Development and evaluation of a Lateral flow immunoassay (LFIA) prototype for the detection of IgG anti-SARS-CoV-2 antibodies.

Lateral flow immunoassays (LFIA) for antibody detection represent cost-effective and user-friendly tools for serology assessment. This study evaluated a new LFIA prototype developed with a recombinant chimeric antigen from the spike/S and nucleocapsid/N proteins to detect anti-SARS-CoV-2 IgG antibodies. The evaluation of LFIA sensitivity and specificity used 811 serum samples from 349 hospitalized, SARS-CoV-2 RT-qPCR positive COVID-19 patients, collected at different time points and 193 serum samples from healthy controls. The agreement between ELISA results with the S/N chimeric antigen and LFIA results was calculated. The LFIA prototype for SARS-CoV-2 using the chimeric S/N protein demonstrated 85 % sensitivity on the first week post symptoms onset, reaching 94 % in samples collected at the fourth week of disease. The agreement between LFIA and ELISA with the same antigen was 92.7 %, 0.827 kappa Cohen value (95 % CI [0.765-0.889]). Further improvements are needed to standardize the prototype for whole blood use. The inclusion of the novel chimeric S + N antigen in the COVID-19 IgG antibody LFIA demonstrated optimal agreement with results from a comparable ELISA, highlighting the prototype's potential for accurate large-scale serologic assessments in the field in a rapid and user-friendly format.

An indirect ELISA for detecting anti-SARS-CoV-2 antibodies in human sera using a baculovirus-expressed recombinant nucleocapsid antigen.

This study focuses on the development and initial assessment of an indirect IgG enzyme-linked immunosorbent assay (ELISA) specifically designed to detect of anti-SARS-CoV-2 antibodies. The unique aspect of this ELISA method lies in its utilization of a recombinant nucleocapsid (N) antigen, produced through baculovirus expression in insect cells. Our analysis involved 292 RT-qPCR confirmed positive serum samples and 54 pre-pandemic healthy controls. The process encompassed cloning, expression, and purification of the SARS-CoV-2 N gene in insect cells, with the resulted purified protein employed in our ELISA tests. Statistical analysis yielded an Area Under the Curve of 0.979, and the optimized cut-off exhibited 92 % sensitivity and 94 % specificity. These results highlight the ELISA's potential for robust and reliable serological detection of SARS-CoV-2 antibodies. Further assessments, including a larger panel size, reproducibility tests, and application in diverse populations, could enhance its utility as a valuable biotechnological solution for diseases surveillance.

Specific antibody production using recombinant proteins to elucidate seed transmission and nuclear localization of Coguvirus citrulli and Coguvirus henanense in radicles of watermelon crop.

Watermelon crinkle leaf-associated virus 1 (WCLaV-1) and WCLaV-2, both belonging to the genus Coguvirus (family Phenuiviridae), have been identified in watermelon plants in Brazil. To study tissue tropism and the potential for seed transmission of these viruses, we initially planned to produce specific antibodies. However, difficulties in isolating and propagating the virus in host plants hindered the purified virus preparations. To overcome this problem, the nucleocapsid (N) proteins of WCLaV-1 and -2 were produced using the pepper ringspot virus vector. The N protein genes and the vector backbone were prepared by (RT-)PCR and ligated by Gibson assembly. The constructs were agro-infiltrated in Nicotiana benthamiana plants. The expressed N proteins were purified and used for polyclonal antibody production. The specificity of both antibodies was confirmed by antigen-coating ELISA, tissue-blot immunobinding assay and Western blot. By antigen-coating ELISA demonstrated that WCLaV-1 showed 93.1% of seed-transmission, while WCLaV-2 showed only 17.8%. The N protein of WCLaV-1 was detected in the cytoplasm of the seed tissues. It was also found in the nuclei of the radicle, as confirmed by confocal microscopy. We concluded that the antibodies exhibited both a high titer and sufficient specificity for use in ELISA-based diagnostics and for subcellular localization study.

First report of Moroccan watermelon mosaic virus in pumpkin plants in Brazil.

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

A novel highly specific biotinylated MAC-ELISA for detection of anti-SARS-CoV-2 nucleocapsid antigen IgM antibodies during the acute phase of COVID-19.

The gold standard for diagnosing COVID-19 in the acute phase is RT-qPCR. However, this molecular technique can yield false-negative results when nasopharyngeal swab collection is not conducted during viremia. To mitigate this challenge, the enzyme-linked immunosorbent assay (ELISA) identifies anti-SARS-CoV-2 IgM antibodies in the initial weeks after symptom onset, facilitating early COVID-19 diagnosis. This study introduces a novel and highly specific IgM antibody capture ELISA (MAC-ELISA), which utilizes biotinylated recombinant SARS-CoV-2 nucleocapsid (N) antigen produced in plants. Our biotinylated approach streamlines the procedure by eliminating the requirement for an anti-N-conjugated antibody, circumventing the need for peroxidase-labeled antigens, and preventing cross-reactivity with IgM autoantibodies such as rheumatoid factor. Performance evaluation of the assay involved assessing sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and accuracy using 682 RT-qPCR-positive samples, categorized by weeks relative to symptoms onset. Negative controls included 205 pre-pandemic serum samples and 46 serum samples from patients diagnosed with other diseases. Based on a cut-off of 0.087 and ROC curve analysis, the highest sensitivity of 81.2% was observed in the 8-14 days post-symptom (dps) group (2nd week), followed by sensitivities of 73.8% and 68.37% for the 1-7 dps (1st week) and 15-21 dps groups (3rd week), respectively. Specificity was consistently 100% across all groups. This newly developed biotinylated N-MAC-ELISA offers a more streamlined and cost-effective alternative to molecular diagnostics. It enables simultaneous testing of multiple samples and effectively identifies individuals with false-negative results.

Biological and molecular characterization of a new potexvirus isolated from Adenium obesum.

Adenium obesum plants showing virus-like symptoms were collected in several regions of Brazil. Mottling symptoms like those observed in symptomatic plants in the field were reproduced in mechanically inoculated A. obesum plants. This potexvirus was named "desert rose mottle virus" (DRMoV), and its genome sequence was first determined by high-throughput sequencing and then confirmed by Sanger sequencing. The complete genome of DRMoV is 6,781 nt in length, excluding the poly(A) tail, and five ORFs were predicted in order from 5' to 3': Rep-TGB1-TGB2-TGB3-CP. Phylogenetic analysis based on Rep amino acid sequences showed different clustering among potexviruses. These data suggest that RDMoV is a new member of the genus Potexvirus, and the binomial name "Potexvirus adenii" is proposed for its species.

Metagenomic analyses of plant virus sequences in sewage water for plant viruses monitoring.

Frequent monitoring of emerging viruses of agricultural crops is one of the most important missions for plant virologists. A fast and precise identification of potential harmful viruses may prevent the occurrence of serious epidemics. Nowadays, high-throughput sequencing (HTS) technologies became an accessible and powerful tool for this purpose. The major discussion of this strategy resides in the process of sample collection, which is usually laborious, costly and nonrepresentative. In this study, we assessed the use of sewage water samples for monitoring the widespread, numerous, and stable plant viruses using HTS analysis and RT-qPCR. Plant viruses belonged to 12 virus families were found, from which Virgaviridae, Solemoviridae, Tymoviridae, Alphaflexiviridae, Betaflexiviridae, Closteroviridae and Secoviridae were the most abundant ones with more than 20 species. Additionally, we detected one quarantine virus in Brazil and a new tobamovirus species. To assess the importance of the processed foods as virus release origins to sewage, we selected two viruses, the tobamovirus pepper mild mottle virus (PMMoV) and the carlavirus garlic common latent virus (GarCLV), to detect in processed food materials by RT-qPCR. PMMoV was detected in large amount in pepper-based processed foods and in sewage samples, while GarCLV was less frequent in dried and fresh garlic samples, and in the sewage samples. This suggested a high correlation of virus abundance in sewage and processed food sources. The potential use of sewage for a virus survey is discussed in this study. Supplementary Information: The online version contains supplementary material available at 10.1007/s40858-023-00575-8.

Practical use of tobravirus-based vector to produce SARS-CoV-2 antigens in plants.

A plant-based heterologous expression system is an attractive option for recombinant protein production because it is based on a eukaryotic system of high feasibility, and low biological risks. Frequently, binary vector systems are used for transient gene-expression in plants. However, plant virus vector-based systems offer advantages for higher protein yields due to their self-replicating machinery. In the present study, we show an efficient protocol using a plant virus vector based on a tobravirus, pepper ringspot virus, that was employed for transient expression of severe acute respiratory syndrome coronavirus 2 partial gene fragments of the spike (named S1-N) and the nucleocapsid (named N) proteins in Nicotiana benthamiana plants. Purified proteins yield of 40-60 µg/g of fresh leaves were obtained. Both proteins, S1-N and N, showed high and specific reactivities against convalescent patients' sera by the enzyme-linked immunosorbent assay format. The advantages and critical points in using this plant virus vector are discussed.

Complete genome sequence of mimosa mosaic virus, a new sobemovirus infecting Mimosa sensitiva L.

A new sobemovirus, which we have named "mimosa mosaic virus" (MimMV), was found by high-throughput sequencing and isolated from a mimosa (Mimosa sensitiva L.) plant. The genome sequence was confirmed by Sanger sequencing and comprises 4595 nucleotides. Phylogenetic analysis based on the predicted amino acid (aa) sequences of the P2b protein (encoded by ORF2b) and the coat protein showed 52.7% and 31.8% aa sequence identity, respectively, to those of blueberry shoestring virus. The complete genome sequence of MimMV was less than 47% identical to those of other sobemoviruses. These data suggest that MimMV is a member of a new species in the genus Sobemovirus, for which the binomial name "Sobemovirus mimosae" is proposed.

Construction of an infectious full-length cDNA clone of a recombinant isolate of cucurbit aphid-borne yellows virus from Brazil.

In Brazil, the main viral disease of melon plant is severe yellowing disease called "Amarelão do Meloeiro," and a polerovirus, cucurbit aphid-borne yellows virus (CABYV) was considered one of the etiological agents. This virus is a recombinant strain originated from CABYV and unknown polerovirus. Due to unsuccessful mechanical inoculations of CABYV to host plants, the study of its biological characterization is hampered. Therefore, an infectious clone of the recombinant strain of CABYV was constructed using the Gibson Assembly technology. The full-length cDNA clones produced in this study showed to be infectious in three cucurbit species; melon (Cucumis melo), squash (a hybrid of Cucurbita maxima × C. moschata), and West Indian gherkin (Cucumis anguria) plants, but not in watermelon, cucumber, and zucchini plants. This insusceptibility of watermelon plants to the infectious clone corroborates the observation that this virus was never found in watermelon plants often located next to the infected melon plants. This infectious clone provides important tools for future study in developing resistant melon variety to CABYV infection.

Virus classification based on in-depth sequence analyses and development of demarcation criteria using the Betaflexiviridae as a case study.

Currently, many viruses are classified based on their genome organization and nucleotide/amino acid sequence identities of their capsid and replication-associated proteins. Although biological traits such as vector specificities and host range are also considered, this later information is scarce for the majority of recently identified viruses, characterized only from genomic sequences. Accordingly, genomic sequences and derived information are being frequently used as the major, if not only, criteria for virus classification and this calls for a full review of the process. Herein, we critically addressed current issues concerning classification of viruses in the family Betaflexiviridae in the era of high-throughput sequencing and propose an updated set of demarcation criteria based on a process involving pairwise identity analyses and phylogenetics. The proposed framework has been designed to solve the majority of current conundrums in taxonomy and to facilitate future virus classification. Finally, the analyses performed herein, alongside the proposed approaches, could be used as a blueprint for virus classification at-large.

First report of Cotton leafroll dwarf virus infecting cacao (Theobroma cacao L.) trees in Brazil.

Cotton leafroll dwarf virus (genus Polerovirus, family Solemoviridae) has been commonly reported affecting cotton plants (Gossypium spp., family Malvaceae) and several weed species (Ramos-Sobrinho et al., 2021; Sedhain et al., 2021). During a recent survey, cacao (Theobroma cacao L.) trees exhibiting virus-like symptoms such as leaf mosaic, vein clearing, and yellow spot were observed in the south part of the state of Bahia, northeastern Brazil, in 2022. Leaf samples were randomly collected from symptomatic cacao plants (n=30) growing in an affected area of approximately 30 ha. Total RNA obtained from pooled cacao samples were subjected to Illumina HiSeq 2500 sequencing as previously described (Keith et al., 2021), and partial sequences of cotton leafroll dwarf virus (CLRDV), and other virus-specific sequence contigs, were de novo assembled according to Ramos-Sobrinho et al. (2021). To further investigate the presence of CLRDV in cacao leaves, total RNA was individually extracted using a modified silica protocol (Rott and Jelkmann, 2001) and used as template for cDNA synthesis with random hexamers using the SuperScript™ IV First-Strand Synthesis System (Invitrogen, CA, USA) following the manufacturer´s protocol. Detection of CLRDV was carried out by reverse transcription-polymerase chain reaction (RT-PCR) with the primers PL4F and o3-R, which amplify the open reading frame 3 (ORF3) encoding the capsid protein (Corrêa et al., 2005). Expected size amplicons (~0.6 kb) were observed from 16 out of 30 symptomatic plants, indicating ~53% of the cacao trees were infected by CLRDV. Considering 14 symptomatic plants tested negative for CLRDV, the symptoms observed here could also be caused by other viral groups or abiotic stress. To confirm the detection of CLRDV, the first half (~3.5kb) of the viral genome was amplified from two representative cacao samples using the primers P20F and P22R (Avelar et al., 2020). The RT-PCR products were gel-purified using the Wizard® SV Gel and PCR Clean-Up System (Promega, WI, USA) and Sanger sequenced. The RNA Illumina sequencing from pooled cacao samples (n=30) yielded 34,610,572 million trimmed reads. Two contigs of 868 and 839 nucleotides (nt) in length, and sharing high nt identity with CLRDV isolates, were assembled from 6,903 and 10,271 reads, at a coverage depth of 795 and 1,224x, respectively. Together, these contigs represent ~29% of the complete viral genome and included part of the 5´-untraslated region, ORF0 and the second half of ORF1-ORF2. Additional CLRDV-like contigs were observed across the viral genome, but they were not considered for further analyses due to the poor sequence quality. The Illumina- and Sanger-derived ORF0 and partial ORF1-ORF2 sequences shared >97% nt identity, suggesting they were congruent. Pairwise sequence comparisons for ORF0, encoding the gene silencing suppressor P0, indicated the cacao-associated isolates shared 99.7 and 99.2% nt and amino acid (aa) identity one with another, respectively. The ORF0 nt sequences showed 91.9-93.8 and 90.7-93.6% identity, while the aa sequences shared 85.8-88.5 and 86.2-90.0% similarity, with CLRDV isolates previously reported in South America and the USA, respectively. Finally, the ~3.5kb nt sequences of cacao-infecting CLRDV isolates shared 92.9-95.8% identity with CLRDV genomes deposited in NCBI-GenBank. The Bayesian phylogenetic tree reconstructed based on ORF0 nt sequences showed the new sequences were more closely related to CLRDV-atypical isolates (GenBank accession nos. KF359946, KF359947, KF906260, and KF906261). Together, these results suggest the new ORF0 sequences belong to CLRDV and were deposited in GenBank under accession nos. ON954058-ON954059. To our knowledge, this is the first report of CLRDV infecting cacao plants, expanding the range of malvaceous hosts of this polerovirus. CLRDV is largely known for causing yield losses in cotton crops, but additional studies are needed to determine if CLRDV infection is detrimental to cacao production.

Complete genome sequence of patchouli chlorosis-associated cytorhabdovirus, a new cytorhabdovirus infecting patchouli plants in Brazil.

A cytorhabdovirus, tentatively named "patchouli chlorosis-associated cytorhabdovirus" (PCaCV), was identified in a patchouli plant, using high-throughput sequencing, and its genome sequence was confirmed by Sanger sequencing. The PCaCV genome consists of 12,913 nucleotides and contains six open reading frames in the order 3'-N-P'-P-P3-M-(G)-L-5'. The glycoprotein gene was found to contain stop codons in the coding frame; hence, this gene is considered defective. PCaCV is most closely related to tomato yellow mottle-associated virus, sharing 61.1% nucleotide sequence identity in the complete genome and 73.9% amino acid sequence identity in the L protein. These data suggest that PCaCV should be considered a new member of the genus Cytorhabdovirus, and the binomial species name "Cytorhabdovirus patchoulii" is proposed.

A Chikungunya Virus Multiepitope Recombinant Protein Expressed from the Binary System Insect Cell/Recombinant Baculovirus Is Useful for Laboratorial Diagnosis of Chikungunya.

Chikungunya virus (CHIKV) is an arbovirus currently distributed worldwide, causing a disease that shares clinical signs and symptoms with other illnesses, such as dengue and Zika and leading to a challenging clinical differential diagnosis. In Brazil, CHIKV emerged in 2014 with the simultaneous introduction of both Asian and East/Central/South African (ECSA) genotypes. Laboratorial diagnosis of CHIKV is mainly performed by molecular and serological assays, with the latter more widely used. Although many commercial kits are available, their costs are still high for many underdeveloped and developing countries where the virus circulates. Here we described the development and evaluation of a multi-epitope recombinant protein-based IgG-ELISA (MULTREC IgG-ELISA) test for the specific detection of anti-CHIKV antibodies in clinical samples, as an alternative approach for laboratorial diagnosis. The MULTREC IgG-ELISA showed 86.36% of sensitivity and 100% of specificity, and no cross-reactivity with other exanthematic diseases was observed. The recombinant protein was expressed from the binary system insect cell/baculovirus using the crystal-forming baculoviral protein polyhedrin as a carrier of the target recombinant protein to facilitate recovery. The crystals were at least 10 times smaller in size and had an amorphous shape when compared to the polyhedrin wild-type crystal. The assay uses a multi-epitope antigen, representing two replicates of 18 amino acid sequences from the E2 region and a sequence of 17 amino acids from the nsP3 region of CHIKV. The recombinant protein was highly expressed, easy to purify and has demonstrated its usefulness in confirming chikungunya exposure, indeed showing a good potential tool for epidemiological surveillance.

Characterization of yam mosaic viruses from Brazil reveals a new phylogenetic group and possible incursion from the African continent.

Yam (Dioscorea spp.) is an important crop for smallholder farmers in the Northeast region of Brazil. Wherever yam is grown, diseases caused by yam mosaic virus (YMV) are prevalent. In the present study, the diversity of YMV infecting Dioscorea cayennensis-rotundata was analyzed. In addition, five species of Dioscorea (D. alata, D. altissima, D. bulbifera, D. subhastata, and D. trifida) commonly found in Brazil were analyzed using ELISA and high-throughput sequencing (HTS). YMV was detected only in D. cayennensis-rotundata, of which 66.7% of the samples tested positive in ELISA. Three YMV genome sequences were assembled from HTS and one by Sanger sequencing to group the sequences in a clade phylogenetically distinct from YMV from other origins. Temporal phylogenetic analyses estimated the mean evolutionary rate for the CP gene of YMV as 1.76 × 10-3 substitutions per site per year, and the time to the most recent common ancestor as 168.68 years (95% Highest Posterior Density, HPD: 48.56-363.28 years), with a most likely geographic origin in the African continent. The data presented in this study contribute to reveal key aspects of the probable epidemiological history of YMV in Brazil.

Detection of SARS-CoV-2 virus via dynamic light scattering using antibody-gold nanoparticle bioconjugates against viral spike protein.

Mass testing for the diagnosis of COVID-19 has been hampered in many countries owing to the high cost of genetic material detection. This study reports on a low-cost immunoassay for detecting SARS-CoV-2 within 30 min using dynamic light scattering (DLS). The immunosensor comprises 50-nm gold nanoparticles (AuNPs) functionalized with antibodies against SARS-CoV-2 spike glycoprotein, whose bioconjugation was confirmed using transmission electron microscopy (TEM), UV-Vis spectroscopy, Fourier transform infrared spectroscopy (FTIR), and surface-enhanced Raman scattering spectroscopy (SERS). The specific binding of the bioconjugates to the spike protein led to an increase in bioconjugate size, with a limit of detection (LOD) 5.29 × 103 TCID50/mL (Tissue Culture Infectious Dose). The immunosensor was also proven to be selective upon interaction with influenza viruses once no increase in size was observed after DLS measurement. The strategy proposed here aimed to use antibodies conjugated to AuNPs as a generic platform that can be extended to other detection principles, enabling technologies for low-cost mass testing for COVID-19.

Heterogeneity in the Response of Different Subtypes of Drosophila melanogaster Midgut Cells to Viral Infections.

Single-cell RNA sequencing (scRNA-seq) offers the possibility to monitor both host and pathogens transcriptomes at the cellular level. Here, public scRNA-seq datasets from Drosophila melanogaster midgut cells were used to compare the differences in replication strategy and cellular responses between two fly picorna-like viruses, Thika virus (TV) and D. melanogaster Nora virus (DMelNV). TV exhibited lower levels of viral RNA accumulation but infected a higher number of cells compared to DMelNV. In both cases, viral RNA accumulation varied according to cell subtype. The cellular heat shock response to TV and DMelNV infection was cell-subtype- and virus-specific. Disruption of bottleneck genes at later stages of infection in the systemic response, as well as of translation-related genes in the cellular response to DMelNV in two cell subtypes, may affect the virus replication.

Nanopore sequencing of tomato mottle leaf distortion virus, a new bipartite begomovirus infecting tomato in Brazil.

During a survey in a tomato field in Luziânia (Goiás State, Brazil), a single plant with mottling, chlorotic spots, and leaf distortion was found. A new bipartite begomovirus sequence was identified using nanopore sequence technology and confirmed by Sanger sequencing. The highest nucleotide sequence identity match of the DNA-A component (2596 bases) was 81.64% with tomato golden leaf deformation virus (HM357456). Due to the current species demarcation criterion of 91% nucleotide sequence identity for DNA-A, we propose this virus to be a new member of the genus Begomovirus, named "tomato mottle leaf distortion virus".

Complete genome sequences of three newly discovered cacao mild mosaic virus isolates from Theobroma cacao L. in Brazil and Puerto Rico and evidence for recombination.

To analyze the DNA virome associated with cacao (Theobroma cacao L.) trees showing virus-like symptoms in Brazil (BR) and Puerto Rico (PR) during 2018-2019, total DNA was isolated from symptomatic leaves and subjected to high-throughput Illumina sequencing. The assembled complete badnaviral genome sequences were verified by PCR amplification, cloning, and DNA sequencing. Based on pairwise distances and phylogenetic analysis, three badnaviral genomes were identified, and these viruses were found to be isolates of the previously described cacao mild mosaic virus (CaMMV). The three genomes were 7,520, 7,524, and 7,514 bp in size for the isolates CaMMV-BR321, CaMMV-BR322, and CaMMV-PR3, respectively. Each genome contained four predicted open reading frames: ORFs 1-3 and ORFY. The CaMMV-PR3 isolate was identified as a probable recombinant, with a CaMMV-BR-like virus as the major parent.