Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 42
Filtrar
Más filtros










Intervalo de año de publicación
1.
Nat Commun ; 15(1): 3284, 2024 Apr 16.
Artículo en Inglés | MEDLINE | ID: mdl-38627386

RESUMEN

The rapid evolution of SARS-CoV-2 is driven in part by a need to evade the antibody response in the face of high levels of immunity. Here, we isolate spike (S) binding monoclonal antibodies (mAbs) from vaccinees who suffered vaccine break-through infections with Omicron sub lineages BA.4 or BA.5. Twenty eight potent antibodies are isolated and characterised functionally, and in some cases structurally. Since the emergence of BA.4/5, SARS-CoV-2 has continued to accrue mutations in the S protein, to understand this we characterize neutralization of a large panel of variants and demonstrate a steady attrition of neutralization by the panel of BA.4/5 mAbs culminating in total loss of function with recent XBB.1.5.70 variants containing the so-called 'FLip' mutations at positions 455 and 456. Interestingly, activity of some mAbs is regained on the recently reported variant BA.2.86.


Asunto(s)
Anticuerpos Monoclonales , Complicaciones Posoperatorias , Humanos , Mutación , SARS-CoV-2/genética , Anticuerpos Neutralizantes , Anticuerpos Antivirales
2.
Angew Chem Int Ed Engl ; 63(13): e202318863, 2024 Mar 22.
Artículo en Inglés | MEDLINE | ID: mdl-38271265

RESUMEN

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen)2 phi]2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG)2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence.


Asunto(s)
Complejos de Coordinación , Compuestos Organometálicos , Rutenio , Compuestos Organometálicos/química , ADN/química , Oligonucleótidos/química , Complejos de Coordinación/química , Temperatura , Rutenio/química
3.
Elife ; 122023 03 07.
Artículo en Inglés | MEDLINE | ID: mdl-36881464

RESUMEN

Much of our current understanding of how small-molecule ligands interact with proteins stems from X-ray crystal structures determined at cryogenic (cryo) temperature. For proteins alone, room-temperature (RT) crystallography can reveal previously hidden, biologically relevant alternate conformations. However, less is understood about how RT crystallography may impact the conformational landscapes of protein-ligand complexes. Previously, we showed that small-molecule fragments cluster in putative allosteric sites using a cryo crystallographic screen of the therapeutic target PTP1B (Keedy et al., 2018). Here, we have performed two RT crystallographic screens of PTP1B using many of the same fragments, representing the largest RT crystallographic screens of a diverse library of ligands to date, and enabling a direct interrogation of the effect of data collection temperature on protein-ligand interactions. We show that at RT, fewer ligands bind, and often more weakly - but with a variety of temperature-dependent differences, including unique binding poses, changes in solvation, new binding sites, and distinct protein allosteric conformational responses. Overall, this work suggests that the vast body of existing cryo-temperature protein-ligand structures may provide an incomplete picture, and highlights the potential of RT crystallography to help complete this picture by revealing distinct conformational modes of protein-ligand systems. Our results may inspire future use of RT crystallography to interrogate the roles of protein-ligand conformational ensembles in biological function.


Asunto(s)
Cristalografía , Proteína Tirosina Fosfatasa no Receptora Tipo 1 , Sitio Alostérico , Sitios de Unión , Ligandos , Temperatura , Proteína Tirosina Fosfatasa no Receptora Tipo 1/química
4.
Cell Rep ; 42(4): 112271, 2023 04 25.
Artículo en Inglés | MEDLINE | ID: mdl-36995936

RESUMEN

In November 2021, Omicron BA.1, containing a raft of new spike mutations, emerged and quickly spread globally. Intense selection pressure to escape the antibody response produced by vaccines or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection then led to a rapid succession of Omicron sub-lineages with waves of BA.2 and then BA.4/5 infection. Recently, many variants have emerged such as BQ.1 and XBB, which carry up to 8 additional receptor-binding domain (RBD) amino acid substitutions compared with BA.2. We describe a panel of 25 potent monoclonal antibodies (mAbs) generated from vaccinees suffering BA.2 breakthrough infections. Epitope mapping shows potent mAb binding shifting to 3 clusters, 2 corresponding to early-pandemic binding hotspots. The RBD mutations in recent variants map close to these binding sites and knock out or severely knock down neutralization activity of all but 1 potent mAb. This recent mAb escape corresponds with large falls in neutralization titer of vaccine or BA.1, BA.2, or BA.4/5 immune serum.


Asunto(s)
Formación de Anticuerpos , COVID-19 , Humanos , SARS-CoV-2 , Sustitución de Aminoácidos , Anticuerpos Monoclonales , Anticuerpos Antivirales , Anticuerpos Neutralizantes
5.
Cell Rep ; 42(1): 111903, 2023 01 31.
Artículo en Inglés | MEDLINE | ID: mdl-36586406

RESUMEN

Variants of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) have caused successive global waves of infection. These variants, with multiple mutations in the spike protein, are thought to facilitate escape from natural and vaccine-induced immunity and often increase in affinity for ACE2. The latest variant to cause concern is BA.2.75, identified in India where it is now the dominant strain, with evidence of wider dissemination. BA.2.75 is derived from BA.2 and contains four additional mutations in the receptor-binding domain (RBD). Here, we perform an antigenic and biophysical characterization of BA.2.75, revealing an interesting balance between humoral evasion and ACE2 receptor affinity. ACE2 affinity for BA.2.75 is increased 9-fold compared with BA.2; there is also evidence of escape of BA.2.75 from immune serum, particularly that induced by Delta infection, which may explain the rapid spread in India, where where there is a high background of Delta infection. ACE2 affinity appears to be prioritized over greater escape.


Asunto(s)
COVID-19 , Hepatitis D , Humanos , Enzima Convertidora de Angiotensina 2 , SARS-CoV-2 , Anticuerpos
6.
Cell ; 185(12): 2116-2131.e18, 2022 06 09.
Artículo en Inglés | MEDLINE | ID: mdl-35662412

RESUMEN

Highly transmissible Omicron variants of SARS-CoV-2 currently dominate globally. Here, we compare neutralization of Omicron BA.1, BA.1.1, and BA.2. BA.2 RBD has slightly higher ACE2 affinity than BA.1 and slightly reduced neutralization by vaccine serum, possibly associated with its increased transmissibility. Neutralization differences between sub-lineages for mAbs (including therapeutics) mostly arise from variation in residues bordering the ACE2 binding site; however, more distant mutations S371F (BA.2) and R346K (BA.1.1) markedly reduce neutralization by therapeutic antibody Vir-S309. In-depth structure-and-function analyses of 27 potent RBD-binding mAbs isolated from vaccinated volunteers following breakthrough Omicron-BA.1 infection reveals that they are focused in two main clusters within the RBD, with potent right-shoulder antibodies showing increased prevalence. Selection and somatic maturation have optimized antibody potency in less-mutated epitopes and recovered potency in highly mutated epitopes. All 27 mAbs potently neutralize early pandemic strains, and many show broad reactivity with variants of concern.


Asunto(s)
Anticuerpos Monoclonales , Vacunas contra la COVID-19/inmunología , SARS-CoV-2 , Glicoproteína de la Espiga del Coronavirus , Enzima Convertidora de Angiotensina 2 , Anticuerpos Monoclonales/química , Anticuerpos Monoclonales/genética , Anticuerpos Antivirales , COVID-19 , Vacunas contra la COVID-19/administración & dosificación , Epítopos , Humanos , Pruebas de Neutralización , SARS-CoV-2/clasificación , SARS-CoV-2/genética , Glicoproteína de la Espiga del Coronavirus/química
7.
Cell ; 185(14): 2422-2433.e13, 2022 07 07.
Artículo en Inglés | MEDLINE | ID: mdl-35772405

RESUMEN

The Omicron lineage of SARS-CoV-2, which was first described in November 2021, spread rapidly to become globally dominant and has split into a number of sublineages. BA.1 dominated the initial wave but has been replaced by BA.2 in many countries. Recent sequencing from South Africa's Gauteng region uncovered two new sublineages, BA.4 and BA.5, which are taking over locally, driving a new wave. BA.4 and BA.5 contain identical spike sequences, and although closely related to BA.2, they contain further mutations in the receptor-binding domain of their spikes. Here, we study the neutralization of BA.4/5 using a range of vaccine and naturally immune serum and panels of monoclonal antibodies. BA.4/5 shows reduced neutralization by the serum from individuals vaccinated with triple doses of AstraZeneca or Pfizer vaccine compared with BA.1 and BA.2. Furthermore, using the serum from BA.1 vaccine breakthrough infections, there are, likewise, significant reductions in the neutralization of BA.4/5, raising the possibility of repeat Omicron infections.


Asunto(s)
COVID-19 , Vacunas Virales , Anticuerpos Neutralizantes , Anticuerpos Antivirales , COVID-19/prevención & control , Humanos , Pruebas de Neutralización , SARS-CoV-2/genética , Sudáfrica
8.
Nature ; 607(7918): 387-392, 2022 07.
Artículo en Inglés | MEDLINE | ID: mdl-35732733

RESUMEN

The α-helix is pre-eminent in structural biology1 and widely exploited in protein folding2, design3 and engineering4. Although other helical peptide conformations do exist near to the α-helical region of conformational space-namely, 310-helices and π-helices5-these occur much less frequently in protein structures. Less favourable internal energies and reduced tendencies to pack into higher-order structures mean that 310-helices rarely exceed six residues in length in natural proteins, and that they tend not to form normal supersecondary, tertiary or quaternary interactions. Here we show that despite their absence in nature, synthetic peptide assemblies can be built from 310-helices. We report the rational design, solution-phase characterization and an X-ray crystal structure for water-soluble bundles of 310-helices with consolidated hydrophobic cores. The design uses six-residue repeats informed by analysing 310-helical conformations in known protein structures, and incorporates α-aminoisobutyric acid residues. Design iterations reveal a tipping point between α-helical and 310-helical folding, and identify features required for stabilizing assemblies of 310-helices. This work provides principles and rules to open opportunities for designing into this hitherto unexplored region of protein-structure space.


Asunto(s)
Péptidos , Estructura Secundaria de Proteína , Cristalografía por Rayos X , Diseño de Fármacos , Interacciones Hidrofóbicas e Hidrofílicas , Péptidos/síntesis química , Péptidos/química , Pliegue de Proteína , Estabilidad Proteica
9.
J Am Chem Soc ; 144(13): 5956-5964, 2022 04 06.
Artículo en Inglés | MEDLINE | ID: mdl-35324198

RESUMEN

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.


Asunto(s)
G-Cuádruplex , Rutenio , Dicroismo Circular , ADN/química , Humanos , Rutenio/química , Telómero/metabolismo
10.
Cell Host Microbe ; 30(1): 53-68.e12, 2022 01 12.
Artículo en Inglés | MEDLINE | ID: mdl-34921776

RESUMEN

Alpha-B.1.1.7, Beta-B.1.351, Gamma-P.1, and Delta-B.1.617.2 variants of SARS-CoV-2 express multiple mutations in the spike protein (S). These may alter the antigenic structure of S, causing escape from natural or vaccine-induced immunity. Beta is particularly difficult to neutralize using serum induced by early pandemic SARS-CoV-2 strains and is most antigenically separated from Delta. To understand this, we generated 674 mAbs from Beta-infected individuals and performed a detailed structure-function analysis of the 27 most potent mAbs: one binding the spike N-terminal domain (NTD), the rest the receptor-binding domain (RBD). Two of these RBD-binding mAbs recognize a neutralizing epitope conserved between SARS-CoV-1 and -2, while 18 target mutated residues in Beta: K417N, E484K, and N501Y. There is a major response to N501Y, including a public IgVH4-39 sequence, with E484K and K417N also targeted. Recognition of these key residues underscores why serum from Beta cases poorly neutralizes early pandemic and Delta viruses.


Asunto(s)
Anticuerpos Antivirales/inmunología , Formación de Anticuerpos/inmunología , COVID-19/inmunología , SARS-CoV-2/inmunología , Animales , Anticuerpos Monoclonales/inmunología , Anticuerpos Neutralizantes/inmunología , Células Cultivadas , Chlorocebus aethiops , Femenino , Células HEK293 , Humanos , Masculino , Ratones , Ratones Transgénicos , Pruebas de Neutralización/métodos , Unión Proteica/inmunología , Glicoproteína de la Espiga del Coronavirus/inmunología , Células Vero
11.
J Med Chem ; 64(15): 11379-11394, 2021 08 12.
Artículo en Inglés | MEDLINE | ID: mdl-34337941

RESUMEN

The effectiveness of ß-lactam antibiotics is increasingly compromised by ß-lactamases. Boron-containing inhibitors are potent serine-ß-lactamase inhibitors, but the interactions of boron-based compounds with the penicillin-binding protein (PBP) ß-lactam targets have not been extensively studied. We used high-throughput X-ray crystallography to explore reactions of a boron-containing fragment set with the Pseudomonas aeruginosa PBP3 (PaPBP3). Multiple crystal structures reveal that boronic acids react with PBPs to give tricovalently linked complexes bonded to Ser294, Ser349, and Lys484 of PaPBP3; benzoxaboroles react with PaPBP3 via reaction with two nucleophilic serines (Ser294 and Ser349) to give dicovalently linked complexes; and vaborbactam reacts to give a monocovalently linked complex. Modifications of the benzoxaborole scaffold resulted in a moderately potent inhibition of PaPBP3, though no antibacterial activity was observed. Overall, the results further evidence the potential for the development of new classes of boron-based antibiotics, which are not compromised by ß-lactamase-driven resistance.


Asunto(s)
Antibacterianos/farmacología , Compuestos de Boro/farmacología , Ensayos Analíticos de Alto Rendimiento , Proteínas de Unión a las Penicilinas/antagonistas & inhibidores , Pseudomonas aeruginosa/efectos de los fármacos , Inhibidores de beta-Lactamasas/farmacología , Antibacterianos/síntesis química , Antibacterianos/química , Sitios de Unión/efectos de los fármacos , Compuestos de Boro/síntesis química , Compuestos de Boro/química , Cristalografía por Rayos X , Relación Dosis-Respuesta a Droga , Pruebas de Sensibilidad Microbiana , Modelos Moleculares , Estructura Molecular , Proteínas de Unión a las Penicilinas/metabolismo , Relación Estructura-Actividad , Inhibidores de beta-Lactamasas/síntesis química , Inhibidores de beta-Lactamasas/química , beta-Lactamasas
12.
Cell ; 184(16): 4220-4236.e13, 2021 08 05.
Artículo en Inglés | MEDLINE | ID: mdl-34242578

RESUMEN

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has undergone progressive change, with variants conferring advantage rapidly becoming dominant lineages, e.g., B.1.617. With apparent increased transmissibility, variant B.1.617.2 has contributed to the current wave of infection ravaging the Indian subcontinent and has been designated a variant of concern in the United Kingdom. Here we study the ability of monoclonal antibodies and convalescent and vaccine sera to neutralize B.1.617.1 and B.1.617.2, complement this with structural analyses of Fab/receptor binding domain (RBD) complexes, and map the antigenic space of current variants. Neutralization of both viruses is reduced compared with ancestral Wuhan-related strains, but there is no evidence of widespread antibody escape as seen with B.1.351. However, B.1.351 and P.1 sera showed markedly more reduction in neutralization of B.1.617.2, suggesting that individuals infected previously by these variants may be more susceptible to reinfection by B.1.617.2. This observation provides important new insights for immunization policy with future variant vaccines in non-immune populations.


Asunto(s)
Anticuerpos Antivirales/inmunología , Vacunas contra la COVID-19/inmunología , SARS-CoV-2/inmunología , Animales , Anticuerpos Monoclonales/inmunología , Anticuerpos Neutralizantes/inmunología , Complejo Antígeno-Anticuerpo/química , COVID-19/patología , COVID-19/terapia , COVID-19/virología , Vacunas contra la COVID-19/administración & dosificación , Chlorocebus aethiops , Cristalografía por Rayos X , Humanos , Inmunización Pasiva , Pruebas de Neutralización , Dominios Proteicos/inmunología , SARS-CoV-2/genética , SARS-CoV-2/aislamiento & purificación , Glicoproteína de la Espiga del Coronavirus/química , Glicoproteína de la Espiga del Coronavirus/inmunología , Células Vero , Sueroterapia para COVID-19
13.
Cell ; 184(11): 2939-2954.e9, 2021 05 27.
Artículo en Inglés | MEDLINE | ID: mdl-33852911

RESUMEN

Terminating the SARS-CoV-2 pandemic relies upon pan-global vaccination. Current vaccines elicit neutralizing antibody responses to the virus spike derived from early isolates. However, new strains have emerged with multiple mutations, including P.1 from Brazil, B.1.351 from South Africa, and B.1.1.7 from the UK (12, 10, and 9 changes in the spike, respectively). All have mutations in the ACE2 binding site, with P.1 and B.1.351 having a virtually identical triplet (E484K, K417N/T, and N501Y), which we show confer similar increased affinity for ACE2. We show that, surprisingly, P.1 is significantly less resistant to naturally acquired or vaccine-induced antibody responses than B.1.351, suggesting that changes outside the receptor-binding domain (RBD) impact neutralization. Monoclonal antibody (mAb) 222 neutralizes all three variants despite interacting with two of the ACE2-binding site mutations. We explain this through structural analysis and use the 222 light chain to largely restore neutralization potency to a major class of public antibodies.


Asunto(s)
Anticuerpos Monoclonales/inmunología , Anticuerpos Neutralizantes/inmunología , Anticuerpos Antivirales/inmunología , COVID-19/inmunología , SARS-CoV-2/inmunología , Glicoproteína de la Espiga del Coronavirus/inmunología , Sitios de Unión , COVID-19/terapia , COVID-19/virología , Línea Celular , Humanos , Evasión Inmune , Inmunización Pasiva , Mutación , Unión Proteica , Dominios Proteicos , SARS-CoV-2/genética , Eliminación de Secuencia , Glicoproteína de la Espiga del Coronavirus/química , Glicoproteína de la Espiga del Coronavirus/genética , Vacunación , Vacunas/inmunología , Sueroterapia para COVID-19
14.
Cell ; 184(8): 2183-2200.e22, 2021 04 15.
Artículo en Inglés | MEDLINE | ID: mdl-33756110

RESUMEN

Antibodies are crucial to immune protection against SARS-CoV-2, with some in emergency use as therapeutics. Here, we identify 377 human monoclonal antibodies (mAbs) recognizing the virus spike and focus mainly on 80 that bind the receptor binding domain (RBD). We devise a competition data-driven method to map RBD binding sites. We find that although antibody binding sites are widely dispersed, neutralizing antibody binding is focused, with nearly all highly inhibitory mAbs (IC50 < 0.1 µg/mL) blocking receptor interaction, except for one that binds a unique epitope in the N-terminal domain. Many of these neutralizing mAbs use public V-genes and are close to germline. We dissect the structural basis of recognition for this large panel of antibodies through X-ray crystallography and cryoelectron microscopy of 19 Fab-antigen structures. We find novel binding modes for some potently inhibitory antibodies and demonstrate that strongly neutralizing mAbs protect, prophylactically or therapeutically, in animal models.


Asunto(s)
Anticuerpos Monoclonales/inmunología , Anticuerpos Neutralizantes/inmunología , Anticuerpos Antivirales/inmunología , COVID-19/inmunología , Glicoproteína de la Espiga del Coronavirus/inmunología , Animales , Sitios de Unión de Anticuerpos , Células CHO , Chlorocebus aethiops , Cricetulus , Epítopos , Femenino , Células HEK293 , Humanos , Masculino , Ratones , Ratones Transgénicos , Modelos Moleculares , Unión Proteica , Estructura Terciaria de Proteína , SARS-CoV-2/inmunología , Células Vero
15.
Cell ; 184(8): 2201-2211.e7, 2021 04 15.
Artículo en Inglés | MEDLINE | ID: mdl-33743891

RESUMEN

SARS-CoV-2 has caused over 2 million deaths in little over a year. Vaccines are being deployed at scale, aiming to generate responses against the virus spike. The scale of the pandemic and error-prone virus replication is leading to the appearance of mutant viruses and potentially escape from antibody responses. Variant B.1.1.7, now dominant in the UK, with increased transmission, harbors 9 amino acid changes in the spike, including N501Y in the ACE2 interacting surface. We examine the ability of B.1.1.7 to evade antibody responses elicited by natural SARS-CoV-2 infection or vaccination. We map the impact of N501Y by structure/function analysis of a large panel of well-characterized monoclonal antibodies. B.1.1.7 is harder to neutralize than parental virus, compromising neutralization by some members of a major class of public antibodies through light-chain contacts with residue 501. However, widespread escape from monoclonal antibodies or antibody responses generated by natural infection or vaccination was not observed.


Asunto(s)
Anticuerpos Monoclonales/inmunología , Anticuerpos Neutralizantes/inmunología , Anticuerpos Antivirales/inmunología , COVID-19/inmunología , SARS-CoV-2/inmunología , Glicoproteína de la Espiga del Coronavirus/inmunología , Animales , Anticuerpos Neutralizantes/sangre , Anticuerpos Antivirales/sangre , Células CHO , COVID-19/epidemiología , Chlorocebus aethiops , Cricetulus , Células HEK293 , Humanos , Pandemias , Unión Proteica , Relación Estructura-Actividad , Células Vero
16.
Preprint en Inglés | Fiocruz Preprints | ID: ppf-47927

RESUMEN

A pesquisa aponta que o soro de pessoas previamente infectadas por outras cepas é menos potente contra esta variante viral. O problema é observado de forma marcante entre os indivíduos anteriormente infectados pela variante Gama, identificada originalmente em Manaus e atualmente dominante no Brasil, assim como pela variante Beta, detectada pela primeira vez na África do Sul. Nestes casos, a capacidade de neutralizar a cepa Delta é onze vezes menor. O soro de pessoas vacinadas também tem potência reduzida contra a variante originária da Índia, mas os dados apontam que as vacinas continuam efetivas. A capacidade de neutralizar a cepa é 2,5 vezes menor para o imunizante da Pfizer e 4,3 vezes menor para o da Astrazeneca. Os autores do trabalho ressaltam que os índices são semelhantes aos verificados com as variantes Gama e Alfa ­ que emergiram no Brasil e no Reino Unido, respectivamente. Não há evidência de fuga generalizada da neutralização, diferentemente do registrado com a variante Beta ­ com origem na África do Sul.

18.
Nat Struct Mol Biol ; 27(10): 950-958, 2020 10.
Artículo en Inglés | MEDLINE | ID: mdl-32737466

RESUMEN

The COVID-19 pandemic has had an unprecedented health and economic impact and there are currently no approved therapies. We have isolated an antibody, EY6A, from an individual convalescing from COVID-19 and have shown that it neutralizes SARS-CoV-2 and cross-reacts with SARS-CoV-1. EY6A Fab binds the receptor binding domain (RBD) of the viral spike glycoprotein tightly (KD of 2 nM), and a 2.6-Å-resolution crystal structure of an RBD-EY6A Fab complex identifies the highly conserved epitope, away from the ACE2 receptor binding site. Residues within this footprint are key to stabilizing the pre-fusion spike. Cryo-EM analyses of the pre-fusion spike incubated with EY6A Fab reveal a complex of the intact spike trimer with three Fabs bound and two further multimeric forms comprising the destabilized spike attached to Fab. EY6A binds what is probably a major neutralizing epitope, making it a candidate therapeutic for COVID-19.


Asunto(s)
Anticuerpos Antivirales/química , Betacoronavirus/química , Infecciones por Coronavirus/inmunología , Neumonía Viral/inmunología , Glicoproteína de la Espiga del Coronavirus/química , Adulto , Enzima Convertidora de Angiotensina 2 , Animales , Anticuerpos Neutralizantes/inmunología , Anticuerpos Antivirales/inmunología , Anticuerpos Antivirales/metabolismo , Betacoronavirus/inmunología , Betacoronavirus/metabolismo , Sitios de Unión , COVID-19 , Chlorocebus aethiops , Reacciones Cruzadas , Microscopía por Crioelectrón , Cristalografía por Rayos X , Epítopos , Humanos , Fragmentos Fab de Inmunoglobulinas/química , Fragmentos Fab de Inmunoglobulinas/metabolismo , Masculino , Pandemias , Peptidil-Dipeptidasa A/metabolismo , Conformación Proteica , Dominios Proteicos , SARS-CoV-2 , Glicoproteína de la Espiga del Coronavirus/inmunología , Glicoproteína de la Espiga del Coronavirus/metabolismo , Células Vero
19.
Cell Host Microbe ; 28(3): 445-454.e6, 2020 09 09.
Artículo en Inglés | MEDLINE | ID: mdl-32585135

RESUMEN

There are as yet no licensed therapeutics for the COVID-19 pandemic. The causal coronavirus (SARS-CoV-2) binds host cells via a trimeric spike whose receptor binding domain (RBD) recognizes angiotensin-converting enzyme 2, initiating conformational changes that drive membrane fusion. We find that the monoclonal antibody CR3022 binds the RBD tightly, neutralizing SARS-CoV-2, and report the crystal structure at 2.4 Å of the Fab/RBD complex. Some crystals are suitable for screening for entry-blocking inhibitors. The highly conserved, structure-stabilizing CR3022 epitope is inaccessible in the prefusion spike, suggesting that CR3022 binding facilitates conversion to the fusion-incompetent post-fusion state. Cryogenic electron microscopy (cryo-EM) analysis confirms that incubation of spike with CR3022 Fab leads to destruction of the prefusion trimer. Presentation of this cryptic epitope in an RBD-based vaccine might advantageously focus immune responses. Binders at this epitope could be useful therapeutically, possibly in synergy with an antibody that blocks receptor attachment.


Asunto(s)
Anticuerpos Neutralizantes/inmunología , Anticuerpos Antivirales/inmunología , Betacoronavirus/química , Betacoronavirus/inmunología , Infecciones por Coronavirus/terapia , Neumonía Viral/terapia , Glicoproteína de la Espiga del Coronavirus/química , Glicoproteína de la Espiga del Coronavirus/inmunología , Sitio Alostérico , Secuencia de Aminoácidos , Enzima Convertidora de Angiotensina 2 , Anticuerpos Monoclonales/inmunología , Anticuerpos Neutralizantes/uso terapéutico , Anticuerpos Antivirales/uso terapéutico , Complejo Antígeno-Anticuerpo/química , Betacoronavirus/genética , COVID-19 , Vacunas contra la COVID-19 , Infecciones por Coronavirus/tratamiento farmacológico , Infecciones por Coronavirus/inmunología , Infecciones por Coronavirus/prevención & control , Infecciones por Coronavirus/virología , Microscopía por Crioelectrón , Cristalografía por Rayos X , Interacciones Microbiota-Huesped/inmunología , Humanos , Modelos Moleculares , Pruebas de Neutralización , Pandemias , Peptidil-Dipeptidasa A/química , Neumonía Viral/inmunología , Neumonía Viral/virología , Receptores Virales/química , SARS-CoV-2 , Glicoproteína de la Espiga del Coronavirus/genética , Vacunas Virales/inmunología , Vacunas Virales/uso terapéutico , Internalización del Virus , Tratamiento Farmacológico de COVID-19
20.
Acta Crystallogr D Struct Biol ; 75(Pt 3): 242-261, 2019 Mar 01.
Artículo en Inglés | MEDLINE | ID: mdl-30950396

RESUMEN

Strategies for collecting X-ray diffraction data have evolved alongside beamline hardware and detector developments. The traditional approaches for diffraction data collection have emphasised collecting data from noisy integrating detectors (i.e. film, image plates and CCD detectors). With fast pixel array detectors on stable beamlines, the limiting factor becomes the sample lifetime, and the question becomes one of how to expend the photons that your sample can diffract, i.e. as a smaller number of stronger measurements or a larger number of weaker data. This parameter space is explored via experiment and synthetic data treatment and advice is derived on how best to use the equipment on a modern beamline. Suggestions are also made on how to acquire data in a conservative manner if very little is known about the sample lifetime.


Asunto(s)
Fotones , Difracción de Rayos X/métodos , Análisis de Datos , Recolección de Datos
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA
...