A Breakthrough in Kitavirids: Genetic Variability, Reverse Genetics, Koch's Postulates, and Transmission of Hibiscus Green Spot Virus 2.

Hibiscus green spot virus 2 (HGSV-2), a member of the genus Higrevirus (family Kitaviridae), is a positive-stranded RNA virus associated with leprosis-like symptoms in citrus and green spots on leaves in hibiscus. HGSV-2 has only been reported in Hawaii, and while it is speculated that mites in the genus Brevipalpus might be responsible for its transmission, proper transmission assays have yet to be conducted. This study characterizes additional citrus and hibiscus isolates of HGSV-2 collected from two Hawaiian Islands. We constructed an infectious cDNA clone from a hibiscus isolate of HGSV-2 collected on Oahu and demonstrated its ability to infect several experimental hosts, including Phaseolus vulgaris, Nicotiana tabacum, and N. benthamiana, as well as natural hosts, Citrus reticulata and Hibiscus arnottianus. Bacilliform virions with varied sizes of 33 to 120 nm (length) and 14 to 70 nm (diameter) were observed in partially purified preparations obtained from agroinoculated leaves. Virus progeny from the infectious cDNA clone was found to be infectious after mechanical transmission to N. benthamiana and to cause local lesions. Finally, an isoline colony of the mite Brevipalpus azores had vector competence to transmit a citrus isolate of HGSV-2 collected from Maui to citrus and hibiscus plants, demonstrating the mite-borne nature of HGSV-2. The infectious cDNA clone developed in this study is the first reverse-genetics system for a kitavirid and will be fundamental to better characterize basic biology of HGSV-2 and its interactions with host plants and mite vectors.

In-silico prediction of RT-qPCR-high resolution melting for broad detection of emaraviruses.

Twenty-four species of RNA viruses contain members infecting economically important crops that are classified within the genus Emaravirus, family Fimoviridae. There are at least two other non-classified species that may be added. Some of these viruses are spreading rapidly and cause economically important diseases on several crops, raising a need for a sensitive diagnostic technique for taxonomic and quarantine purposes. High-resolution melting (HRM) has shown to be reliable for the detection, discrimination, and diagnosis of several diseases of plants, animals, and humans. This research aimed to explore the ability to predict HRM outputs coupled to reverse transcription-quantitative polymerase chain reaction (RT-qPCR). To approach this goal a pair of degenerate genus-specific primers were designed for endpoint RT-PCR and RT-qPCR-HRM and the species in the genus Emaravirus were selected to framework the development of the assays. Both nucleic acid amplification methods were able to detect in-vitro several members of seven Emaravirus species with sensitivity up to one fg of cDNA. Specific parameters for in-silico prediction of the melting temperatures of each expected emaravirus amplicon are compared to the data obtained in-vitro. A very distinct isolate of the High Plains wheat mosaic virus was also detected. The high-resolution DNA melting curves of the RT-PCR products predicted in-silico using uMeltSM allowed saving time while designing and developing the RT-qPCR-HRM assay since the approach avoided extensive searching for optimal HRM assay regions and rounds of HRM tests in-vitro for optimization. The resultant assay provides sensitive detection and reliable diagnosis for potentially any emaravirus, including new species or strains.

Molecular and Biological Characterization of a Novel Tobamovirus Infecting Sunn Hemp (Crotalaria juncea) in Hawaii.

Sunn hemp (Crotalaria juncea L.) cultivar Tropic Sun plants, stunted and displaying mottle and mosaic symptoms on foliage, were observed at a seed farm in Maui County, Hawaii. Lateral flow assays indicated the presence of either tobacco mosaic virus or a serologically related virus. High-throughput sequencing results coupled with real-time PCR experiments recovered the 6,455-nucleotide genome of a virus with an organization typical of tobamoviruses. Nucleotide and amino acid sequence comparisons and phylogenetic analyses indicated that this virus was most closely related to sunn-hemp mosaic virus but represents a distinct species. Sunn-hemp mottle virus (SHMoV) is being proposed as the common name of this virus. Transmission electron microscopy of virus extracts purified from symptomatic leaves revealed rod-shaped particles approximately 320 by 22 nm in size. In inoculation studies, the experimental host range of SHMoV appeared limited to members of the plant families Fabaceae and Solanaceae. Greenhouse experiments demonstrated plant-to-plant transmission of SHMoV that increased with ambient wind speed. Seeds from SHMoV-infected Tropic Sun were collected and were either surface disinfested or directly planted. A total of 924 seedlings germinated; 2 were positive for the virus, resulting in a seed transmission rate of 0.2%. Both infected plants came from the surface disinfestation treatment, suggesting that the virus might be unaffected by the treatment.

First detection and complete genome sequence of a new tobamovirus naturally infecting Hibiscus rosa-sinensis in Hawaii.

High-throughput sequencing was used to analyze Hibiscus rosa-sinensis (family Malvaceae) plants with virus-like symptoms in Hawaii. Bioinformatic and phylogenetic analysis revealed the presence of two tobamoviruses, hibiscus latent Fort Pierce virus (HLFPV) and a new tobamovirus with the proposed name "hibiscus latent Hawaii virus" (HLHV). This is the first report of the complete sequence, genome organization, and phylogenetic characterization of a tobamovirus infecting hibiscus in Hawaii. RT-PCR with virus-specific primers and Sanger sequencing further confirmed the presence of these viruses. Inoculation experiments showed that HLFPV could be mechanically transmitted to Nicotiana benthamiana and N. tabacum, while HLHV could only be mechanically transmitted to N. benthamiana.

Survey of Viruses Infecting Basella alba in Hawaii.

Malabar spinach plants (Basella alba, Basellaceae) with leaves exhibiting symptoms of mosaic, rugosity, and malformation were found in a community garden on Oahu, HI in 2018. Preliminary studies using enzyme-linked immunosorbent assay and reverse-transcription (RT)-PCR identified Basella rugose mosaic virus (BaRMV) in symptomatic plants. However, nucleotide sequence analysis of RT-PCR amplicons indicated that additional potyviruses were also present in the symptomatic Malabar spinach. High-throughput sequencing (HTS) analysis was conducted on ribosomal RNA-depleted composite RNA samples of potyvirus-positive plants from three locations. Assembled contigs shared sequences similar to BaRMV, chilli veinal mottle virus (ChiVMV), Alternanthera mosaic virus (AltMV), Basella alba endornavirus (BaEV), broad bean wilt virus 2 (BBWV2), and Iresine viroid 1. Virus- and viroid-specific primers were designed based on HTS sequencing results and used in RT-PCR and Sanger sequencing to confirm the presence of these viruses and the viroid. We tested 63 additional samples from six community gardens for a survey of viruses in Malabar spinach and found that 21 of them were positive for BaRMV, 57 for ChiVMV, 21 for AltMV, 19 for BaEV, and 14 for BBWV2. This is the first characterization of the virome from B. alba.

Genetic Diversity of Viral Populations Associated with Ananas Germplasm and Improvement of Virus Diagnostic Protocols.

Pineapple (Ananas comosus L. [Merr.]) accessions from the U.S. Tropical Plant Genetic Resources and Disease Research (TPGRDR) in Hilo, Hawaii were subjected to RNA-sequencing to study the occurrence of viral populations associated with this vegetatively propagated crop. Analysis of high-throughput sequencing data obtained from 24 germplasm accessions and public domain transcriptome shotgun assembly (TSA) data identified two novel sadwaviruses, putatively named "pineapple secovirus C" (PSV-C) and "pineapple secovirus D" (PSV-D). They shared low amino acid sequence identity (from 34.8 to 41.3%) compared with their homologs in the Pro-pol region of the previously reported PSV-A and PSV-B. The complete genome (7485 bp) corresponding to a previously reported partial sequence of the badnavirus, pineapple bacilliform ER virus (PBERV), was retrieved from one of the datasets. Overall, we discovered a total of 69 viral sequences representing ten members within the Ampelovirus, Sadwavirus, and Badnavirus genera. Genetic diversity and recombination events were found in members of the pineapple mealybug wilt-associated virus (PMWaV) complex as well as PSVs. PMWaV-1, -3, and -6 presented recombination events across the quintuple gene block, while no recombination events were found for PMWaV-2. High recombination frequency of the RNA1 and RNA2 molecules from PSV-A and PSV-B were congruent with the diversity found by phylogenetic analyses. Here, we also report the development and improvement of RT-PCR diagnostic protocols for the specific identification and detection of viruses infecting pineapple based on the diverse viral populations characterized in this study. Given the high occurrence of recombination events, diversity, and discovery of viruses found in Ananas germplasm, the reported and validated RT-PCR assays represent an important advance for surveillance of viral infections of pineapple.

First report of plumeria mosaic virus infecting Plumeria spp. in the United States.

Plumeria (Plumeria spp.) is a small ornamental tree grown in subtropical and tropical areas, providing shade and attractive and fragrant flowers in public and private landscapes. In Hawaii, plumeria is also commercially grown, with flowers harvested for cut flower and lei production. In 2019, a total of 10 cut flower plumeria farms in Hawaii sold 7,356,702 blossoms, valued at $395,791 (USDA/NASS). In July 2021, a commercial plumeria farm in Maui County, Hawaii reported trees with flowers exhibiting color breaking, and leaves with mosaic and vein banding. To determine if a viral pathogen was present, leaf tissue from a symptomatic plant was processed using a Double-RNA Viral dsRNA Extraction Kit for plant tissue (iNtRON Biotechnology, Korea), followed by random amplification (Melzer et al. 2010). The resulting products underwent paired-end sequencing on a MiSeq platform (Illumina, CA) at the Advanced Studies in Genomics, Proteomics, and Bioinformatics laboratory at the University of Hawaii. Of the 2,913,913 paired-end 300-bp reads generated, Geneious Prime (Biomatters, New Zealand) mapped 350,686 to plumeria mosaic virus (PluMV; KJ395757.1) and 293,911 to frangipani mosaic virus (FrMV; JN555602.2), with mean coverage depths of 10,318 and 7,348 respectively. A 6,648 nt contig representing the near full-length genome of PluMV-HI (OP342599) was found to be >97% identical to PluMV isolates PluMV-DR_TW (KX881422.2) and PluMV-Plu-Ind-1 (KJ395757.1). Similarly, a 6,631 nt contig representing the near full-length genome of FrMV-HI (OP342600) was found to be >98% identical to FrMV isolates FrMV-P (Lim et al. 2010; HM026454.1) and FrMV-Fr-Ind-1 (Kumar et al. 2015; JN555602.2). Bioinformatic analyses (Olmedo-Velarde et al. 2019) of the reads that did not map to PluMV and FrMV suggested the presence of a novel ampelovirus and reovirus in the tissue. To confirm the presence of PluMV and FrMV in Hawaii, leaves were collected in June 2022 from 5 plumeria trees on the Maui County farm and 16 ornamental plumeria trees from Honolulu County. Total RNA extracted as described by Li et al. (2008) as well as non-template (water) and positive (HTS tissue sample) controls underwent RT-PCR using random primers for cDNA synthesis, followed by virus-specific primers for PluMV (1133: 5'-TGGGCAAATAATCCGGCTATAC-3'/1134: 5'CCGGAGAGAGCATCAAACAA-3') and FrMV (1129: 5'-TGAGTTTAGGTCGCAGTTGATAG-3'/1130: 5-'AAAGACCAGAACCTCCAGAAAG-3') in singleplex reactions. The results indicated that all 5 plumeria samples from Maui County were positive for both PluMV and FrMV, whereas 6 out of 16 plumeria samples collected from Honolulu County tested positive for PluMV only. Both PluMV and FrMV are tobamoviruses (Virgaviridae) that can be transmitted mechanically and spread through the introduction and/or movement of cuttings, the primary method of plumeria propagation. Both PluMV and FrMV cause leaf mosaic (Kumar et al. 2015; Lim et al. 2010; Lin et al. 2020) and FrMV may also cause color break or "splash" in flowers, which was observed at the Maui County farm. This represents the first report of PluMV in the USA. FrMV was detected in Florida (Dey et al. 2020), but this is the first report of the virus in Hawaii. Additional surveys are required to determine the incidence of both viruses in other counties of Hawaii. The putative discovery of a novel ampelovirus and reovirus in plumeria warrants further research to characterize these agents and determine their distribution and impact on plumeria health.

Genome sequence of pineapple secovirus B, a second sadwavirus reported infecting Ananas comosus.

The complete genome sequence of pineapple secovirus B (PSV-B), a new virus infecting pineapple (Ananas comosus) on the island of Oahu, Hawaii, was determined by high-throughput sequencing (HTS). The genome comprises two RNAs that are 5,956 and 3,808 nt long, excluding the 3'-end poly-A tails, both coding for a single large polyprotein. The RNA1 polyprotein contains five conserved domains associated with replication, while the RNA2 polyprotein is cleaved into the movement protein and coat protein. PSV-B is representative of a new species in the subgenus Cholivirus (genus Sadwavirus; family Secoviridae), as the level of amino acid sequence identity to recognized members of this subgenus in the Pro-Pol and coat protein regions is below currently valid species demarcation thresholds.

Examination of the Virome of Taro Plants Affected by a Lethal Disease, the Alomae-Bobone Virus Complex, in Papua New Guinea.

Alomae-bobone virus complex (ABVC) is a lethal but still understudied disease that is limited to the Solomon Islands and Papua New Guinea. The only virus clearly associated to ABVC is Colocasia bobone disease-associated virus (CBDaV). Taro (Colocasia esculenta) plants with and without symptoms of ABVC disease were sampled from two locations in Papua New Guinea and examined for viruses using high-throughput sequencing (HTS). Similar to previous reports, isolates of CBDaV were present only in symptomatic plants, further supporting its role in the disease. The only other viruses consistently present in symptomatic plants were badnaviruses: taro bacilliform virus (TaBV) and/or taro bacilliform CH virus (TaBCHV). If ABVC requires co-infection by multiple viruses, CBDaV and badnavirus infection appears to be the most likely combination. The complete genomes of two isolates of CBDaV and TaBCHV, and single isolates of TaBV and dasheen mosaic virus, were obtained in this study, furthering our knowledge of the genetic diversity of these relatively understudied taro viruses. HTS data also provided evidence for an agent similar to umbra-like viruses that we are tentatively designating it as Colocasia umbra-like virus (CULV).

Complete genome organization and characterization of Hippeastrum latent virus.

The complete genome sequences of two carlaviruses were determined by high-throughput sequencing of RNA extracted from ringspot and mosaic, disease symptoms on leaves of spider lily plants (Crinum asiaticum, family Amaryllidaceae) growing as landscape plants in Hawaii. One, named Nerine latent virus (NeLV)-Hawaii with a genome of 8281 nucleotide exhibited the highest nucleotide identity and amino acid similarity of 95.5% and 96.0%, respectively, to the genome sequence of an isolate of NeLV from Narcissus sp. in Australia (JQ395044). The second, named Hippeastrum latent virus (HiLV)-Hawaii with a genome of 8497 nucleotides exhibited the highest nucleotide identity and amino acid similarity, 84.3% and 88.7%, respectively, to the sequence of a previously uncharacterized HiLV isolate from a potted flowering plant, Amaryllis (Hippeastrum hybridum Hort) in Taiwan (DQ098905). The amino acid sequence similarities of replicase (Rep) and coat protein (CP) between HiLV-Hawaii and NeLV-Hawaii were 44.8% and 38.4%, respectively. Results of viral protein Rep and CP amino acid sequence comparisons from various carlaviruses provide evidence that HiLV and NeLV, previously classified as synonymous viruses are in fact unique viruses. This is the first report for the complete sequence, organization, and phylogenetic characterization of HiLV and the first detection of HiLV both in C. asiaticum and in the USA.

First report of the hibiscus strain of citrus leprosis virus C2 infecting passionfruit (Passiflora edulis).

In Hawaii, passionfruit (Passiflora edulis; Passifloraceae) is grown primarily in residential properties and community gardens (CG). In 2019, passionfruit plants displaying chlorotic spots on young leaves, and green spots in senescing leaves were observed at two CG in Honolulu. Symptoms resembled those of passionfruit green spot virus (PfGSV) infection in Passiflora spp. (Ramos-González et al. 2020) and of the hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) infection in hibiscus in Hawaii (Melzer et al. 2013). Both viruses belong to the genus Cilevirus, family Kitaviridae. Total RNA was extracted from two sample pools comprised of 40 symptomatic leaves collected from both the CG following a CTAB-based procedure (Li et al. 2008). To identify the virus associated with the P. edulis infection, reverse transcription (RT)-polymerase chain reaction (PCR) was performed using CiLV-C2 (Olmedo-Velarde et al. 2021) and PfGSV specific primers (Ramos-González et al. 2020). RT-PCR assay amplified the CiLV-C2 amplicon but failed to produce the PfGSV amplicon from infected leaves. Amplicon sequencing followed by a BLASTn search showed the nucleotide sequence had >99% identity with the CiLV-C2H-RNA1 (KC626783). A ribo-depleted RNA library created using the TruSeq Stranded Total RNA Library Prep kit (Illumina) underwent high throughput sequencing (HTS) on a NextSeq550 Illumina platform (2x75 cycles). The 6.5 million raw reads obtained were trimmed, filtered, and de novo assembled using Metaviral SPAdes v. 3.15.02 (Antipov et al. 2020). The resulting contigs were searched against an in-house database generated from GenBank virus and viroid sequences using BLASTn. This identified 12 and 3 contigs corresponding to CiLV-C2H and watermelon mosaic virus, respectively, with the latter being previously reported in passionfruit (Watanabe et al. 2016). RNA1 contigs covered 80.17% of the CiLV-C2H genome, whereas RNA2 contigs covered 94.5% with an average coverage depth of 31.660 and 57.121, respectively. To obtain the near complete genome of CiLV-C2H, gaps from the assembled HTS data were filled by overlapping RT-PCR followed by Sanger sequencing. RNA1 (8,536 nt, Acc. No. MW413437) and RNA2 (4,878 nt, MW413438) genome sequences shared 99.2% and 97.0% identity with CiLV-C2H-RNA1 (KC626783) and -RNA2 (KC626784). To further confirm the presence of CiLV-C2H in symptomatic P. edulis plants, 40 symptomatic leaf samples were individually tested by RT-PCR, and 30 samples were positive. Brevipalpus mites collected from CiLV-C2H-positive P. edulis leaves were transferred to common bean (Phaseolus vulgaris) seedlings (Garita et al. 2013). At 15-30 days post-transfer, RNA extracted from lesions observed in recipient plants tested positive for CiLV-C2H by RT-PCR. Total RNA from individual Brevipalpus mites was isolated, and cDNA was prepared to tentatively identify the mite species involved in CiLV-C2H transmission in passionfruit (Druciarek et al 2019, Olmedo-Velarde et al. 2021). CiLV-C2H was detected in individual mites, and the 28S ribosomal mite RNA sequence (MZ478051) shared 99-100% nucleotide identity with B. yothersi (MK293678 and MT812697), a vector of CiLV-C2 (Roy et al. 2013). CiLV-C2 currently has a host range limited to the families Malvaceae, Araceae, and Rutaceae (Roy et al. 2015). CiLV-C2H infects hibiscus alone and citrus in mixed infection with CiLV-C2 (Roy et al; 2018) which is responsible for causing citrus leprosis disease. Detection of CiLV-C2H in passionfruit expands the number of host families of CiLV-C2H.

First Detection and Genome Characterization of a New RNA Virus, Hibiscus Betacarmovirus, and a New DNA Virus, Hibiscus Soymovirus, Naturally Infecting Hibiscus spp. in Hawaii.

Hibiscus (Hibiscus spp., family Malvaceae) leaves exhibiting symptoms of mosaic, ringspot, and chlorotic spots were collected in 2020 on Oahu, HI. High-throughput sequencing analysis was conducted on ribosomal RNA-depleted composite RNA samples extracted from symptomatic leaves. About 77 million paired-end reads and 161,970 contigs were generated after quality control, trimming, and de novo assembly. Contig annotation with BLASTX/BLASTN searches revealed a sequence (contig 1) resembling the RNA virus, hibiscus chlorotic ringspot virus (genus Betacarmovirus), and one (contig 2) resembling the DNA virus, peanut chlorotic streak virus (genus Soymovirus). Further bioinformatic analyses of the complete viral genome sequences indicated that these viruses, with proposed names of hibiscus betacarmovirus and hibiscus soymovirus, putatively represent new species in the genera Betacarmovirus and Soymovirus, respectively. RT-PCR using specific primers, designed based on the retrieved contigs, coupled with Sanger sequencing, further confirmed the presence of these viruses. An additional 54 hibiscus leaf samples from other locations on Oahu were examined to determine the incidence and distribution of these viruses.

Exploring in-silico prediction for the development of a RT-qPCR-high resolution melting assay for the broad detection of emaraviruses.

High-resolution melting (HRM) has shown to be reliable for the detection, discrimination, and diagnosis of several diseases of plants, animals, and humans. The aim of this research was to explore the ability to predict HRM outputs when coupled to reverse transcription quantitative polymerase chain reaction (RT-qPCR). This research used the species in the Emaravirus genus as model to framework the development of genus-specific RT-qPCR-HRM assays. A pair of degenerate genus-specific primers were designed for use in endpoint RT-PCR and RT-qPCR-HRM detection of emaraviruses. Eleven species of RNA viruses infecting economically important crops are classified within the genus Emaravirus, family Fimoviridae. There are at least fifteen other non-classified species that may be added. Some of these viruses are spreading rapidly and cause economically important diseases on several crops, raising a need for a sensitive diagnostic technique for taxonomic and quarantine purposes. RT-PCR and RT-qPCR-HRM were able to detect seven emaravirus species in-vitro with sensitivity up to one fg of cDNA. Specific parameters for prediction in-silico of the melting temperatures of each expected emaravirus amplicon are provided and compared to the data obtained in-vitro. A very distinct isolate of the High Plains wheat mosaic virus was also detected. The prediction in-silico of fluorescence of high-resolution DNA melting curves of predicted RT-PCR products using uMeltSM speeded the design and development of RT-qPCR-HRM assay. This approach avoided rounds of HRM tests in-vitro when searching for the optimal regions that provides accurate diagnosis. The resultant assay provided sensitive detection and reliable diagnosis for potentially any emaravirus, including new species or strains.

Genome characterization of fig umbra-like virus.

The complete genome of a new umbra-like virus from edible fig (Ficus carica) was identified by high-throughput sequencing. Based on its similarity to umbra-like virus genome sequences available in GenBank, the proposed name of this new virus is "fig umbra-like virus" (FULV). The genome of full-length FULV-1 consists of 3049 nucleotides organized into three open reading frames (ORFs). Pairwise comparisons showed that the complete nucleotide sequence of the virus had the highest identity (71.3%) to citrus yellow vein-associated virus (CYVaV). In addition, phylogenetic trees based on whole-genome nucleotide sequences and amino acid sequences of the RNA-dependent RNA polymerase showed that FULV forms a monophyletic lineage with CYVaV and other umbra-like viruses. Based on the demarcation criteria of the genus Umbravirus, and lack of two umbravirus ORFs, we propose that FULV is a putative new member of the umbra-like virus clade within the family Tombusviridae.

A novel ampelovirus associated with mealybug wilt of pineapple (Ananas comosus).

Mealybug wilt of pineapple (MWP) is the most important and complex viral disease affecting pineapple worldwide. High-throughput sequencing was conducted to characterize a new virus identified only in symptomatic pineapple plants and tentatively named pineapple mealybug wilt-associated virus 6 (PMWaV-6). Data analyses revealed a genome of 17,854 nucleotides with an organization resembling members of the genus Ampelovirus, family Closteroviridae. Encoded proteins shared sequence identity with the corresponding proteins of grapevine leafroll-associated virus 3, blackberry vein banding-associated virus, and PMWaV-2. The present study reports the discovery of PMWaV-6, a putative and distinct new member of the genus Ampelovirus, subgroup I, its potential involvement in MWP, and the development of PMWaV-6-specific RT-PCR assays to detect and monitor this virus in field samples.

A Virus Infecting Hibiscus rosa-sinensis Represents an Evolutionary Link Between Cileviruses and Higreviruses.

Hibiscus (Hibiscus spp.) are popular ornamental and landscape plants in Hawaii which are susceptible to foliar diseases caused by viruses belonging to the genera Cilevirus and Higrevirus (family Kitaviridae). In this study, a virus infecting H. rosa-sinensis plants displaying foliar symptoms consistent with infection by a kitavirus, including yellow chlorotic blotches with a green perimeter, was characterized. The genome consisted of two RNAs 8.4 and 4.4 kb in length, and was organized most similarly to cileviruses, but with important distinctions. These included the location of the p29 homolog as the 3'-terminal open reading frame (ORF) of RNA2 instead of its typical locus at the 3'-end of RNA1; the absence of a p15 homolog on RNA2 and the adjacent intergenic region which also harbors small putative ORFs of unknown function; and the presence of an ORF encoding a 10 kDa protein at the 3'-terminal end of RNA1 that was also found to be present in the hibiscus green spot virus 2 genome. Spherical particles approximately 55-65 nm in diameter were observed in infected leaf tissue, and viral RNA was detected by reverse-transcription PCR in individual mites collected from symptomatic plants tentatively identified as Brevipalpus yothersi. Although phylogenetic analyses placed this virus between the higrevirus and cilevirus clades, we propose the tentative taxonomic placement of this virus, designated hibiscus yellow blotch virus (HYBV), within the genus Cilevirus.

First report of orchid fleck virus associated with citrus leprosis symptoms in rough lemon (Citrus jambhiri) and mandarin (C. reticulata) the United States.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

Plant part and a steep environmental gradient predict plant microbial composition in a tropical watershed.

Plant microbiomes are shaped by forces working at different spatial scales. Environmental factors determine a pool of potential symbionts while host physiochemical factors influence how those microbes associate with distinct plant tissues. These scales are seldom considered simultaneously, despite their potential to interact. Here, we analyze epiphytic microbes from nine Hibiscus tiliaceus trees across a steep, but short, environmental gradient within a single Hawaiian watershed. At each location, we sampled eight microhabitats: leaves, petioles, axils, stems, roots, and litter from the plant, as well as surrounding air and soil. The composition of bacterial communities is better explained by microhabitat, while location better predicted compositional variance for fungi. Fungal community compositional dissimilarity increased more rapidly along the gradient than did bacterial composition. Additionally, the rates of fungal community compositional dissimilarity along the gradient differed among plant parts, and these differences influenced the distribution patterns and range size of individual taxa. Within plants, microbes were compositionally nested such that aboveground communities contained a subset of the diversity found belowground. Our findings indicate that both environmental context and microhabitat contribute to microbial compositional variance in our study, but that these contributions are influenced by the domain of microbe and the specific microhabitat in question, suggesting a complicated and potentially interacting dynamic.

Novel Fig-Associated Viroid-Like RNAs Containing Hammerhead Ribozymes in Both Polarity Strands Identified by High-Throughput Sequencing.

Based on high-throughput sequencing (HTS) data, the existence of viroid-like RNAs (Vd-LRNAs) associated with fig trees grown in the Hawaiian Islands has been predicted. One of these RNAs has been characterized as a circular RNA ranging in size from 357 to 360 nucleotides. Structural and biochemical features of this RNA, tentatively named fig hammerhead viroid-like RNA (FHVd-LR), markedly resemble those previously reported for several viroids and viroid-like satellite RNAs (Vd-LsatRNAs), which are non-protein-coding RNAs infecting their hosts autonomously and in combination with a helper virus, respectively. The full-length sequence of FHVd-LR variants was determined by RT-PCR, cloning, and sequencing. Despite a low global sequence identity with known viroids and Vd-LsatRNAs, FHVd-LR contains a hammerhead ribozyme (HRz) in each polarity strand. Northern blot hybridization assays identified the circular and linear forms of both polarity strands of FHVd-LR and showed that one strand, assigned the (+) polarity, accumulates at higher levels than the (-) polarity strand in vivo. The (+) polarity RNA assumes a rod-like secondary structure of minimal free energy with the conserved domains of the HRzs located in opposition to each other, a feature typical of several viroids and Vd-LRNAs. The HRzs of both FHVd-LR polarity strands were shown to be active in vitro during transcription, self-cleaving the RNAs at the predicted sites. These data, together with the sequence variability observed in the cloned and sequenced full-length variants, indicate that FHVd-LR is a novel viroid or Vd-LsatRNA. According to HTS data, the coexistence of FHVd-LR of different sizes in the same host cannot be excluded. The relationships of FHVd-LR with previously reported viroids and Vd-LsatRNAs, and the need to perform bioassays to conclusively clarify the biological nature of this circular RNA, are discussed.

Identification and complete genomic sequence of a novel sadwavirus discovered in pineapple (Ananas comosus).

The complete genomic sequence of a putative novel member of the family Secoviridae was determined by high-throughput sequencing of a pineapple accession obtained from the National Plant Germplasm Repository in Hilo, Hawaii. The predicted genome of the putative virus was composed of two RNA molecules of 6,128 and 4,161 nucleotides in length, excluding the poly-A tails. Each genome segment contained one large open reading frame (ORF) that shares homology and phylogenetic identity with members of the family Secoviridae. The presence of this new virus in pineapple was confirmed using RT-PCR and Sanger sequencing from six samples collected in Oahu, Hawaii. The name "pineapple secovirus A" (PSVA) is proposed for this putative new sadwavirus.