Proliferating brain cells are a target of neurotoxic CSF in systemic autoimmune disease.

Brain atrophy, neurologic and psychiatric (NP) manifestations are common complications in the systemic autoimmune disease, lupus erythematosus (SLE). Here we show that the cerebrospinal fluid (CSF) from autoimmune MRL-lpr mice and a deceased NP-SLE patient reduce the viability of brain cells which proliferate in vitro. This detrimental effect was accompanied by periventricular neurodegeneration in the brains of autoimmune mice and profound in vivo neurotoxicity when their CSF was administered to the CNS of a rat. Multiple ionic responses with microfluorometry and protein peaks on electropherograms suggest more than one mechanism of cellular demise. Similar to the CSF from diseased MRL-lpr mice, the CSF from a deceased SLE patient with a history of psychosis, memory impairment, and seizures, reduced viability of the C17.2 neural stem cell line. Proposed mechanisms of cytotoxicity involve binding of intrathecally synthesized IgG autoantibodies to target(s) common to different mammalian species and neuronal populations. More importantly, these results indicate that the viability of proliferative neural cells can be compromised in systemic autoimmune disease. Antibody-mediated lesions of germinal layers may impair the regenerative capacity of the brain in NP-SLE and possibly, brain development and function in some forms of CNS disorders in which autoimmune phenomena have been documented.

Role of ELAV-like RNA-binding proteins HuD and HuR in the post-transcriptional regulation of acetylcholinesterase in neurons and skeletal muscle cells.

Over the last few years, several laboratories have focused their attention on elucidating the molecular events that control the expression and localization of acetylcholinesterase (AChE) in neurons and skeletal muscle cells. In this context, results from a number of studies have clearly shown the important contribution of transcriptional events in regulating AChE expression. Specifically, these studies have highlighted the roles of several cis- and trans-acting factors that control transcription of the AChE gene in these excitable cells. However, it has also become apparent that changes in the transcriptional activity of the AChE gene cannot fully account for the alterations seen in the overall abundance of AChE transcripts in neurons and muscle cells placed under a variety of experimental conditions. This indicates, therefore, that post-transcriptional mechanisms also play a significant role in controlling AChE mRNA expression. With this in mind, we have recently begun to address this issue in greater detail. Here, we provide a summary of our most recent findings dealing with the post-transcriptional regulation of AChE. Together, our studies have shown so far the important contribution of an AU-rich element located in the 3'UTR of AChE transcripts and of the stabilizing RNA-binding proteins of the ELAV-like family in regulating AChE expression in differentiating neuronal and muscle cells.

Ascorbate uptake in pig coronary artery endothelial cells.

Although smooth muscle and endothelial cells in pig coronary artery are morphologically and functionally distinct, ascorbate uptake has been characterized only in smooth muscle cells. Ascorbate transporters in kidney and intestinal epithelial cells differ from those in smooth muscle. We examined ascorbate transport and mRNA expression of sodium-dependent vitamin C transporters (SVCT) by RT-PCR in the pig coronary artery endothelial cell cultures. When 14C-ascorbate uptake in endothelial cells was examined as 14C or by HPLC, the two values did not differ from each other. 14C-ascorbate uptake was Na(+)-dependent, stereoselective for L-ascorbate and inhibited by sulfinpyrazone. The kinetic characteristics of the uptake were: Km = 27 +/- 3 microM (Hill coefficient = 1) for ascorbate and Km = 73 +/- 14 mM (Hill coefficient = 2) for Na+. Surprisingly, endothelial cells had similar kinetic parameters as smooth muscle cells, except for a slightly lower uptake velocity in endothelial cells. Comparison with the smooth muscle showed that both tissue types expressed mRNA for SVCT2. Endothelial cells differ from epithelial cells which express mainly SVCT1 but resemble smooth muscle cells in this respect.

The RNA-binding protein HuR binds to acetylcholinesterase transcripts and regulates their expression in differentiating skeletal muscle cells.

During myogenic differentiation, acetylcholinesterase (AChE) transcript levels are known to increase dramatically. Although this increase can be attributed in part to increased transcriptional activity, posttranscriptional mechanisms have also been implicated in the high levels of AChE mRNA in myotubes. In this study, we observed that transfection of a luciferase reporter construct containing the full-length AChE 3'-untranslated region (UTR) resulted in significantly higher (5-fold) luciferase activity in differentiated myotubes versus myoblasts. RNA-electrophoretic mobility shift assays (REMSAs) performed with a full-length AChE 3'-UTR probe and the AU-rich element revealed that the intensity of RNA-binding protein complexes increased as myogenic differentiation proceeded. Using several complementary approaches including supershift REMSA, mRNA-binding protein pull-down assays, and immunoprecipitation followed by reverse transcription-PCR, we found that the mRNA-stabilizing protein HuR interacts directly with AChE transcripts. Stable overexpression of HuR in C2C12 cells increased the expression of endogenous AChE transcripts as well as that of the luciferase reporter construct containing the AChE 3'-UTR. In vitro stability assays performed with protein extracts from these cells versus controls resulted in a slower rate of AChE mRNA decay. The down-regulation of HuR expression mediated through small interfering RNA further confirmed the role of HuR in the regulation of AChE mRNA levels. Taken together, these studies demonstrate that HuR interacts with the AChE 3'-UTR to regulate posttranscriptionally the expression of AChE mRNA during myogenic differentiation.

Role of cis-acting elements in the control of SERCA2b Ca2+ pump mRNA decay by nuclear proteins.

Alternative splicing at position 3495 b yields SERCA2 (sarco/endoplasmic reticulum Ca2+ pump 2) RNA species, namely SERCA2a and SERCA2b which differ in 3'-end regions. This results in SERCA2b RNA being less stable. In vitro decay experiments show that, in the presence of protein extracts from nuclei of LVMs (left ventricular myocytes), the rate of decay of both SERCA2b RNA and synthetic RNA from its 3'-region is greater than that of the corresponding SERCA2a RNA. To search for cis-acting instability elements in the 3'-region of SERCA2b, we examined the effects of LVM nuclear protein extracts on the in vitro decay of six short overlapping capped [m7G(5')ppp(5')Gm] and polyadenylated (A40) RNA fragments from the 3'-end region (3444-4472) of SERCA2b. The proximal fragment 2B1 (3444-3753) was the most unstable. 2B1 RNA without a cap or a polyadenylated tail was analysed further in electrophoretic mobility-shift assays, and was observed to bind to protein(s) in the nuclear extracts. Based on competition for binding to nuclear proteins between radiolabelled 2B1 RNA and short unlabelled RNA fragments, the cis-acting element involved in this binding was the sequence 2B1-4. 2B1-4 is a 35-base (3521-3555, CCAGUCCUGCUCGUUGUGGGCGUGCACCGAGGGGG) GC-rich region just past the splice site (3495). Nuclear extracts decreased the electrophoretic mobility of the radiolabelled 2B1-4 RNA which bound to two proteins (19 and 21 kDa) in cross-linking experiments. Excess 2B1-4 RNA decreased the decay of the 2B1 RNA by the nuclear protein extract. 2B1-del 4 RNA (2B1 with the 2B1-4 domain deleted) also decayed more slowly than the control 2B1 RNA. Thus SERCA2b contains a novel GC-rich cis-acting element involved in its decay by nuclear proteins.

Control of SERCA2a Ca2+ pump mRNA stability by nuclear proteins: role of domains in the 3'-untranslated region.

Alternative splicing of the sarco/endoplasmic reticulum (SERCA2) Ca2+ pump transcript generates the two isoforms: SERCA2a in left ventricular myocytes (LVM) and SERCA2b in most tissues. Nuclear protein extracts from left ventricular myocytes can cause a decay of the 3'-region of the SERCA2a. To determine if all the domains in the 800 b SERCA2a 3'-end region (3344-4243) are equally stable, we examined in vitro decay of synthetically capped, polyadenylated overlapping RNA fragments 2A1-2A6 from the 3'-end region of SERCA2a. Whereas 2A1-2A5 RNAs were stable, the distal fragment 2A6 (4135-4243 b) decayed rapidly. Deleting the 2A6 sequence from the 800-b 3'-end region increased its stability. In mobility shift assays, 2A6 bound to protein(s) in the LVM nuclear extracts in a specific manner: unlabelled 2A6 or the 800 b 3'-region RNA competed for binding but poly A, poly U, and poly C RNA did not. Secondary structure analysis revealed three hairpin loops in 2A6. Experiments using small synthetic RNA fragments for competition with 2A6 binding to nuclear proteins were consistent with a model involving the three hairpin loops. Thus, the secondary structure of the distal domain of SERCA2a RNA may be important in regulating its stability.

Role of transient receptor potential canonical 6 (TRPC6) in non-transferrin-bound iron uptake in neuronal phenotype PC12 cells.

Cells take up transferrin-bound iron or NTBI (non-transferrin-bound iron). After treatment with NGF (nerve growth factor), PC12 cells exhibited a neuronal phenotype and an increase in the NTBI uptake (55Fe2+ or 55Fe3+). We loaded the cells with the dye calcein, whose fluorescence increases in the presence of Ca2+ but is quenched with Fe2+ or Fe3+. When examined using calcein fluorescence or radioactive iron, DAG (diacylglycerol)-stimulated NTBI entry was more in NGF-treated PC12 cells compared with untreated cells. All experiments were performed at 1.5 mM extracellular Ca2+. Nramp2 (natural-resistance-associated macrophage protein 2) mRNA expression did not change after the NGF treatment. Expression of the bivalent cation entry protein TRPC6 (transient receptor potential canonical 6) was detected only in the NGF-treated cells. To verify that increased NTBI uptake depended on TRPC6, we examined whether transfecting HEK-293 (human embryonic kidney 293) cells with TRPC6 also increased the NTBI (55Fe) uptake. We also cotransfected HEK-293 cells with two plasmids, one expressing TRPC6 and the other expressing the fluorescent protein DsRED2 to identify the transfected cells. Challenging the calcein-loaded HEK-293 cells (which intrinsically express the a1-adrenergic receptors) with phenylephrine or a cell-permeant DAG increased the fluorescence signal more rapidly in transfected cells compared with untransfected cells. However, when iron (Fe2+ and Fe3+) was added before adding phenylephrine or DAG, the fluorescence intensity decreased more rapidly in transfected cells compared with untransfected cells, thereby indicating a greater stimulation of the NTBI uptake in cells expressing TRPC6. We postulate that the increase in the NTBI entry into neuronal PC12 cells is through TRPC6, a pathway that is unique since it is receptor-stimulated. Since neuronal cells express TRPC6, this pathway may have a role in neurotoxicity.

Sarcoplasmic reticulum Ca(2+) pump mRNA stability in cardiac and smooth muscle: role of the 3'-untranslated region.

Stomach smooth muscle (SSM) and left ventricular muscle (LVM) express the sarco(endo)plasmic reticulum Ca(2+)-ATPase (SERCA) pump gene SERCA2. Alternative splicing yields two major isoforms, SERCA2a in LVM and slow twitch muscle and SERCA2b in SSM and most other tissues. The splices have different 3'-untranslated regions (UTR) and also encode proteins that differ slightly in their COOH-terminal domains. SERCA2 transcription rates are similar in the two tissues, yet LVM has a much higher level of SERCA2 mRNA than SSM. To understand the control of SERCA2 RNA expression, we inhibited transcription and showed that the half-life of SERCA2 mRNA is significantly longer (P < 0.05) in primary cultures of LVM cells than in SSM cells. Nuclear SERCA2 mRNA levels were also higher in LVM than in SSM. In vitro decay assays using synthetic RNA corresponding to the 3'-UTR of SERCA2a and -2b showed that nuclear extracts produced a faster decay of SERCA2 RNA than cytoplasmic extracts and that nuclear extracts produced a faster decay of SERCA2b than -2a. This was also true when the full-length native mRNA was used instead of the 3'-UTR RNA, and SERCA2b decay by cytoplasmic extracts was faster for LVM than for SSM. We propose that nuclear decay is an initial step in the control of SERCA2 RNA abundance and that this control is maintained or modulated in the cytoplasm. We discuss how these control mechanisms may be part of a control switch in cardiac development and pathophysiology.

Dehydroascorbic acid uptake by coronary artery smooth muscle: effect of intracellular acidification.

Dehydroascorbic acid (DHAA) enters cells via Na(+)-independent glucose transporters (GLUT) and is converted to ascorbate. However, we found that Na(+) removal inhibited [(14)C]DHAA uptake by smooth-muscle cells cultured from pig coronary artery. The uptake was examined for 2-12 min at 10-200 microM DHAA in either the presence of 134 mM Na(+) or in its absence (N-methyl D-glucamine, choline or sucrose replaced Na(+)). This inhibition of DHAA uptake by Na(+) removal was paradoxical because it was inhibited by 2-deoxyglucose and cytochalasin B, as expected of transport via the GLUT pathway. We tested the hypothesis that this paradox resulted from an inefficient intracellular reduction of [(14)C]DHAA into [(14)C]ascorbate upon intracellular acidosis caused by the Na(+) removal. Consistent with this hypothesis: (i) the Na(+)/H(+)-exchange inhibitors ethylisopropyl amiloride and cariporide also decreased the uptake, (ii) Na(+) removal and Na(+)/H(+)-exchange inhibitors lowered cytosolic pH, with the decrease being larger in 12 min than in 2 min, and (iii) less of the cellular (14)C was present as ascorbate (determined by HPLC) in cells in Na(+)-free buffer than in those in Na(+)-containing buffer. This inability to obtain ascorbate from extracellular DHAA may be detrimental to the coronary artery under hypoxia-induced acidosis during ischaemia/reperfusion.