Prognostic significance of molecular subgroups in survival outcome for children with medulloblastoma in Malaysia.

Introduction: Advancements in genomic profiling led to the discovery of four major molecular subgroups in medulloblastoma (MB), which have now been incorporated into the World Health Organization classification of central nervous system tumors. The current study aimed to determine the prognostic significance of the MB molecular subgroups among children in Malaysia. Methods: We assembled MB samples from children <18 years between January 2003 and June 2017 from four pediatric oncology centers in Malaysia. MB was sub-grouped using 850k DNA methylation testing at German Cancer Research Centre, Heidelberg, Germany. Results: Fifty samples from patients diagnosed and treated as MB were identified. Two (4%) of the 50 patients' tumor DNA samples were insufficient for analysis. Of the remaining 48 patients, 41 (85%) samples were confirmed as MB, while for 7 (15%) patients, DNA methylation classification results were discrepant with the histopathological diagnosis of MB, with various other diagnoses. Of the 41 MB patients, 15 patients were stratified as standard-risk (SR), 16 patients as high-risk (HR), and ten as infants (age <3 years old). Molecular subgrouping of the whole cohort revealed four (14%) WNT, 11 (27%) SHH, 10 (24%) Group 3, and 16 (39%) Group 4. Treatment abandonment rates for older children and infants were 22.5% and 10%, respectively. After censoring treatment abandonment, for SR patients, the 5-year event-free survival (EFS) and overall survival (OS) were 43.1% ± 14.7% and 46.9 ± 15.6%, respectively, while in HR, 5-year EFS and OS were both 63.6% ± 14.5%. Infants had a 5-year EFS and OS of 55.6% ± 16.6% and 66.7% ± 15.7%, respectively. WNT tumors had the best 5y-OS, followed by Group 3, Group 4, and SHH in children ≥3 years old. In younger children, SHH MB patients showed favorable outcomes. Conclusion: The study highlights the importance of DNA methylation profiling for diagnostic accuracy. Most infants had SHH MB, and their EFS and OS were comparable to those reported in high-income countries. Due to the relatively small cohort and the high treatment abandonment rate, definite conclusions cannot be made regarding the prognostic significance of molecular subgroups of MB. Implementing this high-technology investigation would assist pathologists in improving the diagnosis and provide molecular subgrouping of MB, permitting subgroup-specific therapies.

Demographics and outcome of patients with congenital haemophilia in Sarawak, Malaysia

@#Introduction: Sarawak has a population that is geographically and characteristically widely varied. This study aimed to determine the demographic profile of patients in Sarawak, Malaysia. Materials and Methods – A cross-sectional study was conducted in 2019 at four major haemophilia treatment centres in Kuching, Sibu, Bintulu and Miri Hospitals, Sarawak. Demographic and clinical data were collected with consents from patients. Results and Discussion: Ninety-six haemophilia patients were identified - 79(82.3%) haemophilia A(HA) and 17(17.7%) haemophilia B(HB). Severe haemophilia patients were noted in 45.6% (36/79) of HA and 64.7% (11/17) of HB. In all 44.3% of the HA and 52.9% of the HB population had no identifiable family history of haemophilia. Two-thirds of the patients with severe HA were on prophylaxis [24/36 (66.7%)] and only onethird [4/11 (36.4%)] in severe HB. Inhibitors developed in 9/79 (11.4%) of the HA population [3/79 (3.8%) high responders]. The median inhibitor titre was not significantly different between the different treatment groups – on demand versus prophylaxis (1.0BU versus 2.0BU; z statistic -1.043, p-value 0.297, Mann-Whitney test). None of the patients developed inhibitory alloantibodies to factor IX. Four HA patients (5.1%) underwent immune tolerance induction where one case had a successful outcome. Three severe HA patients received emicizumab prophylaxis and showed remarkable reduction in bleeding events with no thromboembolic events being reported. One female moderate HA patient received PEGylated recombinant anti-haemophilic factor. Eleven patients underwent radiosynovectomy. One mild HB patient succumbed to traumatic intracranial bleeding. Our data reported a prevalence (per 100,000 males) of 5.40 cases for all severities of HA, 2.46 cases for severe HA; 1.16 cases for all severities of HB, and 0.75 cases for severe HB. The overall incidence of HA and HB was 1 in 11,500 and 1 in 46,000, respectively. Conclusion: This study outlines the Sarawakian haemophilia landscape and offers objective standards for forward planning. Shared responsibilities among all parties are of utmost importance to improve the care of our haemophilia population.

Observational study on the current status of thalassaemia in Malaysia: a report from the Malaysian Thalassaemia Registry.

OBJECTIVE: Thalassaemia is the most common inherited blood disorder in Malaysia. This study aims to report the current status of thalassaemia in Malaysia and provide a comprehensive understanding of the disease through data obtained from the Malaysian Thalassaemia Registry. DESIGN: Data were extracted from the Malaysian Thalassaemia Registry, a web-based system accessible to enrolled users through www.mytalasemia.net.my. SETTING: The Malaysian Thalassaemia Registry data was recorded from reports obtained from 110 participating government and university hospitals in Malaysia. PARTICIPANTS: The patients were those attending the 110 participating hospitals for thalassaemia treatment. INTERVENTION: Data were collected from the Malaysian Thalassaemia Registry from 2007 until the fourth quarter of 2018. PRIMARY OUTCOME MEASURE: 7984 out of 8681 patients with thalassaemia registered in the Malaysian Thalassaemia Registry were reported alive. RESULTS: Majority of the patients were reported in the state of Sabah (22.72%); the largest age group affected was 5.0-24.9 years old (64.45%); the largest ethnic group involved was Malay (63.95%); and the major diagnosis was haemoglobin E/ß-thalassaemia (34.37%). From the 7984 patients, 56.73% were on regular blood transfusions and 61.72% were on chelation therapy. A small fraction (14.23%) has undergone splenectomy, while the percentage of patients with severe iron overload (serum ferritin ≥5000 µg/L) reduced over time. However, cardiac complications are still the main cause of death in patients with thalassaemia. CONCLUSION: Data gathered into the registry can be used to understand the progression of the disorder, to monitor iron overload management and to improve the outcomes of treatment, to enhance preventive strategies, reduce healthcare burden and improve the quality of life. Sustainability of the Malaysian Thalassaemia Registry is important for surveillance of thalassaemia management in the country and help the national health authorities to develop more effective policies.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and ß-globin gene mutations were characterized using DNA amplification and genomic sequencing. RESULTS: Ten ß- and 2 previously reported α-globin defects were identified. The Filipino ß-deletion represented the majority of the ß-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The ß-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with ß-thalassemia did not ameliorate the severity of thalassemia major in the patients. CONCLUSION: The Filipino ß-deletion was the most common gene defect observed. Homozygosity for the Filipino ß-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Limb salvage in osteosarcoma using autoclaved tumor-bearing bone.

BACKGROUND: Tumor prostheses currently give the best short- and medium-term results for limb-salvage reconstruction procedures in the treatment of bone tumors. However, in developing countries, the cost of a tumor prosthesis is beyond the reach of much of the population. We report the use of autoclaved tumor-bearing bone in 10 patients, as an affordable alternative to the use of prostheses. METHODS: This is a case series of 10 patients (mean age 19 years) with osteosarcoma who were treated at our hospital from 1998 to 2008, and followed up for a mean of 35 months (range 14 to 8). The femur was involved in six cases, the humerus in three cases, and the ulna in one case. The mean length of the autoclaved bone was 150 mm (range 60-210). RESULTS: Bone union occurred in seven patients over an mean duration of 12 months (range 8-17). Three patients had non-union. Two of these had associated implant failure, with one of them also developing chronic infection, and the third is still being followed up. Two other patients had local recurrence. CONCLUSION: The use of autoclaved tumor grafts provides an inexpensive limb-salvage option without sacrificing appropriate oncologic principles. A painless and stable limb is achievable, and the use of this technique can be further refined.

GATA1 mutations in patients with down syndrome and acute megakaryoblastic leukaemia do not always confer a good prognosis.

Children with Down syndrome and acute megakaryoblastic leukemia (DS-AMKL) have been shown to have increased sensitivity to cytarabine based chemotherapy. The excellent prognosis in patients with DS-AMKL may be due to mutations in the GATA1 gene leading to reduced expression of the enzyme cytidine deaminase. This leads to a decreased ability to convert cytarabine into its inactive metabolite, resulting in high intracellular concentration of this cytotoxic agent. We report two cases of DS-AMKL with GATA1 mutations who had poor outcome. These patients had high expression levels of cytidine deaminase mRNA transcripts. We speculate that other factors can affect overall outcome in patients with DS-AMKL irrespective of the presence of GATA1 mutations.