartyl methyltransferase activity in a variety of higher plant species and a green alga. Interestingly, the highest levels of methyltransferase were located in seeds, where the problem of spontaneous protein degradation may become particularly severe upon aging. The wheat germ methyltransferase was purified as a monomeric 28,000-Da species by DEAE-cellulose chromatography, reverse ammonium sulfate gradient solubilization, and gel filtration chromatography. The purified enzyme recognized a variety of L-isoaspartyl-containing peptides, but did not recognize two D-aspartyl-containing peptides that are substrates for the mammalian enzyme. The partial amino acid sequence was utilized to design oligonucleotides to isolate a full-length cDNA clone, pMBM1. Its nucleotide sequence demonstrated an open reading frame encoding a polypeptide of 230 amino acid residues with a calculated molecular weight of 24,710. This sequence shares 31% identity with the L-isoaspartyl methyltransferase from Escherichia coli and 50% identity with the L-isoaspartyl/D-aspartyl methyltransferase from human erythrocytes. Such conservation in sequence is consistent with a fundamental role of this enzyme in the metabolism of spontaneously damaged polypeptides.