circPVT1 promotes silica-induced epithelial-mesenchymal transition by modulating the miR-497-5p/TCF3 axis.

Epithelial-mesenchymal transition (EMT) is a vital pathological feature of silica-induced pulmonary fibrosis. However, whether circRNA is involved in the process remains unclear. The present study aimed to investigate the role of circPVT1 in the silica-induced EMT and the underlying mechanisms. We found that an elevated expression of circPVT1 promoted EMT and enhanced the migratory capacity of silica-treated epithelial cells. The isolation of cytoplasmic and nuclear separation assay showed that circPVT1 was predominantly expressed in the cytoplasm. RNA immunoprecipitation assay and RNA pull-down experiment indicated that cytoplasmic-localized circPVT1 was capable of binding to miR-497-5p. Furthermore, we found that miR-497-5p attenuated the silica-induced EMT process by targeting transcription factor 3 (TCF3), an E-cadherin transcriptional repressor, in the silica-treated epithelial cells. Collectively, these results reveal a novel role of the circPVT1/miR-497-5p/TCF3 axis in the silica-induced EMT process in lung epithelial cells. Once validated, this finding may provide a potential theoretical basis for the development of interventions and treatments for pulmonary fibrosis.

The interplay of Cxcl10+/Mmp14+ monocytes and Ccl3+ neutrophils proactively mediates silica-induced pulmonary fibrosis.

As a fatal occupational disease with limited therapeutic options, molecular mechanisms underpinning silicosis are still undefined. Herein, single-cell RNA sequencing of the lung tissue of silicosis mice identified two monocyte subsets, which were characterized by Cxcl10 and Mmp14 and enriched in fibrotic mouse lungs. Both Cxcl10+ and Mmp14+ monocyte subsets exhibited activation of inflammatory marker genes and positive regulation of cytokine production. Another fibrosis-unique neutrophil population characterized by Ccl3 appeared to be related to the pro-fibrotic process, specifically the "inflammatory response". Meanwhile, the proportion of monocytes and neutrophils was significantly higher in the serum of silicosis patients and slices of lung tissue from patients with silicosis further validated the over-expression of Cxcl10 and Mmp14 in monocytes, also Ccl3 in neutrophils, respectively. Mechanically, receptor-ligand interaction analysis identified the crosstalk of Cxcl10+/Mmp14+ monocytes with Ccl3+ neutrophils promoting fibrogenesis via coupling of HBEGF-CD44 and CSF1-CSF1R. In vivo, administration of clodronate liposomes, Cxcl10 or Mmp14 siRNA-loaded liposomes, Ccl3 receptor antagonist BX471, CD44 or CSF1R neutralizing antibodies significantly alleviated silica-induced lung fibrosis. Collectively, these results demonstrate that the newly defined Cxcl10+/Mmp14+ monocytes and Ccl3+ neutrophils participate in the silicosis process and highlight anti-receptor-ligand pair treatment as a potentially effective therapeutic strategy in managing silicosis.

Associations of combined phenotypic ageing and genetic risk with incidence of chronic respiratory diseases in the UK Biobank: a prospective cohort study.

BACKGROUND: Accelerated biological ageing has been associated with an increased risk of several chronic respiratory diseases. However, the associations between phenotypic age, a new biological age indicator based on clinical chemistry biomarkers, and common chronic respiratory diseases have not been evaluated. METHODS: We analysed data from 308 592 participants at baseline in the UK Biobank. The phenotypic age was calculated from chronological age and nine clinical chemistry biomarkers, including albumin, alkaline phosphatase, creatinine, glucose, C-reactive protein, lymphocyte percent, mean cell volume, red cell distribution width and white blood cell count. Furthermore, phenotypic age acceleration (PhenoAgeAccel) was calculated by regressing phenotypic age on chronological age. The associations of PhenoAgeAccel with incident common chronic respiratory diseases and cross-sectional lung function were investigated. Moreover, we constructed polygenic risk scores and evaluated whether PhenoAgeAccel modified the effect of genetic susceptibility on chronic respiratory diseases and lung function. RESULTS: The results showed significant associations of PhenoAgeAccel with increased risk of idiopathic pulmonary fibrosis (IPF) (hazard ratio (HR) 1.52, 95% CI 1.45-1.59), COPD (HR 1.54, 95% CI 1.51-1.57) and asthma (HR 1.18, 95% CI 1.15-1.20) per 5-year increase and decreased lung function. There was an additive interaction between PhenoAgeAccel and the genetic risk for IPF and COPD. Participants with high genetic risk and who were biologically older had the highest risk of incident IPF (HR 5.24, 95% CI 3.91-7.02), COPD (HR 2.99, 95% CI 2.66-3.36) and asthma (HR 2.07, 95% CI 1.86-2.31). Mediation analysis indicated that PhenoAgeAccel could mediate 10∼20% of the associations between smoking and chronic respiratory diseases, while ∼10% of the associations between particulate matter with aerodynamic diameter <2.5 µm and the disorders were mediated by PhenoAgeAccel. CONCLUSION: PhenoAgeAccel was significantly associated with incident risk of common chronic respiratory diseases and decreased lung function and could serve as a novel clinical biomarker.

CircZNF609 regulates pulmonary fibrosis via miR-145-5p/KLF4 axis and its translation function.

BACKGROUND: Pulmonary fibrosis is a growing clinical problem that develops as a result of abnormal wound healing, leading to breathlessness, pulmonary dysfunction and ultimately death. However, therapeutic options for pulmonary fibrosis are limited because the underlying pathogenesis remains incompletely understood. Circular RNAs, as key regulators in various diseases, remain poorly understood in pulmonary fibrosis induced by silica. METHODS: We performed studies with fibroblast cell lines and silica-induced mouse pulmonary fibrosis models. The expression of circZNF609, miR-145-5p, and KLF4 was determined by quantitative real-time polymerase chain reaction (qRT-PCR) analysis. RNA immunoprecipitation (RIP) assays and m6A RNA immunoprecipitation assays (MeRIP), Western blotting, immunofluorescence assays, and CCK8 were performed to investigate the role of the circZNF609/miR-145-5p/KLF4 axis and circZNF609-encoded peptides in fibroblast activation. RESULTS: Our data showed that circZNF609 was downregulated in activated fibroblasts and silica-induced fibrotic mouse lung tissues. Overexpression of circZNF609 could inhibit fibroblast activation induced by transforming growth factor-ß1 (TGF-ß1). Mechanically, we revealed that circZNF609 regulates pulmonary fibrosis via miR-145-5p/KLF4 axis and circZNF609-encoded peptides. Furthermore, circZNF609 was highly methylated and its expression was controlled by N6-methyladenosine (m6A) modification. Lastly, in vivo studies revealed that overexpression of circZNF609 attenuates silica-induced lung fibrosis in mice. CONCLUSIONS: Our data indicate that circZNF609 is a critical regulator of fibroblast activation and silica-induced lung fibrosis. The circZNF609 and its derived peptides may represent novel promising targets for the treatment of pulmonary fibrosis.

IL33-mediated NPM1 promotes fibroblast-to-myofibroblast transition via ERK/AP-1 signaling in silica-induced pulmonary fibrosis.

Silicosis is a global occupational pulmonary disease due to the accumulation of silica dust in the lung. Lacking effective clinical drugs makes the treatment of this disease quite challenging in clinics largely because the pathogenic mechanisms remain obscure. Interleukin 33 (IL33), a pleiotropic cytokine, could promote wound healing and tissue repair via the receptor ST2. However, the mechanisms governing the involvement of IL33 in silicosis progression remain to be further explored. Here, we demonstrated that the IL33 levels in the lung sections were significantly overexpressed after bleomycin and silica treatment. Chromatin immunoprecipitation assay, knockdown, and reverse experiments were performed in lung fibroblasts to prove gene interaction following exogenous IL33 treatment or cocultured with silica-treated lung epithelial cells. Mechanistically, we illustrated that silica-stimulated lung epithelial cells secreted IL33 and further promoted the activation, proliferation, and migration of pulmonary fibroblasts by activating the ERK/AP-1/NPM1 signaling pathway in vitro. And more, treatment with NPM1 siRNA-loaded liposomes markedly protected mice from silica-induced pulmonary fibrosis in vivo. In conclusion, the involvement of NPM1 in the progression of silicosis is regulated by the IL33/ERK/AP-1 signaling axis, which is the potential therapeutic target candidate in developing novel antifibrotic strategies for pulmonary fibrosis.

UHRF1-mediated ferroptosis promotes pulmonary fibrosis via epigenetic repression of GPX4 and FSP1 genes.

Pulmonary fibrosis (PF), as an end-stage clinical phenotype of interstitial lung diseases (ILDs), is frequently initiated after alveolar injury, in which ferroptosis has been identified as a critical event aggravating the pathophysiological progression of this disease. Here in, a comprehensive analysis of two mouse models of pulmonary fibrosis developed in our lab demonstrated that lung damage-induced ferroptosis of alveolar epithelial Type2 cells (AEC2) significantly accumulates during the development of pulmonary fibrosis while ferroptosis suppressor genes GPX4 and FSP1 are dramatically inactivated. Mechanistically, upregulation of de novo methylation regulator Uhrf1 sensitively elevates CpG site methylation levels in promoters of both GPX4 and FSP1 genes and induces the epigenetic repression of both genes, subsequently leading to ferroptosis in chemically interfered AEC2 cells. Meanwhile, specific inhibition of UHRF1 highly arrests the ferroptosis formation and blocks the progression of pulmonary fibrosis in both of our research models. This study first, to our knowledge, identified the involvement of Uhrf1 in mediating the ferroptosis of chemically injured AEC2s via de novo promoter-specific methylation of both GPX4 and FSP1 genes, which consequently accelerates the process of pulmonary fibrosis. The above findings also strongly suggested Uhrf1 as a novel potential target in the treatment of pulmonary fibrosis.

Metal Exposure-Related Welder's Pneumoconiosis and Lung Function: A Cross-Sectional Study in a Container Factory of China.

Long-term inhalation of welding fume at high exposure can cause welder's pneumoconiosis, and metals in welding dust are associated with respiratory dysfunction. This cross-sectional study, which contains 384 Chinese male workers who were or had been working in a container factory, aimed to assess the potential risk of haemal and urinary metal content in welder's pneumoconiosis. Further, we investigated their effects on lung function parameters. Metal content and lung function were measured using inductively coupled plasma-mass spectrometry (ICP-MS) and spirometer, respectively. The concentration and metal content of respirable dust as well as total dust were collected at this container factory. Lung function of cases with welder's pneumoconiosis was significantly worse, as indicated by lower values of FVC, FVC% predicted, FEV1, FEV1% predicted, MEF25% predicted, and MMEF% predicted (p < 0.05). Results of logistic regression models showed that haemal Cr and Zn were risk factors of welder's pneumoconiosis (OR = 4.98, 95%CI: 1.73-21.20, p = 0.009 for Cr; OR = 5.23, 95%CI: 1.56-41.08, p = 0.033 for Zn) after adjusted with age, BMI, working years, welding dust exposure years, and smoking status. Multiple linear regression models showed that several metals (haemal Cd and Pb; urinary Cd and Fe) were significantly associated with different lung function indices in the welder's pneumoconiosis group. Compared to non-welders, welders were exposed to considerably higher levels of respirable dust, total dust, and six kinds of metals (p < 0.05). In conclusion, haemal Cr and Zn are positively related to welder's pneumoconiosis. Meanwhile, Cd and Pb might worsen lung function in welder's pneumoconiosis.

Antagonistic Effect of Trichoderma longibrachiatum (TL6 and TL13) on Fusarium solani and Fusarium avenaceum Causing Root Rot on Snow Pea Plants.

Snow pea root rot in China is caused by Fusarium solani (FSH) and Fusarium avenaceum (FAH), which affect snow pea production. The chemical control methods used against FSH and FAH are toxic to the environment and resistance may be developed in persistence applications. Therefore, an alternative approach is needed to control these pathogens. This study focuses on Trichoderma longibrachiatum strains (TL6 and TL13), mycoparasitic mechanisms of FSH and FAH, as well as growth-promoting potentials on snow pea seedlings under FSH and FAH stress at the physiological, biochemical, and molecular levels. The average inhibitory rates of TL6 against FSH and FAH were 54.58% and 69.16%, respectively, on day 7. Similarly, TL13 average inhibitory rates against FSH and FAH were 59.06% and 71.27%, respectively, on day 7. The combined TL13 and TL6 with FSH and FAH reduced disease severity by 86.6, 81.6, 57.60, and 60.90%, respectively, in comparison to the controls. The snow pea plants inoculated with FSH and FAH without TL6 and TL13 increased malondialdehyde (MDA) and hydrogen peroxide (H2O2) contents in the leaves by 64.8, 66.0, 64.4 and 65.9%, respectively, compared to the control. However, the combined FSH and FAH with TL6 and TL13 decreased the MDA and H2O2 content by 75.6, 76.8, 70.0, and 76.4%, respectively, in comparison to the controls. In addition, the combined TL6 + FSH and TL6 + FAH increased the activity of superoxide dismutase (SOD), peroxidase (POD), and catalase (CAT) by 60.5, 64.7, and 60.3%, respectively, and 60.0, 64.9, and 56.6%, respectively, compared to the controls. Again, compared to the controls, the combined TL13 + FSH and TL13 + FAH increased the activity of SOD, POD, and CAT by 69.7, 68.6, and 65.6%, respectively, and 70.10, 69.5, and 65.8%, respectively. Our results suggest that the pretreatment of snow pea seeds with TL6 and TL13 increases snow pea seedling growth, controls FSH and FAH root rot, increases antioxidant enzyme activity, and activates plant defense mechanisms. The TL13 strain had the greatest performance in terms of pathogen inhibition and snow pea growth promotion compared to the TL6 strain.

Targeted delivery of ZNF416 siRNA-loaded liposomes attenuates experimental pulmonary fibrosis.

BACKGROUND: Pulmonary fibrosis is a chronic progressive fibrotic interstitial lung disease characterized by excessive extracellular matrix (ECM) deposition caused by activated fibroblasts. Increasing evidence shows that matrix stiffness is essential in promoting fibroblast activation and profibrotic changes. Here, we investigated the expression and function of matrix stiffness-regulated ZNF416 in pulmonary fibrotic lung fibroblasts. METHODS: 1 kappa (soft), 60 kappa (stiff) gel-coated coverslips, or transforming growth factor-beta 1 (TGF-ß1)-cultured lung fibroblasts and the gain- or loss- of the ZNF416 function assays were performed in vitro. We also established two experimental pulmonary fibrosis mouse models by a single intratracheal instillation with 50 mg/kg silica or 6 mg/kg bleomycin (BLM). ZNF416 siRNA-loaded liposomes and TGF-ß1 receptor inhibitor SB431542 were administrated in vivo. RESULTS: Our study identified that ZNF416 could regulate fibroblast differentiation, proliferation, and contraction by promoting the nuclear accumulation of p-Smad2/3. Besides, ZNF416 siRNA-loaded liposome delivery by tail-vein could passively target the fibrotic area in the lung, and co-administration of ZNF416 siRNA-loaded liposomes and SB431542 significantly protects mice against silica or BLM-induced lung injury and fibrosis. CONCLUSION: In this study, our results indicate that mechanosensitive ZNF416 is a potential molecular target for the treatment of pulmonary fibrosis. Strategies aimed at silencing ZNF416 could be a promising approach to fight against pulmonary fibrosis.

Caveolin-1 and Its Functional Peptide CSP7 Affect Silica-Induced Pulmonary Fibrosis by Regulating Fibroblast Glutaminolysis.

Exposure to silica is a cause of pulmonary fibrosis disease termed silicosis, which leads to respiratory failure and ultimately death. However, what drives fibrosis is not fully elucidated and therapeutic options remain limited. Our previous RNA-sequencing analysis showed that the expression of caveolin-1 (CAV1) was downregulated in silica-inhaled mouse lung tissues. Here, we not only verified that CAV1 was decreased in silica-induced fibrotic mouse lung tissues in both messenger RNA and protein levels, but also found that CSP7, a functional peptide of CAV1, could attenuate pulmonary fibrosis in vivo. Further in vitro experiments revealed that CAV1 reduced the expression of Yes-associated protein 1(YAP1) and affected its nuclear translocation in fibroblasts. In addition, Glutaminase 1 (GLS1), a key regulator of glutaminolysis, was identified to be a downstream effector of YAP1. CAV1 could suppress the activity of YAP1 to decrease the transcription of GLS1, thereby inhibiting fibroblast activation. Taken together, our results demonstrated that CAV1 and its functional peptide CSP7 may be potential molecules or drugs for the prevention and intervention of silicosis.

Liposomal UHRF1 siRNA shows lung fibrosis treatment potential through regulation of fibroblast activation.

Pulmonary fibrosis is a chronic and progressive interstitial lung disease associated with the decay of pulmonary function, which leads to a fatal outcome. As an essential epigenetic regulator of DNA methylation, the involvement of ubiquitin-like containing PHD and RING finger domains 1 (UHRF1) in fibroblast activation remains largely undefined in pulmonary fibrosis. In the present study, we found that TGF-ß1-mediated upregulation of UHRF1 repressed beclin 1 via methylated induction of its promoter, which finally resulted in fibroblast activation and lung fibrosis both in vitro and in vivo. Moreover, knockdown of UHRF1 significantly arrested fibroblast proliferation and reactivated beclin 1 in lung fibroblasts. Thus, intravenous administration of UHRF1 siRNA-loaded liposomes significantly protected mice against experimental pulmonary fibrosis. Accordingly, our data suggest that UHRF1 might be a novel potential therapeutic target in the pathogenesis of pulmonary fibrosis.

First Report of Chestnut Blight Caused by Cryphonectria parasitica on Chestnut (Castanea seguinii) in Gansu Province, China.

In China, chestnut blight usually causes insignificant damage to fruit production of Chinese chestnut (Castanea mollissima Blume) and no serious disease epidemics occur, due to the high resistance to Cryphonectria parasitica (Huang et al. 1998). According to recent surveys, chestnut blight was mainly found in sixteen provinces including Shandong, Hebei, Anhui, Hunan, Jiangxi, Beijing, and Fujian, with severe cases occurring occasionally (Guo et al. 2005). The disease incidence has been aggravated with increasing monoculture of newly improved chestnut cultivars in chestnut-producing areas (Yan et al. 2007), though it was not detected in Gansu Province. In September 2021, some chestnut trees (Castanea seguinii) showing symptoms of crown dieback and diffuse sunken cankers on the trunk with swelled margins and subsequent cracking of the outer bark, were collected in mountains of Hui County in Longnan City, Gansu Province (E 104° 15' 5.76″ ，N 35° 11' 30.84″). Symptomatic branches were washed using tap water and dried on sterilized tissue paper. The Junction between diseased and healthy tissue was cut from the bark and sterilized with NaClO (2.5 %) for 2 minutes, then plated on potato dextrose agar (PDA) and incubated at 25 ℃ for 3 to 4 days. After fungal colonies formed, mycelia were transferred and subcultured onto new PDA media and then purified using single spore culture. After 7 days, colonies turned yellow white. Uninucleate conidia were formed in orange pycnidia and the orange pigments could turn purple if in 2% KOH. Conidia were straight or slightly curved, hyaline, with 2.5-3.5 × 1.2-1.5 µm in size. The characteristics of the culture and morphology were similar with those of C. parasitica (Tziros et al. 2016). Perithecia were not found on culture medium. In accordance with previous findings, the sexual stage of C. parasitica appears on diseased trees in late October. For molecular identification, genomic DNA was extracted from mycelium using a Fungal Genomic DNA Extraction Kit (Tsingke Biotech Co. Ltd, Xi'an, China), the ITS region was amplified with primers ITS1/ITS4 (Sorrentino et al. 2019), and the TEF1-α region was amplified with primers TEF-1H/TEF-2T (O'Donnel et al. 1998). Cloning and sequencing of PCR products were carried out by Tsingke Biotech Co. Ltd, Xi'an, China. The resulting sequences were deposited in GenBank (ITS sequence accession number: OM033734, TEF sequence accession number: OM12254). BLAST results revealed that the sequences of ITS and TEF shared identity over 99% with those of C. parasitica strains (GenBank accession number: AY308953, KP524763, KP824756 and KF220299). Based on morphological and molecular characteristic, the fungal isolates were identified as C. parasitica. To verify pathogenicity, thirty 3-year-old chestnut seeding (70 cm high, 1 cm diameter) of Castanea seguinii were used for inoculation. Chestnut branches were wounded (five wounds per sapling) using a hole punch and inoculated with a mycelial plug (5 mm in diameter) from the edge of 7-day-old, actively growing colonies. Pathogen-free PDA plugs were used as controls. To prevent desiccation, inoculated wounds were sealed with parafilm, and saplings were incubated in a greenhouse at 25℃. Each treatment consisted of 5 seedling and the pathogenicity tests were repeated three times. After inoculation for 5 weeks, symptoms of bark cankers were observed on branches similar to those of diseased chestnut trees in the field. Control saplings with sterile PDA discs did not display symptoms. C. parasitica was reisolated from inoculated branches. To our knowledge, this is the first report of C. parasitica causing chestnut blight in Gansu Province, one of the few areas in the China thought to be free of the disease. The specimens were found in the westernmost part of the natural distribution of chestnuts in China. There are more than 2.6 million chestnut trees, which constitute one of the most important economic forests in Hui County Gansu Province (Yang et al. 2005). The occurrence of chestnut blight could be a restricting factor for chestnut forests.

Transcriptome-wide association study identifies PSMB9 as a susceptibility gene for coal workers' pneumoconiosis.

Coal workers' pneumoconiosis (CWP) is a type of typical occupational lung disease caused by prolonged inhalation of coal mine dust. The individuals' different genetic background may underlie their different susceptibility to develop pneumoconiosis, even under the same exposure level. This study aimed to identify susceptibility genes associated with CWP. Based on our previous genome-wide association study (GWAS, 202 CWP cases vs. 198 controls) and gene expression data obtained by analyzing human lungs and whole blood from the Genotype-Tissue Expression (GTEx) Portal, a transcriptome-wide association study (TWAS) was applied to identify CWP risk-related genes. Luciferase report gene assay, qRT-PCR, Western blot, immunofluorescence assay, and TUNEL assay were conducted to explore the potential role of the candidate gene in CWP. Proteasome 20S subunit beta 9 (PSMB9) was identified as a strong risk-related gene of CWP in both lungs and whole blood (Lungs: PTWAS  = 4.22 × 10-4 ; Whole blood: PTWAS  = 2.11 × 10-4 ). Single nucleotide polymorphisms (SNPs) rs2071480 and rs1351383, which locate in the promoter region and the first intron of the PSMB9 gene, were in high linkage disequilibrium (LD, r2  = 0.98) with the best GWAS SNP rs4713600 (G>T, OR = 0.55, 95% CI: 0.42-0.74, P = 6.86 × 10-5 ). Both rs2071480 and rs1351383 significantly enhanced the transcriptional activity of PSMB9. Functional experiments revealed that silica exposure remarkably reduced the PSMB9 expression and caused cell apoptosis, while overexpression of PSMB9 markedly abolished silica-induced cell apoptosis. We here identified PSMB9 as a novel susceptibility gene for CWP and provided important insights into the further exploration of the CWP pathogenesis.

ALKBH5 promotes lung fibroblast activation and silica-induced pulmonary fibrosis through miR-320a-3p and FOXM1.

BACKGROUND: N6-methyladenosine (m6A) is the most common and abundant internal modification of RNA. Its critical functions in multiple physiological and pathological processes have been reported. However, the role of m6A in silica-induced pulmonary fibrosis has not been fully elucidated. AlkB homolog 5 (ALKBH5), a well-known m6A demethylase, is upregulated in the silica-induced mouse pulmonary fibrosis model. Here, we sought to investigate the function of ALKBH5 in pulmonary fibrosis triggered by silica inhalation. METHODS: We performed studies with fibroblast cell lines and silica-induced mouse pulmonary fibrosis models. The expression of ALKBH5, miR-320a-3p, and forkhead box protein M1 (FOXM1) was determined by quantitative real-time polymerase chain reaction (qRT-PCR) analysis. RNA immunoprecipitation (RIP) assays and m6A RNA immunoprecipitation assays (MeRIP), western bolt, immunofluorescence assays, and 5-ethynyl-2'-deoxyuridine (EdU) fluorescence staining were performed to explore the roles of ALKBH5, miR-320a-3p, and FOXM1 in fibroblast activation. RESULTS: ALKBH5 expression was increased in silica-inhaled mouse lung tissues and transforming growth factor (TGF)-ß1-stimulated fibroblasts. Moreover, ALKBH5 knockdown exerted antifibrotic effects in vitro. Simultaneously, downregulation of ALKBH5 elevated miR-320a-3p but decreased pri-miR-320a-3p. Mechanically, ALKBH5 demethylated pri-miR-320a-3p, thus blocking the microprocessor protein DGCR8 from interacting with pri-miR-320a-3p and leading to mature process blockage of pri-miR-320a-3p. We further demonstrated that miR-320a-3p could regulate fibrosis by targeting FOXM1 messenger RNA (mRNA) 3'-untranslated region (UTR). Notably, our study also verified that ALKBH5 could also directly regulate FOXM1 in an m6A-dependent manner. CONCLUSIONS: Our findings suggest that ALKBH5 promotes silica-induced lung fibrosis via the miR-320a-3p/FOXM1 axis or targeting FOXM1 directly. Approaches aimed at ALKBH5 may be efficacious in treating lung fibrosis.

First Report of Northern Root-Knot Nematode Meloidogyne hapla on Bupleurum chinensis in Gansu Province, China.

Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19'42″; E 104°2'24″). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 µm, 439.72 to 659.93 µm), W (maximum body width) = (403.92 ± 57.17 µm, 311.01 to 513.34 µm), St (stylet length) = (11.28 ± 1.05 µm, 9.82 to 12.91 µm), MBW (width of the median bulb) = (31.13 ± 3.32 µm, 23.66 to 35.55 µm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 µm, 58,62 to 71.92 µm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 µm, 2.72 to 5.00 µm). Male (n=20): L= (1038.25 ± 90.34 µm, 877.28 to 1206.12 µm), St= (18.13 ± 1.48 µm, 15.10 to 20.12 µm), a (body length divided by greatest body width) = (31.77 ± 4.03 µm, 23.29 to 41.16µm), MBW= (10.97 ± 0.78 µm, 9.05 to 12.31 µm), MB= (64.81 ± 3.45 µm, 59.59 to 71.38 µm), DGO= (4.05 ± 0.47 µm, 3.11 to 5.08 µm), and Spic (spicule length) = (22.57 ± 1.91 µm, 19.26 to 26.43 µm). J2 (n=25): L= (381.73 ± 25.85µm, 336.96 to 419.98 µm), St= (10.52 ± 1.03 µm, 9.15 to 12.14 µm), a= (24.35 ± 2.10 µm, 20.45 to 28.29 µm), DGO= (3.02 ± 0.42 µm, 2.42 to 3.79 µm), c (body length divided by tail length) = (8.90 ± 0.86 µm, 7.71 to 10.48 µm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 µm, 3.47 to 5.04 µm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25℃ for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.

PTX3 alleviates hard metal-induced acute lung injury through potentiating efferocytosis.

Prolonged exposure to hard metal dust results in hard metal lung disease (HMLD) characterized by respiratory symptoms. Understanding the pathogenesis and pathological process of HMLD would be helpful for its early diagnosis and treatment. In this study, we established a mouse model of hard metal-induced acute lung injury through one-time intratracheal instillation of WC-Co dust suspension. We found that WC-Co treatment damaged the lungs of mice, leading to increased production of IL-1ß, TNF-α, IL-6 and IL-18, inflammatory cells infiltration and apoptosis. In vitro, WC-Co induced cytotoxicity, inflammatory response and apoptosis in macrophages (PMA-treated THP-1) and epithelial cells (A549) in a dose-dependent manner. Moreover, RNA-sequence and validation experiments verified that Pentraxin 3 (PTX3), an important mediator in the regulation of inflammation, was elevated both in vivo and in vitro induced by WC-Co. Functional experiments confirmed the PTX3, which was located on the membrane of apoptotic cells, promoted macrophage efferocytosis efficiently. This progress could help block the lung inflammation and contribute to the rapid recovery of WC-Co-induced acute lung injury. These observations provide a further understanding of the molecular mechanism of WC-Co-induced pulmonary injury and disclose PTX3 as a new potential therapeutic approach to relieve WC-Co-induced acute lung injury via efferocytosis.

Exploration study on serum metabolic profiles of Chinese male patients with artificial stone silicosis, silicosis, and coal worker's pneumoconiosis.

Long-term exposure to inhaled silica dust induces pneumoconiosis, which remains a heavy burden in developing countries. Modern industry provides new resources of occupational SiO2 leading to artificial stone silicosis especially in developed countries. This study aimed to characterize the serum metabolic profile of pneumoconiosis and artificial stone silicosis patients. Our case-control study recruited 46 pairs of pneumoconiosis patients and dust-exposed workers. Nontargeted metabolomics and lipidomics by ultra-high-performance liquid chromatography-tandem mass spectrometry platform were conducted to characterize serum metabolic profile in propensity score-matched (PSM) pilot study. 54 differential metabolites were screened, 24 of which showed good screening efficiency through receiver operating characteristics (ROC) in pilot study and validation study (both AUC > 0.75). 4 of the 24 metabolites can predict pneumoconiosis stages, which are 1,2-dioctanoylthiophosphatidylcholine, phosphatidylcholine(O-18:1/20:1), indole-3-acetamide and l-homoarginine. Kynurenine, N-tetradecanoylsphingosine 1-phosphate, 5-methoxytryptophol and phosphatidylethanolamine(22:6/18:1) displayed the potential as specific biomarkers for artificial stone silicosis. Taken together, our results confirmed that tryptophan metabolism is closely related to pneumoconiosis and may be related to disease progression. Hopefully, our results could supplement the biomarkers of pneumoconiosis and provide evidence for the discovery of artificial stone silicosis-specific biomarkers.

Metformin attenuates silica-induced pulmonary fibrosis via AMPK signaling.

BACKGROUND: Silicosis is one of the most common occupational pulmonary fibrosis caused by respirable silica-based particle exposure, with no ideal drugs at present. Metformin, a commonly used biguanide antidiabetic agent, could activate AMP-activated protein kinase (AMPK) to exert its pharmacological action. Therefore, we sought to investigate the role of metformin in silica-induced lung fibrosis. METHODS: The anti-fibrotic role of metformin was assessed in 50 mg/kg silica-induced lung fibrosis model. Silicon dioxide (SiO2)-stimulated lung epithelial cells/macrophages and transforming growth factor-beta 1 (TGF-ß1)-induced differentiated lung fibroblasts were used for in vitro models. RESULTS: At the concentration of 300 mg/kg in the mouse model, metformin significantly reduced lung inflammation and fibrosis in SiO2-instilled mice at the early and late fibrotic stages. Besides, metformin (range 2-10 mM) reversed SiO2-induced cell toxicity, oxidative stress, and epithelial-mesenchymal transition process in epithelial cells (A549 and HBE), inhibited inflammation response in macrophages (THP-1), and alleviated TGF-ß1-stimulated fibroblast activation in lung fibroblasts (MRC-5) via an AMPK-dependent pathway. CONCLUSIONS: In this study, we identified that metformin might be a potential drug for silicosis treatment.

CircHIPK3 regulates pulmonary fibrosis by facilitating glycolysis in miR-30a-3p/FOXK2-dependent manner.

Pulmonary fibrosis develops when myofibroblasts and extracellular matrix excessively accumulate in the injured lung, but what drives fibrosis is not fully understood. Glycolysis has been linked to cell growth and proliferation, and several studies have shown enhanced glycolysis promotes pulmonary fibrosis. However, detailed studies describing this switch remain limited. Here, we identified that TGF-ß1 effectively increased the expression of circHIPK3 in lung fibroblasts, and circHIPK3 inhibition attenuated the activation, proliferation, and glycolysis of fibroblasts in vitro. Dual-luciferase reporter gene assays, RNA immunoprecipitation (RIP), and RNA pull-down assays showed that circHIPK3 could function as a sponge of miR-30a-3p and inhibit its expression. Furthermore, FOXK2, a driver transcription factor of glycolysis, was identified to be a direct target of miR-30a-3p. Mechanistically, circHIPK3 could enhance the expression of FOXK2 via sponging miR-30a-3p, thereby facilitating fibroblast glycolysis and activation. Besides, miR-30a-3p overexpression or FOXK2 knockdown blocked fibroblast activation induced by TGF-ß1 and abrogated the profibrotic effects of circHIPK3. Moreover, circHIPK3 and miR-30a-3p were also dysregulated in fibrotic murine lung tissues induced by silica. Adeno-associated virus (AAV)-mediated circHIPK3 silence or miR-30a-3p overexpression alleviated silica-induced pulmonary fibrosis in vivo. In conclusion, our results identified circHIPK3/miR-30a-3p/FOXK2 regulatory pathway as an important glycolysis cascade in pulmonary fibrosis.

miR-770-5p inhibits the activation of pulmonary fibroblasts and silica-induced pulmonary fibrosis through targeting TGFBR1.

Silicosis is a devastating interstitial lung disease arising from long-term exposure to inhalable silica. Regrettably, no therapy currently can effectively reverse the silica-induced fibrotic lesion. Emerging evidence has indicated that the dysregulation of microRNAs is involved in silica-induced pulmonary fibrosis. The aim of this study is to explore the expression pattern and underlying mechanisms of miR-770-5p in silica-induced pulmonary fibrosis. Consistent with our previous miRNA microarray analysis, the results of qRT-PCR showed that miR-770-5p expression was downregulated in silica-induced pulmonary fibrosis in humans and animal models. Administration of miR-770-5p agomir significantly reduced the fibrotic lesions in the lungs of mice exposed to silica dust. MiR-770-5p also exhibited a dramatic reduction in TGF-ß1-activated human pulmonary fibroblasts (MRC-5). Transfection of miR-770-5p mimics significantly decreased the viability, migration ability, and S/G0 phase distribution, as well as the expression of fibronectin, collagen I, and α-SMA in TGF-ß1-treated MRC-5 cells. Transforming growth factor-ß receptor 1 (TGFBR1) was confirmed as a direct target of regulation by miR-770-5p. The expression of TGFBR1 was significantly increased in pulmonary fibrosis. Knockdown of TGFBR1 blocked the transduction of the TGF-ß1 signaling pathway and attenuated the activation of MRC-5 cells, while overexpression of TGFBR1 effectively restored the activation of MRC-5 cells inhibited by miR-770-5p. Together, our results demonstrated that miR-770-5p exerted an anti-fibrotic effect in silica-induced pulmonary fibrosis by targeting TGFBR1. Targeting miR-770-5p might provide a new therapeutic strategy to prevent the abnormal activation of pulmonary fibroblasts in silicosis.